ID: 1103320011

View in Genome Browser
Species Human (GRCh38)
Location 12:120086996-120087018
Sequence TGGGCCCATCTGTCCCTCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 117}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103320005_1103320011 3 Left 1103320005 12:120086970-120086992 CCGGCGCTGCGCCGCGGCTGTAG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1103320011 12:120086996-120087018 TGGGCCCATCTGTCCCTCGCCGG 0: 1
1: 0
2: 1
3: 14
4: 117
1103320008_1103320011 -8 Left 1103320008 12:120086981-120087003 CCGCGGCTGTAGCCCTGGGCCCA 0: 1
1: 0
2: 3
3: 23
4: 251
Right 1103320011 12:120086996-120087018 TGGGCCCATCTGTCCCTCGCCGG 0: 1
1: 0
2: 1
3: 14
4: 117
1103320004_1103320011 4 Left 1103320004 12:120086969-120086991 CCCGGCGCTGCGCCGCGGCTGTA 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1103320011 12:120086996-120087018 TGGGCCCATCTGTCCCTCGCCGG 0: 1
1: 0
2: 1
3: 14
4: 117
1103319999_1103320011 14 Left 1103319999 12:120086959-120086981 CCCCACCATGCCCGGCGCTGCGC 0: 1
1: 0
2: 3
3: 12
4: 190
Right 1103320011 12:120086996-120087018 TGGGCCCATCTGTCCCTCGCCGG 0: 1
1: 0
2: 1
3: 14
4: 117
1103320000_1103320011 13 Left 1103320000 12:120086960-120086982 CCCACCATGCCCGGCGCTGCGCC 0: 1
1: 0
2: 1
3: 6
4: 128
Right 1103320011 12:120086996-120087018 TGGGCCCATCTGTCCCTCGCCGG 0: 1
1: 0
2: 1
3: 14
4: 117
1103320001_1103320011 12 Left 1103320001 12:120086961-120086983 CCACCATGCCCGGCGCTGCGCCG 0: 1
1: 0
2: 1
3: 25
4: 314
Right 1103320011 12:120086996-120087018 TGGGCCCATCTGTCCCTCGCCGG 0: 1
1: 0
2: 1
3: 14
4: 117
1103320002_1103320011 9 Left 1103320002 12:120086964-120086986 CCATGCCCGGCGCTGCGCCGCGG 0: 1
1: 0
2: 2
3: 22
4: 231
Right 1103320011 12:120086996-120087018 TGGGCCCATCTGTCCCTCGCCGG 0: 1
1: 0
2: 1
3: 14
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103320011 Original CRISPR TGGGCCCATCTGTCCCTCGC CGG Intronic
900144050 1:1150382-1150404 TGAGCCCTCCTGCCCCTCGCCGG - Intergenic
900251809 1:1674874-1674896 TGGGCGCCTCTGCTCCTCGCTGG + Intronic
900262216 1:1737730-1737752 TGGGCGCCTCTGCTCCTCGCTGG + Intronic
900395756 1:2452618-2452640 TGGGCCCATCTGCTGCTCTCTGG - Intronic
901689754 1:10965097-10965119 TGGGTCCCTCTGCCCCTCCCAGG + Intronic
902785692 1:18731298-18731320 TGGGCCTAAATGCCCCTCGCTGG - Intronic
904679258 1:32217316-32217338 TGTGCCCATCTGTAACTCTCTGG - Exonic
905172857 1:36119356-36119378 TGGGACCATCCTTCCCTGGCTGG - Intronic
905393622 1:37653382-37653404 TCTGCCCATCTCTCCCTCTCTGG - Intergenic
905793029 1:40800230-40800252 TGGGCCCATCCCTCCCTGGGAGG - Intronic
907553363 1:55323582-55323604 TGGGTCCATCTGTGCCTCACTGG - Intergenic
913071322 1:115301558-115301580 TGCCCCCATCTGGCCCTCTCTGG + Intronic
919429082 1:197470774-197470796 TGGGCCAAACAGTCCCTGGCAGG - Intronic
1072751774 10:97985919-97985941 TGTGGCCTTCTGTCCCTTGCTGG - Intronic
1072970010 10:100009635-100009657 TGCGCCCCACTGTCCCTCGCGGG + Intronic
1074114304 10:110444074-110444096 TGATGCCATCTGTCCCTGGCTGG - Intergenic
1077460289 11:2705662-2705684 TGGGCCCACTTTTCCCTGGCAGG - Intronic
1079452598 11:20610234-20610256 ATGGCCCATCATTCCCTCGCGGG + Intronic
1083838537 11:65288933-65288955 AGGGCTCATCTGTCCCTCCAAGG - Intronic
1084596041 11:70117627-70117649 TGTGCCCAGCTTTCCCTCTCGGG + Intronic
1084693369 11:70739623-70739645 GGGGCCCAGCTGACCCTGGCTGG - Intronic
1084700998 11:70785982-70786004 CGGGCCCATCTGTGCATAGCAGG - Intronic
1087677272 11:101177418-101177440 TGGGAGCATCTGTCCTTCACAGG + Intergenic
1094416362 12:30220183-30220205 TGTGCCCATGTGTCCCTTGAAGG - Intergenic
1095440973 12:42238368-42238390 TGGGCGCACGTGACCCTCGCCGG + Intergenic
1102826194 12:115949678-115949700 CTGGCCCCTCTGTCCCTCCCGGG - Intergenic
1103320011 12:120086996-120087018 TGGGCCCATCTGTCCCTCGCCGG + Intronic
1105325453 13:19366596-19366618 TGGTGCCATCTGTCTCTCCCAGG - Intergenic
1105867999 13:24478233-24478255 TGGTGCCATCTGTCTCTCCCGGG + Exonic
1106498618 13:30306787-30306809 TCGGCGCCTCTGACCCTCGCAGG - Intronic
1106559574 13:30836770-30836792 TGGGCTCACCTTTCCCTGGCAGG + Intergenic
1109151645 13:58856216-58856238 AGGTCCCTTGTGTCCCTCGCAGG + Intergenic
1113459658 13:110473002-110473024 GGGGCCCATCTGGCCCTGGCAGG - Exonic
1117495380 14:56296925-56296947 TGGGCCCCTATGTGCCTCTCTGG + Exonic
1121493757 14:94378158-94378180 TGGGCCCATCTGTTTCTGGAGGG - Exonic
1122950991 14:105044859-105044881 GGGGCCAATCTGGCCATCGCTGG - Intergenic
1127460510 15:59194458-59194480 TGGACACACCTGTCCCTCGCAGG + Intronic
1128498476 15:68211232-68211254 TGGGCCCATCTGTCTATCCCAGG - Intronic
1132656858 16:1045038-1045060 CAGGCCCCTCTGTCCCTCCCTGG - Intergenic
1132940862 16:2507448-2507470 TGGGCCCTAGTGTCCCTCCCAGG + Intronic
1136027780 16:27481039-27481061 TGGTTCCATGTGGCCCTCGCAGG - Intronic
1136655514 16:31706857-31706879 TGAGCCCATGTCTCCCTCCCTGG + Intergenic
1138097919 16:54227200-54227222 TGGGCCCAGATGTCCCTTGAGGG + Intergenic
1140856466 16:78982069-78982091 TTGGCCCATCTGAGCCTCACTGG + Intronic
1142238528 16:88934570-88934592 TGTCCCCATCTGTCCCTTGCGGG - Intronic
1142429287 16:90017923-90017945 TGAGCCCATCAGTCACTGGCTGG - Intronic
1143372509 17:6449204-6449226 TGGGCCCAGATGACCCTGGCGGG - Intronic
1143918887 17:10315150-10315172 TGGCCTCCTCTGTCCCCCGCAGG - Intronic
1145812197 17:27771125-27771147 TGTGCTCATCTGTCTCTCCCAGG + Intronic
1151800142 17:76374429-76374451 TGGGACCATCTGTACCTCAAGGG + Intronic
1152573042 17:81128821-81128843 CGGGCCCTGCTGTCCCTGGCCGG - Intronic
1155315483 18:24566796-24566818 TGCACCCATCTGTGCCTTGCAGG + Intergenic
1157802624 18:50633339-50633361 TGTGCCCATCCCACCCTCGCTGG + Intronic
1160437637 18:78863468-78863490 TGGGCTCCTCTGGCCCTCTCTGG - Intergenic
1160498975 18:79393249-79393271 TGGGCGCACCTGCCCCTGGCTGG + Intergenic
1160833196 19:1112758-1112780 TGGGCCCCTCTGTGCCTCTTGGG + Intronic
1160946339 19:1645635-1645657 TGGGGCAACCTGGCCCTCGCTGG + Intronic
1161221722 19:3120909-3120931 TGGGCCCCTTTGTCACTCCCAGG - Intronic
1161586194 19:5107122-5107144 TGGGCGCATCTGGCCAACGCAGG - Intronic
1162044077 19:7987346-7987368 TGGCCCCATATGTCCCTCGGGGG - Intronic
1163518604 19:17779287-17779309 TGGGCCCATCAGGCCCTTCCTGG - Intronic
1164011773 19:21209956-21209978 TAGGCCCCTCTGTCCCCCCCAGG + Intergenic
1165794079 19:38508614-38508636 TGGGGGCATCTGTTCCTTGCAGG + Intronic
1167209600 19:48125476-48125498 TAGGCCCATCTGTCCTTCGCCGG - Intronic
925018253 2:547766-547788 TGTGCCCAGCTGTTCCTCCCTGG - Intergenic
925018274 2:547880-547902 TGTGCCCAGCTGTCCCTCCTTGG - Intergenic
925726521 2:6877956-6877978 TGGTCTCATCTGGCCCTCTCAGG - Exonic
928319058 2:30268788-30268810 TGTTCCCATCTGTCTCTCTCTGG + Intronic
936089428 2:109491305-109491327 TGGGCCTATGTGTCCCACTCAGG + Intronic
942444900 2:176071391-176071413 TGGCAACATCTGTCCCTCTCCGG - Intergenic
947545839 2:231009571-231009593 TGGGCTCATCTCTCCCACACTGG + Intronic
948792088 2:240384372-240384394 TCGGCCCAGCTGTCCCCTGCTGG + Intergenic
1174057307 20:47806935-47806957 TTGGCCCATGTGTCCCTTCCGGG + Intergenic
1178349433 21:31861916-31861938 TCGGCCAATCTGTCCCTAGAGGG + Intergenic
1183422920 22:37722820-37722842 TGGGCCCACCTCTCCCTCCCTGG + Intronic
950440466 3:13007377-13007399 TGGGCCCAGCTGCCCCTGGGAGG + Intronic
950902977 3:16513616-16513638 TCGGTGCGTCTGTCCCTCGCCGG + Exonic
954065996 3:48106585-48106607 TGTGTCCATCTGACCCTCACTGG + Intergenic
954745915 3:52787483-52787505 TGGGCCCAGCCGTCCCTCTGGGG - Intronic
956459062 3:69453650-69453672 TGTGCCCATCTCTCCCCCACTGG - Intronic
959764313 3:110006783-110006805 TGGGCCTATCTTTCCCTGGTAGG + Intergenic
960868728 3:122228562-122228584 TAGACCCATCTGTCTCTGGCTGG + Intronic
961387363 3:126530124-126530146 TGTGCCCATCTGTCCCTCCATGG + Intronic
961647357 3:128399796-128399818 TGGGCCTCTCTGTCCCCAGCCGG + Intronic
961650364 3:128413968-128413990 TGGGCCCAGCGGCCCCTCGGCGG - Intergenic
961661418 3:128470617-128470639 TGGGCCCTGCCGTCCCTCACCGG + Intergenic
963042188 3:141078085-141078107 TGGGCCCATCAGACACTCACAGG - Intronic
963893192 3:150658643-150658665 TGGGCTCCTCTGTCTCTCCCAGG + Intergenic
967305036 3:188051742-188051764 TGTGCCCATCTCTCTCTCCCTGG + Intergenic
968497910 4:928556-928578 TGGCCCCATGTGTCCTCCGCAGG - Intronic
968573176 4:1353168-1353190 GGGGCCCACCTGGCCCGCGCAGG - Exonic
969311876 4:6357661-6357683 TAGGCCCACCTGTCCCTCCAGGG - Intronic
969850563 4:9953377-9953399 TGGGCCCACCTGGCCCTCAGTGG - Intronic
975401485 4:73944225-73944247 GGGACCCATCTGCCGCTCGCCGG + Intergenic
979448478 4:120840684-120840706 GGGGCCCCTCTGTCCATCACAGG + Intronic
984734851 4:183099367-183099389 TGCGCCCCTCAGCCCCTCGCCGG + Exonic
985913261 5:2898912-2898934 TGGACCCATCTGTCCTGAGCAGG - Intergenic
993743907 5:91572634-91572656 TGGGCCCAGCTGTGCCAAGCTGG - Intergenic
994329289 5:98487211-98487233 TGGTCCCATATGTCCCTGGCTGG - Intergenic
998152115 5:139763499-139763521 TGGGCCCACTTGTCCCTTGCTGG + Intergenic
1002579447 5:180198877-180198899 TGGGCCCAGCTCTGCCTCCCTGG - Intronic
1005700920 6:28399570-28399592 TGGGCCCCTCAGGCCCTGGCCGG - Intronic
1006102040 6:31691593-31691615 GGGGCTCAGCTGTCCCCCGCCGG + Exonic
1006896777 6:37476253-37476275 TGAGCCCTCCTGTCCCTCACTGG - Intronic
1007505720 6:42333741-42333763 GGGGCCCATGTGGCCCTCGGAGG - Intronic
1018909099 6:168091688-168091710 TGGGCCCATGTGTCACTCGGAGG - Intergenic
1018941343 6:168310360-168310382 TGACCACATCTCTCCCTCGCTGG - Exonic
1019255290 7:45919-45941 TGGGCCTGTCTTTCCCTTGCTGG - Intergenic
1019305172 7:330843-330865 TGAGCCCGTCTTTCCCTCTCCGG - Intergenic
1019383386 7:740002-740024 TGGTGCCATCAGTCCCTGGCTGG - Intronic
1019578617 7:1749408-1749430 AGGGCCCATCTGTCCCCTCCAGG + Intergenic
1022473704 7:30697217-30697239 TGGGCCCATCTGCCCCAAGAAGG - Intronic
1023342103 7:39231779-39231801 TGCGCCCCACTGGCCCTCGCTGG + Intronic
1023761013 7:43465345-43465367 TGGGCTCACCTGTCCATCGTGGG + Intronic
1023891808 7:44398154-44398176 CGGTCCCATCTGTCCCACGAAGG + Intronic
1029386233 7:100245471-100245493 GGGGCCCATCTACCCCTTGCTGG + Intronic
1032856048 7:135834408-135834430 TGGGTCCCTCTGCCCCTCACAGG - Intergenic
1034943548 7:155247856-155247878 TGAGCCCCTCAGCCCCTCGCTGG - Intergenic
1037936007 8:22915435-22915457 GGCTCCCATCTGTCCCTTGCTGG + Intronic
1041344449 8:56882183-56882205 TGGGCCCCACTGTCTCTCTCAGG + Intergenic
1042837780 8:73093161-73093183 AGGGCCCGGCTGTGCCTCGCCGG - Exonic
1043800887 8:84608298-84608320 TGGGCCAATCTGTCCCTGCAGGG + Intronic
1050382370 9:5042900-5042922 AGGGCCCACCTGCCCCTCGCCGG - Intronic
1058718530 9:107742845-107742867 TGGGCACGTCTGTACCTGGCAGG + Intergenic
1062037534 9:134389413-134389435 TGGGCGCCTCTGTCCCGGGCTGG + Intronic
1062354404 9:136154815-136154837 TGGGCCCTTCTGACCCTGGGGGG - Intergenic
1062630156 9:137459726-137459748 CGGGCCCCTCTGTCTCTCTCTGG - Intergenic
1062632584 9:137472039-137472061 TGAGCCCATCTGGACCTTGCTGG - Intronic
1062632598 9:137472111-137472133 TGAGCCCATCTGGACCTTGCTGG - Intronic
1203792074 EBV:157143-157165 GGTGCCCAGCTGTCCCTCGTAGG + Intergenic
1189492546 X:41481475-41481497 TGGGCACAGCTGTCCTTGGCTGG + Intergenic
1191754625 X:64580746-64580768 TGGGGCCATCTGTCCCTAACAGG + Intergenic
1196577745 X:117339573-117339595 TGGGCCTATCTTTCCCTAGAAGG - Intergenic