ID: 1103320025

View in Genome Browser
Species Human (GRCh38)
Location 12:120087052-120087074
Sequence TGCTCTCGGCGCCACCTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 147}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103320015_1103320025 19 Left 1103320015 12:120087010-120087032 CCTCGCCGGCAACGTTAGTCAGC 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1103320025 12:120087052-120087074 TGCTCTCGGCGCCACCTGCCGGG 0: 1
1: 0
2: 2
3: 12
4: 147
1103320013_1103320025 28 Left 1103320013 12:120087001-120087023 CCATCTGTCCCTCGCCGGCAACG 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1103320025 12:120087052-120087074 TGCTCTCGGCGCCACCTGCCGGG 0: 1
1: 0
2: 2
3: 12
4: 147
1103320014_1103320025 20 Left 1103320014 12:120087009-120087031 CCCTCGCCGGCAACGTTAGTCAG 0: 1
1: 0
2: 0
3: 2
4: 10
Right 1103320025 12:120087052-120087074 TGCTCTCGGCGCCACCTGCCGGG 0: 1
1: 0
2: 2
3: 12
4: 147
1103320012_1103320025 29 Left 1103320012 12:120087000-120087022 CCCATCTGTCCCTCGCCGGCAAC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1103320025 12:120087052-120087074 TGCTCTCGGCGCCACCTGCCGGG 0: 1
1: 0
2: 2
3: 12
4: 147
1103320020_1103320025 -9 Left 1103320020 12:120087038-120087060 CCTGGGGCTCCCGCTGCTCTCGG 0: 1
1: 0
2: 1
3: 52
4: 336
Right 1103320025 12:120087052-120087074 TGCTCTCGGCGCCACCTGCCGGG 0: 1
1: 0
2: 2
3: 12
4: 147
1103320016_1103320025 14 Left 1103320016 12:120087015-120087037 CCGGCAACGTTAGTCAGCACATT 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1103320025 12:120087052-120087074 TGCTCTCGGCGCCACCTGCCGGG 0: 1
1: 0
2: 2
3: 12
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103320025 Original CRISPR TGCTCTCGGCGCCACCTGCC GGG Intronic
900420756 1:2555018-2555040 GGCCCTCAGCGCCCCCTGCCAGG - Intergenic
900880967 1:5381068-5381090 TGCTCTCAGCTCCACCTCACTGG - Intergenic
901854388 1:12035205-12035227 TGCTCTAGGGGCCTCCTGCCTGG - Intergenic
903012350 1:20340117-20340139 TTCTCTCGCCCCCTCCTGCCTGG + Intronic
904000452 1:27335754-27335776 TGCTCCCGCCACCACCTGCTGGG + Exonic
906065665 1:42978600-42978622 TGCCCTCGGTGCCCCCTACCAGG + Intergenic
906708788 1:47914169-47914191 GGCTCACGACGTCACCTGCCAGG - Intronic
907255383 1:53174758-53174780 CGATCTCGGCTCCACCTCCCAGG + Intergenic
911547707 1:99239833-99239855 TGTTCTTGGCCTCACCTGCCTGG - Intergenic
916165284 1:161961275-161961297 TGCTCTAGGCGGCACCTTACAGG - Exonic
1063668906 10:8083905-8083927 TGCCCTCGGAGCCAGCTGGCTGG + Intergenic
1065013306 10:21439100-21439122 TGATCTTGGCTCCACCTCCCAGG + Intergenic
1066046273 10:31598235-31598257 TGCTCTCAGCCCGTCCTGCCAGG - Intergenic
1066198865 10:33127375-33127397 TGATCTCAGCTCCACCTCCCAGG - Intergenic
1067177446 10:43960054-43960076 TGCTCTGGGCTCCATCTGGCCGG + Intergenic
1067746533 10:48940565-48940587 TACTCTCTGCTCCACCTGCATGG - Intronic
1071462965 10:85915988-85916010 TTCTCTCGTTCCCACCTGCCAGG + Intronic
1071560957 10:86646604-86646626 TGCCCTCGGCACCAGGTGCCTGG + Intergenic
1072662325 10:97370587-97370609 TGCTCCCTGAGCCATCTGCCCGG + Intronic
1074325538 10:112447264-112447286 TGCTCTCGGGGGCACCTTCCGGG + Exonic
1074971667 10:118544230-118544252 TTCTGTCAGCGCCACCTGGCAGG - Intergenic
1077134115 11:990252-990274 TGCCCTTGGGGCCTCCTGCCGGG - Intronic
1078389887 11:10928271-10928293 TGCTCTCGGCTCCACCTCCCGGG + Intergenic
1078555416 11:12321363-12321385 TGGTCTCCGTGCCACCTGGCTGG - Intronic
1084196023 11:67523935-67523957 TGCACTTGGCTCCCCCTGCCTGG + Intergenic
1085329959 11:75640075-75640097 TGCTCTAGGAGCCGCCTGTCTGG - Intronic
1089540940 11:119188618-119188640 TGCTCTCCCTGCCACCTTCCAGG + Exonic
1097190180 12:57216090-57216112 CCCTCTCAGCGCCGCCTGCCTGG - Intergenic
1100581589 12:95944464-95944486 TGATCTTGGCTCCACCTCCCAGG + Intronic
1101354682 12:103965999-103966021 TGCGGGCGGCTCCACCTGCCGGG - Exonic
1101409541 12:104457243-104457265 CGCTCTCGGAGCCCCCAGCCCGG - Exonic
1101441393 12:104706689-104706711 GGCTCTCAACACCACCTGCCTGG + Intronic
1103320025 12:120087052-120087074 TGCTCTCGGCGCCACCTGCCGGG + Intronic
1103410166 12:120705829-120705851 AGCTCTGGGCCCCACCTGCCTGG + Intergenic
1104688615 12:130807391-130807413 GGCTCTGGGGTCCACCTGCCTGG - Intronic
1105449749 13:20488833-20488855 TGCTCCCAGCTCCACCTGCAGGG + Intronic
1112324919 13:98437748-98437770 TTCTCTCGGTCCCACCAGCCTGG + Exonic
1112735622 13:102413244-102413266 TGCTCTGTGCGCCACGAGCCTGG - Intergenic
1113885084 13:113654646-113654668 TGCCCTCGGGGGCACCTGCTGGG + Intronic
1114458378 14:22871946-22871968 TGGCCTGGTCGCCACCTGCCGGG - Exonic
1119470035 14:74890775-74890797 CGATATCGGCTCCACCTGCCAGG + Intronic
1124007592 15:25807257-25807279 TGCTGGCTGCCCCACCTGCCTGG - Intronic
1124412172 15:29445568-29445590 TTCTCTGGGCGCCACCCTCCAGG - Intronic
1125898737 15:43325915-43325937 TGATCTTGGCTCGACCTGCCAGG + Exonic
1127128902 15:55841645-55841667 TGATCTCGGCTCCGCCTTCCGGG + Intronic
1130037455 15:80374751-80374773 TCCTCTCTGCCCCACCTGCAAGG + Exonic
1131472505 15:92709191-92709213 TGCTCTCAGCCCCATCAGCCTGG + Intronic
1132552551 16:559548-559570 TGCTCCCAGCCCCACCTCCCGGG - Intergenic
1132645707 16:998403-998425 GGCTCTGGGCGCCACCTGCCTGG - Intergenic
1132750883 16:1457109-1457131 GGCTCTGGGAGCCACCCGCCAGG + Intronic
1132991903 16:2799725-2799747 TGCTCTCACTGCCACCTGTCAGG + Intergenic
1133839678 16:9396196-9396218 TCCTCTGGGCCCCACCTGCCAGG + Intergenic
1136016140 16:27402386-27402408 TGCTCTGTGGGACACCTGCCTGG + Exonic
1136345430 16:29672524-29672546 CGATCTCGGCTCCACCTCCCGGG + Intronic
1142312270 16:89320959-89320981 TGCTCTTGAAGCCACCTTCCGGG - Intronic
1142328703 16:89435990-89436012 TGCTCTCAGCAGCACCTGCTGGG - Intronic
1142508910 17:382304-382326 TGCTCTGGGCGTCCCCTGCCCGG + Intronic
1142957305 17:3530649-3530671 GTCTCTCGTCACCACCTGCCTGG - Intronic
1144284305 17:13758024-13758046 GGCTCTAGAAGCCACCTGCCGGG + Intergenic
1145761791 17:27429659-27429681 TGGGCTGGGCCCCACCTGCCTGG - Intergenic
1146488508 17:33262944-33262966 AGCCCTGGGCACCACCTGCCTGG - Intronic
1147189400 17:38730139-38730161 CGGTCCCGGCGCCCCCTGCCGGG - Intergenic
1149622379 17:58055587-58055609 TGATCTTGGCTCCACCTCCCAGG + Intergenic
1152332406 17:79680763-79680785 AGCTCTCAGAGCCCCCTGCCTGG - Intergenic
1152531794 17:80923230-80923252 TCCTGTCCGCGCCACCTCCCAGG + Intronic
1154070609 18:11148947-11148969 TGCTCGCCGCGCCGCCTCCCAGG - Intergenic
1159013583 18:63082729-63082751 TGCCCTCACCCCCACCTGCCAGG + Intergenic
1160715105 19:572898-572920 TCCTCCCGGCGCGGCCTGCCGGG + Intronic
1161400316 19:4064401-4064423 TGCTCTCGGGGCCCCATGGCGGG + Intronic
1161772177 19:6236794-6236816 TGCTCACGGAGCCTGCTGCCAGG - Intronic
1162778769 19:12995952-12995974 GGCTCTCGGCCCCCCCTTCCCGG - Intronic
1163685591 19:18710096-18710118 TGCTCACGGGGCCTCCTGCCTGG + Intronic
1165729541 19:38135924-38135946 TGCCCTCGCTGCCACCAGCCAGG + Intronic
1166703360 19:44894887-44894909 TGCTCTCTACGCCAGCTGCAGGG - Intronic
1166788829 19:45385565-45385587 TGCTGACTGCGCCACCTACCTGG - Exonic
925718066 2:6803098-6803120 TGCTCCCGAGGCCACCAGCCAGG - Intergenic
930194197 2:48493079-48493101 TGATCTCGGCTCCGCCTCCCGGG + Intronic
932496329 2:72147537-72147559 GGCTCCCGGCGCCCCCTGGCCGG + Intronic
937209730 2:120260600-120260622 CTTTCTCGGCGCCACTTGCCAGG - Intronic
938114737 2:128595406-128595428 TGCACTCGGCGGCACCTGTGAGG + Intergenic
938302628 2:130228083-130228105 TTCGCTCGGCGCCGCCCGCCCGG + Intergenic
944624060 2:201552069-201552091 TGATCTCGGCTCCACCCCCCAGG + Intronic
947944742 2:234091882-234091904 TGCTCTCGTCACCACGAGCCTGG - Intergenic
1172107177 20:32523747-32523769 TGCTCCCCGGGCCTCCTGCCTGG + Intronic
1174648818 20:52107020-52107042 CGATCTCGGCTCCACCTCCCGGG - Intronic
1175498945 20:59435699-59435721 TGCTCTAGGCCTCACCTCCCAGG + Intergenic
1176020838 20:62961623-62961645 TGCTCCCGGCCCCACCTACAGGG - Intronic
1176102977 20:63372888-63372910 CGCACTCGTCCCCACCTGCCTGG + Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1181269641 22:21651742-21651764 TGCTCTCTGCGCCTCCTGGATGG - Intergenic
1181854105 22:25769920-25769942 TGATCTCGGCTCCACCTCCCGGG + Intronic
1183702360 22:39457627-39457649 TGCGCTTGGCGCCCCCCGCCCGG + Intronic
1183942069 22:41301617-41301639 TGCTCCCGGCGCCGCCGCCCCGG - Exonic
1184204814 22:42995093-42995115 TGCTCCGGGCCCCAACTGCCAGG + Intronic
1184234181 22:43174288-43174310 GGCCCTCGGGGCCACCTGCCCGG + Exonic
950435119 3:12974786-12974808 GGCTCCCTGCGCCACCTACCAGG - Intronic
953911844 3:46897156-46897178 TGCTCTTGGAACCACCTTCCAGG - Intronic
961459627 3:127042153-127042175 TGCTCCCTGCCACACCTGCCAGG + Intergenic
961625455 3:128259652-128259674 TTCTCTGTGCGCCACCAGCCTGG + Intronic
965627718 3:170698344-170698366 TCCTCTGGGCCCCACCTGCTGGG - Intronic
968514566 4:1010833-1010855 TGCTCCTGGGGCCGCCTGCCCGG + Intronic
968950259 4:3687827-3687849 GGCTCACGCCACCACCTGCCTGG - Intergenic
969084192 4:4643214-4643236 GGCTCTAGAGGCCACCTGCCTGG - Intergenic
969684639 4:8664311-8664333 TGCTCTCTGCACAGCCTGCCTGG - Intergenic
970324459 4:14909033-14909055 TTCTCTGGGCCCCACCAGCCAGG + Intergenic
971368357 4:25995340-25995362 TGCTCTCAGAGGCACCTTCCAGG + Intergenic
976388166 4:84483268-84483290 TGGTCTCGGCGGGACCTCCCGGG + Intergenic
980514969 4:133845026-133845048 CGATCTCGGCTCCACCTCCCGGG + Intergenic
982281041 4:153684118-153684140 CTCGCTCGGGGCCACCTGCCTGG + Intergenic
984866358 4:184283926-184283948 TGCTCTCCAAGCCACCAGCCAGG - Intergenic
986608210 5:9544636-9544658 CGCTCGCAGCGCCCCCTGCCGGG + Intronic
990165371 5:52988925-52988947 TGCCCTCGGCACCCGCTGCCAGG + Intergenic
995988453 5:118208224-118208246 TGCACTCGGAGCCCCCGGCCAGG - Intergenic
997308272 5:132856737-132856759 TGATCTCGGCTCCACTTCCCAGG - Intergenic
997947307 5:138213847-138213869 TGCTCTCACCCCCACCTCCCCGG - Intergenic
999647365 5:153731428-153731450 TGATCTCAGCTCCACCTGCTAGG + Intronic
999931778 5:156441104-156441126 TGCTCCTGACGCCACCTACCAGG - Intronic
1002343343 5:178531371-178531393 TGCTCTCCGCATGACCTGCCTGG + Intronic
1003174305 6:3744019-3744041 CGCTCTAGGAGCCACCTCCCAGG - Intronic
1006591398 6:35160639-35160661 TGCTCTCTGCCCAACCTGCAAGG - Intergenic
1007601310 6:43083353-43083375 TGCTCTGGCCCCCATCTGCCTGG + Intronic
1007633537 6:43285337-43285359 GGCCCTCCGCGCCTCCTGCCCGG - Exonic
1010520751 6:76832802-76832824 TGGACTTGGAGCCACCTGCCTGG - Intergenic
1014228897 6:118879966-118879988 TGAGCTCGGCTCCACCTCCCAGG - Intronic
1014371612 6:120615936-120615958 TGATCTCGGCTCCACCTCCCAGG - Intergenic
1018728829 6:166633959-166633981 TGCTCTCGTCTCCACTTGCCTGG - Intronic
1018795813 6:167184865-167184887 TGCTTTCTGCTCCACCTGCAAGG - Intronic
1018820504 6:167370199-167370221 TGCTTTCTGCTCCACCTGCAAGG + Intronic
1018824463 6:167398681-167398703 TGCACACAGCACCACCTGCCAGG - Intergenic
1018855065 6:167669217-167669239 TGCTCTCTGTGGCCCCTGCCTGG - Intergenic
1019734342 7:2643496-2643518 TGCCCTTGGCGCCGCCTGCAGGG - Intronic
1020418006 7:7968722-7968744 TGCTCGCTGCGGCAGCTGCCGGG + Intronic
1023380549 7:39603212-39603234 CGATCTCGGCTCCACCTGCAGGG + Intronic
1025725721 7:64057549-64057571 TGCTCTCCCCGCCCCCTGACAGG - Intronic
1027174404 7:75894103-75894125 TGCTCTTAGGGCCCCCTGCCTGG + Intergenic
1033427371 7:141256395-141256417 TGCTCTTGGCACCACCTGTAAGG - Intronic
1033616209 7:143016931-143016953 TGCTCTTGGCTGCACGTGCCTGG - Intergenic
1034265192 7:149777342-149777364 TGCTCCAGCCGACACCTGCCAGG + Intergenic
1035016448 7:155770442-155770464 GGCTCTCGGCCCTTCCTGCCAGG + Intronic
1035160910 7:156949572-156949594 TGCCCCGGGCGCCACCTGCCCGG + Intergenic
1035729965 8:1846982-1847004 TGCTCTTGGGGCCTCCTGGCAGG + Intronic
1036753937 8:11460224-11460246 AGCCCTCGGTGCCTCCTGCCTGG + Intronic
1037950946 8:23018571-23018593 TGCCCTCGGAGCCAGCTGGCAGG - Intronic
1038306387 8:26407055-26407077 GGATCTCGGCTCCACCTCCCAGG + Intronic
1038531323 8:28320183-28320205 TGCTATCTACTCCACCTGCCAGG - Intronic
1039908091 8:41800788-41800810 TGATCTCGGCTCTACCTCCCAGG + Intronic
1045190003 8:99872584-99872606 TGCTCTCTGCCCCTCCTTCCTGG + Intronic
1048512807 8:135077938-135077960 GGCTGTCTGAGCCACCTGCCAGG + Intergenic
1053105494 9:35404718-35404740 GGCACTAGGGGCCACCTGCCTGG + Exonic
1054773414 9:69104164-69104186 CGATCTCGGCTCCACCTCCCAGG + Intergenic
1056831926 9:89924209-89924231 TGGTCTGGGCGACATCTGCCAGG + Intergenic
1057470015 9:95349234-95349256 TGCCTTCTGCGCCACCTCCCTGG - Intergenic
1060205191 9:121678698-121678720 GGCTCTCGGCGCAGCCTGCCTGG + Exonic
1060585451 9:124782676-124782698 TGCTCCCAGTGCCAGCTGCCAGG - Intronic
1061838828 9:133346173-133346195 TGCTGACCGCTCCACCTGCCTGG + Intronic
1061908481 9:133710872-133710894 TGCCCTGGGTGCCACCAGCCAGG + Intronic
1062023726 9:134330943-134330965 TCCTCTCTGTGCCTCCTGCCTGG + Intronic
1062148056 9:135001585-135001607 TGCTGGCAGGGCCACCTGCCTGG - Intergenic
1062360018 9:136183193-136183215 TACTTTCGGCTCCCCCTGCCCGG - Intergenic
1190711851 X:53077320-53077342 TGGTCCCGGGGCCACCGGCCAGG + Exonic
1198228173 X:134665771-134665793 TGCTCTGGGCTCCTCTTGCCTGG - Intronic
1199069899 X:143463784-143463806 TGATCTTGGCTCCACCTCCCGGG + Intergenic