ID: 1103320019

View in Genome Browser
Species Human (GRCh38)
Location 12:120087022-120087044
Sequence CGTTAGTCAGCACATTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103320013_1103320019 -2 Left 1103320013 12:120087001-120087023 CCATCTGTCCCTCGCCGGCAACG 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1103320019 12:120087022-120087044 CGTTAGTCAGCACATTCCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1103320008_1103320019 18 Left 1103320008 12:120086981-120087003 CCGCGGCTGTAGCCCTGGGCCCA 0: 1
1: 0
2: 3
3: 23
4: 251
Right 1103320019 12:120087022-120087044 CGTTAGTCAGCACATTCCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1103320009_1103320019 6 Left 1103320009 12:120086993-120087015 CCCTGGGCCCATCTGTCCCTCGC 0: 1
1: 0
2: 1
3: 16
4: 262
Right 1103320019 12:120087022-120087044 CGTTAGTCAGCACATTCCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1103320004_1103320019 30 Left 1103320004 12:120086969-120086991 CCCGGCGCTGCGCCGCGGCTGTA 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1103320019 12:120087022-120087044 CGTTAGTCAGCACATTCCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1103320012_1103320019 -1 Left 1103320012 12:120087000-120087022 CCCATCTGTCCCTCGCCGGCAAC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1103320019 12:120087022-120087044 CGTTAGTCAGCACATTCCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1103320010_1103320019 5 Left 1103320010 12:120086994-120087016 CCTGGGCCCATCTGTCCCTCGCC 0: 1
1: 0
2: 0
3: 27
4: 320
Right 1103320019 12:120087022-120087044 CGTTAGTCAGCACATTCCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1103320005_1103320019 29 Left 1103320005 12:120086970-120086992 CCGGCGCTGCGCCGCGGCTGTAG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1103320019 12:120087022-120087044 CGTTAGTCAGCACATTCCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1103320014_1103320019 -10 Left 1103320014 12:120087009-120087031 CCCTCGCCGGCAACGTTAGTCAG 0: 1
1: 0
2: 0
3: 2
4: 10
Right 1103320019 12:120087022-120087044 CGTTAGTCAGCACATTCCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103320019 Original CRISPR CGTTAGTCAGCACATTCCTG GGG Intronic
904101452 1:28032410-28032432 TGTTGGTCAGCACATTTTTGTGG + Intronic
907886628 1:58598095-58598117 CATCAGTCAGTGCATTCCTGCGG + Intergenic
920086661 1:203422414-203422436 GGTTAGACAGCTCTTTCCTGGGG - Intergenic
921162793 1:212484992-212485014 CTGTAGTCATCACATTCCAGGGG + Intergenic
921881597 1:220260980-220261002 TGTTAGACAGCACAGTACTGAGG + Intronic
1080867920 11:36212084-36212106 CCTTATTCAGCAAATTCCAGAGG + Intronic
1081429992 11:42966407-42966429 ATTTACTCAGCACATTCTTGGGG - Intergenic
1086431569 11:86741486-86741508 CATTAGACAGCACATCCCTGAGG - Intergenic
1088589852 11:111394216-111394238 CGGTAGCCAGCCCATTCCTGTGG + Intronic
1093433800 12:19112529-19112551 TTTTAGGCAGCACACTCCTGTGG + Intergenic
1094180921 12:27591944-27591966 CGTGACCCATCACATTCCTGCGG - Intronic
1095923193 12:47551761-47551783 TGTTTGTCATCACAATCCTGAGG + Intergenic
1095978208 12:47954225-47954247 AATTGGGCAGCACATTCCTGAGG - Intergenic
1097044670 12:56178606-56178628 CTTTAGTGTCCACATTCCTGGGG - Intronic
1103320019 12:120087022-120087044 CGTTAGTCAGCACATTCCTGGGG + Intronic
1111232945 13:85368262-85368284 CTTTAGGCAGCCCCTTCCTGTGG + Intergenic
1112912156 13:104500343-104500365 AGTTATTCAGCACAATTCTGAGG - Intergenic
1113431223 13:110251756-110251778 ATTAAGACAGCACATTCCTGAGG + Intronic
1118649986 14:67881207-67881229 CGTTATGCAGCACATGACTGTGG + Intronic
1124721593 15:32115467-32115489 GGCTGGTCAGCACATACCTGGGG - Intronic
1127973533 15:63980547-63980569 GCTTAGTCATCCCATTCCTGGGG + Intronic
1128913973 15:71543009-71543031 ATTTAGTCATCACATTTCTGTGG - Intronic
1133151219 16:3832732-3832754 CGTTATGTAGCACATTACTGTGG + Intronic
1138202538 16:55100904-55100926 AGTTGGGCAGCACATTTCTGTGG + Intergenic
1140701113 16:77582410-77582432 GGTTTGGCAGCACATTTCTGGGG - Intergenic
1158324968 18:56303747-56303769 CATTGGTTAGCACACTCCTGGGG - Intergenic
1161110796 19:2468823-2468845 CATCAGGCAGGACATTCCTGGGG - Intergenic
1162720418 19:12658540-12658562 CGGGAGTCCGCACCTTCCTGGGG + Intronic
1165538793 19:36473198-36473220 CCATATTCAGAACATTCCTGTGG + Intronic
1166603658 19:44120307-44120329 TCTTAGACATCACATTCCTGGGG - Intronic
926834162 2:16999151-16999173 TGAAACTCAGCACATTCCTGGGG - Intergenic
928690250 2:33791821-33791843 AGTGAGTCAGCACATCGCTGAGG + Intergenic
929484283 2:42340536-42340558 CGTTACGGAGCACATTCCTGGGG - Intronic
942817744 2:180071873-180071895 GGTTAGAAAGAACATTCCTGGGG + Intergenic
943495817 2:188619609-188619631 CTTGTGTCACCACATTCCTGGGG - Intergenic
1173476849 20:43365654-43365676 TGTGAGCCAGCTCATTCCTGTGG + Intergenic
1174242479 20:49148753-49148775 CGTTGGTTGGCACAGTCCTGAGG - Intronic
1176231140 20:64033513-64033535 TGTCACTCAGCACATGCCTGAGG - Intronic
1177210862 21:18069271-18069293 TTTTAGGCAGCACACTCCTGTGG - Intronic
1181674390 22:24442223-24442245 CGCTACTCAGCACATGCCAGTGG - Exonic
957653537 3:83039608-83039630 AGTAATTCAGAACATTCCTGAGG - Intergenic
959873043 3:111350459-111350481 CATTAATCAACACTTTCCTGTGG + Intronic
960672828 3:120168765-120168787 CATTATTCAGCTCATACCTGCGG - Intronic
962374327 3:134847582-134847604 ACTTAGTCAGCACCTTACTGTGG - Intronic
970690592 4:18615584-18615606 AGTAACTCAGCACATTTCTGAGG + Intergenic
983674133 4:170272001-170272023 CGTAAGAAAACACATTCCTGGGG - Intergenic
983860080 4:172694738-172694760 CGTAAGGGAGCACATTCCTTTGG - Intronic
990271389 5:54144766-54144788 TGGCAGTCAGCACATTACTGAGG + Intronic
990751028 5:59016420-59016442 CGTGAGGCAGCAGATTCCTATGG - Intronic
1003102794 6:3190196-3190218 AGTTAGTCAGGACATTCCAGGGG - Intergenic
1015317962 6:131838343-131838365 CGTTAGTCTGCACATGTCTTTGG - Intronic
1018167225 6:161109643-161109665 CGTTAGAAAGAACATTCCTTTGG + Intronic
1018942458 6:168318882-168318904 GAAAAGTCAGCACATTCCTGAGG + Intronic
1020794843 7:12666781-12666803 AGTTTGTTAGGACATTCCTGGGG - Intergenic
1027185796 7:75969885-75969907 CTTTACTCTGCACATTCCTGTGG - Intronic
1028400515 7:90420372-90420394 CGATAGTCAGCACCTTCCAAGGG - Intronic
1032728443 7:134614053-134614075 CATTAGTCAGCTCATATCTGAGG - Intergenic
1033463996 7:141574381-141574403 CGTTAGTCAGCTGAGTTCTGTGG - Intronic
1033552186 7:142457637-142457659 AGTTTATCAGCACATCCCTGGGG + Intergenic
1033559083 7:142514117-142514139 AGTTTATCAGCACATTACTGGGG + Intergenic
1037413351 8:18620567-18620589 GGTGTGACAGCACATTCCTGTGG + Intronic
1045551128 8:103173570-103173592 TGACAGTCAGCAAATTCCTGGGG - Intronic
1046193587 8:110831600-110831622 CGATATTCAGGACATTCCTCTGG + Intergenic
1055219153 9:73907445-73907467 CTTTAGTCATCAACTTCCTGTGG - Intergenic
1057097324 9:92324098-92324120 CCTTAGCCAGGACATTTCTGAGG - Exonic
1057269021 9:93636726-93636748 CCTTGGTCAGCACTTCCCTGGGG + Intronic
1196179129 X:112671244-112671266 TGTCATTCAGCACATTCCGGAGG - Exonic
1197717561 X:129720327-129720349 GAATAGTCAGCACATTCCTCAGG + Intergenic
1197763994 X:130047600-130047622 CCTAACTCACCACATTCCTGGGG - Intronic