ID: 1103320018

View in Genome Browser
Species Human (GRCh38)
Location 12:120087021-120087043
Sequence ACGTTAGTCAGCACATTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103320005_1103320018 28 Left 1103320005 12:120086970-120086992 CCGGCGCTGCGCCGCGGCTGTAG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1103320018 12:120087021-120087043 ACGTTAGTCAGCACATTCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1103320004_1103320018 29 Left 1103320004 12:120086969-120086991 CCCGGCGCTGCGCCGCGGCTGTA 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1103320018 12:120087021-120087043 ACGTTAGTCAGCACATTCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1103320009_1103320018 5 Left 1103320009 12:120086993-120087015 CCCTGGGCCCATCTGTCCCTCGC 0: 1
1: 0
2: 1
3: 16
4: 262
Right 1103320018 12:120087021-120087043 ACGTTAGTCAGCACATTCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1103320012_1103320018 -2 Left 1103320012 12:120087000-120087022 CCCATCTGTCCCTCGCCGGCAAC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1103320018 12:120087021-120087043 ACGTTAGTCAGCACATTCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1103320013_1103320018 -3 Left 1103320013 12:120087001-120087023 CCATCTGTCCCTCGCCGGCAACG 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1103320018 12:120087021-120087043 ACGTTAGTCAGCACATTCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1103320008_1103320018 17 Left 1103320008 12:120086981-120087003 CCGCGGCTGTAGCCCTGGGCCCA 0: 1
1: 0
2: 3
3: 23
4: 251
Right 1103320018 12:120087021-120087043 ACGTTAGTCAGCACATTCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1103320010_1103320018 4 Left 1103320010 12:120086994-120087016 CCTGGGCCCATCTGTCCCTCGCC 0: 1
1: 0
2: 0
3: 27
4: 320
Right 1103320018 12:120087021-120087043 ACGTTAGTCAGCACATTCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103320018 Original CRISPR ACGTTAGTCAGCACATTCCT GGG Intronic
904450112 1:30605629-30605651 TCCTTAGTGAGCACCTTCCTTGG - Intergenic
905219250 1:36432794-36432816 GAGTAAGCCAGCACATTCCTGGG + Intronic
906819113 1:48910872-48910894 ACATTAGTAAAAACATTCCTAGG + Intronic
917256641 1:173123264-173123286 CCTTTACTTAGCACATTCCTGGG + Intergenic
920086662 1:203422415-203422437 AGGTTAGACAGCTCTTTCCTGGG - Intergenic
924208840 1:241743913-241743935 TCTCTAGTCAGAACATTCCTAGG + Intronic
1071800434 10:89054141-89054163 ACATTGGTCAGCACCTTCCTTGG + Intergenic
1086795580 11:91097242-91097264 ATGTCAGTCAGTGCATTCCTAGG - Intergenic
1086920096 11:92576492-92576514 ACTTTAGTAAGTACAGTCCTTGG + Intronic
1091906106 12:4190311-4190333 ACAGTACTCAGCACAGTCCTTGG - Intergenic
1096013420 12:48243648-48243670 ACATTAGGTAGGACATTCCTGGG - Intergenic
1096614786 12:52825925-52825947 ACTTTACTCAGCACATGCCATGG - Intronic
1099202456 12:79691287-79691309 GAGTTAGACGGCACATTCCTGGG + Intergenic
1103320018 12:120087021-120087043 ACGTTAGTCAGCACATTCCTGGG + Intronic
1113913286 13:113854875-113854897 TCTTTAGTCAGCACTTTCCCAGG - Intronic
1124721594 15:32115468-32115490 AGGCTGGTCAGCACATACCTGGG - Intronic
1140701114 16:77582411-77582433 AGGTTTGGCAGCACATTTCTGGG - Intergenic
1144323026 17:14149527-14149549 AGGATAGTCACCTCATTCCTTGG + Intronic
1151748332 17:76023370-76023392 ACGGTACTCCGCACACTCCTGGG + Exonic
1152525255 17:80884719-80884741 TCGTTCATCAGCACATTCCCTGG + Intronic
1155523011 18:26688298-26688320 ACGTTACTGAGCAGATTCCTGGG - Intergenic
1166869379 19:45862342-45862364 AGGGTAGTCATCAGATTCCTAGG - Intronic
929484284 2:42340537-42340559 GCGTTACGGAGCACATTCCTGGG - Intronic
937194102 2:120134460-120134482 ACAATAGTCACCACATACCTCGG + Intronic
947903923 2:233745847-233745869 ACCTTGGTCAGCAGCTTCCTGGG - Intronic
947905325 2:233757202-233757224 ACCTTGGTCAGCAGCTTCCTGGG - Intronic
1169384187 20:5134120-5134142 ACATTTGTGAGCACTTTCCTGGG + Intronic
1169872132 20:10259295-10259317 AAGTGAGTCAGCTCCTTCCTGGG + Intronic
1171478676 20:25435263-25435285 AAGTAAGTCATCACATACCTGGG - Intronic
1178536101 21:33411529-33411551 ACGTCAGGCAGCACATTCCCAGG - Intronic
950164873 3:10788749-10788771 ACCCTAGTCATCTCATTCCTAGG + Intergenic
954895603 3:53972570-53972592 AGGTTCGTCAGCAGCTTCCTGGG + Intergenic
955773169 3:62406287-62406309 ACATTTATCAGCACAATCCTTGG + Intronic
957107835 3:75913336-75913358 ATGTAAGGCAGCACATTCCCAGG + Intronic
967636989 3:191813630-191813652 CTGTTATTCAGCATATTCCTGGG + Intergenic
967684754 3:192407347-192407369 ACGTTAATGAGCAGAGTCCTTGG + Intronic
969902691 4:10364271-10364293 ACGTTAGCCAGCAGCTTCCATGG - Intergenic
992216338 5:74528202-74528224 ACGTTAGTCAGCATCTTAGTTGG + Intergenic
994263641 5:97688805-97688827 ACGTAAGTCAGCACAATTCAGGG + Intergenic
996611615 5:125387597-125387619 AAGCTAGTCAGCACATTAATAGG + Intergenic
998284502 5:140846091-140846113 AAGATAGTCTACACATTCCTTGG - Intronic
999786773 5:154897879-154897901 ACCTTAGTCAGCCCAGGCCTTGG - Intronic
1003102795 6:3190197-3190219 CAGTTAGTCAGGACATTCCAGGG - Intergenic
1005813785 6:29534365-29534387 ACGTCAGTGAGGACATACCTGGG - Intergenic
1009420565 6:63459957-63459979 AAGTTGGTCATCAAATTCCTAGG - Intergenic
1016763407 6:147765638-147765660 AAATTAGTCAGCATGTTCCTTGG + Intergenic
1020794844 7:12666782-12666804 AAGTTTGTTAGGACATTCCTGGG - Intergenic
1024190739 7:47005798-47005820 AAGTTAAACAGCACATTTCTAGG + Intergenic
1028400516 7:90420373-90420395 GCGATAGTCAGCACCTTCCAAGG - Intronic
1031741599 7:125438498-125438520 AGGTTAGTCAGAAAATGCCTGGG + Intergenic
1043620645 8:82187990-82188012 ACATAAGTCAGCACTATCCTGGG + Intergenic
1050578745 9:7028180-7028202 TTGCAAGTCAGCACATTCCTAGG - Intronic
1054955533 9:70905628-70905650 AGGTTATTCATCACATTTCTAGG - Intronic
1189697515 X:43679937-43679959 ACATTAGTCAGCACAAACTTTGG + Intronic