ID: 1103321402

View in Genome Browser
Species Human (GRCh38)
Location 12:120094680-120094702
Sequence GGGGGCAGTGCCAGGCGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 0, 2: 2, 3: 69, 4: 604}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103321402_1103321412 7 Left 1103321402 12:120094680-120094702 CCCTCCCGCCTGGCACTGCCCCC 0: 1
1: 0
2: 2
3: 69
4: 604
Right 1103321412 12:120094710-120094732 GCTGCAGCGTGCCATCCGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 88
1103321402_1103321413 11 Left 1103321402 12:120094680-120094702 CCCTCCCGCCTGGCACTGCCCCC 0: 1
1: 0
2: 2
3: 69
4: 604
Right 1103321413 12:120094714-120094736 CAGCGTGCCATCCGCAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103321402 Original CRISPR GGGGGCAGTGCCAGGCGGGA GGG (reversed) Intergenic