ID: 1103321413

View in Genome Browser
Species Human (GRCh38)
Location 12:120094714-120094736
Sequence CAGCGTGCCATCCGCAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103321410_1103321413 -10 Left 1103321410 12:120094701-120094723 CCTGCCAGTGCTGCAGCGTGCCA 0: 1
1: 0
2: 4
3: 12
4: 166
Right 1103321413 12:120094714-120094736 CAGCGTGCCATCCGCAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
1103321396_1103321413 21 Left 1103321396 12:120094670-120094692 CCTCCCCTGCCCCTCCCGCCTGG 0: 1
1: 0
2: 18
3: 147
4: 1411
Right 1103321413 12:120094714-120094736 CAGCGTGCCATCCGCAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
1103321405_1103321413 6 Left 1103321405 12:120094685-120094707 CCGCCTGGCACTGCCCCCTGCCA 0: 1
1: 0
2: 11
3: 69
4: 631
Right 1103321413 12:120094714-120094736 CAGCGTGCCATCCGCAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
1103321402_1103321413 11 Left 1103321402 12:120094680-120094702 CCCTCCCGCCTGGCACTGCCCCC 0: 1
1: 0
2: 2
3: 69
4: 604
Right 1103321413 12:120094714-120094736 CAGCGTGCCATCCGCAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
1103321401_1103321413 12 Left 1103321401 12:120094679-120094701 CCCCTCCCGCCTGGCACTGCCCC 0: 1
1: 0
2: 5
3: 63
4: 653
Right 1103321413 12:120094714-120094736 CAGCGTGCCATCCGCAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
1103321407_1103321413 -7 Left 1103321407 12:120094698-120094720 CCCCCTGCCAGTGCTGCAGCGTG 0: 1
1: 1
2: 0
3: 22
4: 257
Right 1103321413 12:120094714-120094736 CAGCGTGCCATCCGCAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
1103321409_1103321413 -9 Left 1103321409 12:120094700-120094722 CCCTGCCAGTGCTGCAGCGTGCC 0: 1
1: 0
2: 2
3: 8
4: 150
Right 1103321413 12:120094714-120094736 CAGCGTGCCATCCGCAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
1103321408_1103321413 -8 Left 1103321408 12:120094699-120094721 CCCCTGCCAGTGCTGCAGCGTGC 0: 1
1: 0
2: 2
3: 19
4: 187
Right 1103321413 12:120094714-120094736 CAGCGTGCCATCCGCAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
1103321400_1103321413 16 Left 1103321400 12:120094675-120094697 CCTGCCCCTCCCGCCTGGCACTG 0: 1
1: 0
2: 5
3: 52
4: 634
Right 1103321413 12:120094714-120094736 CAGCGTGCCATCCGCAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
1103321404_1103321413 7 Left 1103321404 12:120094684-120094706 CCCGCCTGGCACTGCCCCCTGCC 0: 1
1: 2
2: 6
3: 116
4: 951
Right 1103321413 12:120094714-120094736 CAGCGTGCCATCCGCAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
1103321398_1103321413 18 Left 1103321398 12:120094673-120094695 CCCCTGCCCCTCCCGCCTGGCAC 0: 1
1: 0
2: 4
3: 65
4: 751
Right 1103321413 12:120094714-120094736 CAGCGTGCCATCCGCAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
1103321403_1103321413 10 Left 1103321403 12:120094681-120094703 CCTCCCGCCTGGCACTGCCCCCT 0: 1
1: 2
2: 4
3: 38
4: 585
Right 1103321413 12:120094714-120094736 CAGCGTGCCATCCGCAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
1103321406_1103321413 3 Left 1103321406 12:120094688-120094710 CCTGGCACTGCCCCCTGCCAGTG 0: 1
1: 0
2: 1
3: 55
4: 469
Right 1103321413 12:120094714-120094736 CAGCGTGCCATCCGCAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
1103321399_1103321413 17 Left 1103321399 12:120094674-120094696 CCCTGCCCCTCCCGCCTGGCACT 0: 1
1: 0
2: 5
3: 34
4: 480
Right 1103321413 12:120094714-120094736 CAGCGTGCCATCCGCAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103321413 Original CRISPR CAGCGTGCCATCCGCAAGGC AGG Intergenic