ID: 1103321412

View in Genome Browser
Species Human (GRCh38)
Location 12:120094710-120094732
Sequence GCTGCAGCGTGCCATCCGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 88}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103321403_1103321412 6 Left 1103321403 12:120094681-120094703 CCTCCCGCCTGGCACTGCCCCCT 0: 1
1: 2
2: 4
3: 38
4: 585
Right 1103321412 12:120094710-120094732 GCTGCAGCGTGCCATCCGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 88
1103321404_1103321412 3 Left 1103321404 12:120094684-120094706 CCCGCCTGGCACTGCCCCCTGCC 0: 1
1: 2
2: 6
3: 116
4: 951
Right 1103321412 12:120094710-120094732 GCTGCAGCGTGCCATCCGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 88
1103321398_1103321412 14 Left 1103321398 12:120094673-120094695 CCCCTGCCCCTCCCGCCTGGCAC 0: 1
1: 0
2: 4
3: 65
4: 751
Right 1103321412 12:120094710-120094732 GCTGCAGCGTGCCATCCGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 88
1103321395_1103321412 30 Left 1103321395 12:120094657-120094679 CCAGGAAGGGCATCCTCCCCTGC 0: 1
1: 0
2: 2
3: 20
4: 285
Right 1103321412 12:120094710-120094732 GCTGCAGCGTGCCATCCGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 88
1103321401_1103321412 8 Left 1103321401 12:120094679-120094701 CCCCTCCCGCCTGGCACTGCCCC 0: 1
1: 0
2: 5
3: 63
4: 653
Right 1103321412 12:120094710-120094732 GCTGCAGCGTGCCATCCGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 88
1103321402_1103321412 7 Left 1103321402 12:120094680-120094702 CCCTCCCGCCTGGCACTGCCCCC 0: 1
1: 0
2: 2
3: 69
4: 604
Right 1103321412 12:120094710-120094732 GCTGCAGCGTGCCATCCGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 88
1103321405_1103321412 2 Left 1103321405 12:120094685-120094707 CCGCCTGGCACTGCCCCCTGCCA 0: 1
1: 0
2: 11
3: 69
4: 631
Right 1103321412 12:120094710-120094732 GCTGCAGCGTGCCATCCGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 88
1103321400_1103321412 12 Left 1103321400 12:120094675-120094697 CCTGCCCCTCCCGCCTGGCACTG 0: 1
1: 0
2: 5
3: 52
4: 634
Right 1103321412 12:120094710-120094732 GCTGCAGCGTGCCATCCGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 88
1103321406_1103321412 -1 Left 1103321406 12:120094688-120094710 CCTGGCACTGCCCCCTGCCAGTG 0: 1
1: 0
2: 1
3: 55
4: 469
Right 1103321412 12:120094710-120094732 GCTGCAGCGTGCCATCCGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 88
1103321396_1103321412 17 Left 1103321396 12:120094670-120094692 CCTCCCCTGCCCCTCCCGCCTGG 0: 1
1: 0
2: 18
3: 147
4: 1411
Right 1103321412 12:120094710-120094732 GCTGCAGCGTGCCATCCGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 88
1103321399_1103321412 13 Left 1103321399 12:120094674-120094696 CCCTGCCCCTCCCGCCTGGCACT 0: 1
1: 0
2: 5
3: 34
4: 480
Right 1103321412 12:120094710-120094732 GCTGCAGCGTGCCATCCGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103321412 Original CRISPR GCTGCAGCGTGCCATCCGCA AGG Intergenic