ID: 1103322090

View in Genome Browser
Species Human (GRCh38)
Location 12:120098169-120098191
Sequence TCCAGCTGGGCCGGGCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1196
Summary {0: 1, 1: 0, 2: 8, 3: 134, 4: 1053}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103322090_1103322095 19 Left 1103322090 12:120098169-120098191 CCGGCGCGCCCGGCCCAGCTGGA 0: 1
1: 0
2: 8
3: 134
4: 1053
Right 1103322095 12:120098211-120098233 GAAAGTGCCCCTGCTGTTCACGG 0: 1
1: 0
2: 0
3: 16
4: 154
1103322090_1103322097 26 Left 1103322090 12:120098169-120098191 CCGGCGCGCCCGGCCCAGCTGGA 0: 1
1: 0
2: 8
3: 134
4: 1053
Right 1103322097 12:120098218-120098240 CCCCTGCTGTTCACGGACATAGG 0: 1
1: 0
2: 0
3: 4
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103322090 Original CRISPR TCCAGCTGGGCCGGGCGCGC CGG (reversed) Intronic
900138328 1:1128192-1128214 TACAGGTGGGGCGGGCGCGCAGG + Intergenic
900513636 1:3071349-3071371 TCCCGCTGGGCCCGGCTCTCCGG - Intronic
901048350 1:6412706-6412728 TTAAGATGGGCCGGGCGCGGTGG - Intronic
901319042 1:8328549-8328571 TTCATCTGGGCCGGGCGTGGTGG + Intronic
901340200 1:8491151-8491173 ACCAGCTGGGCCAGGCGCAGTGG + Intronic
901510995 1:9717956-9717978 TCCAGCTGGGCTGGGGGCTGTGG + Intronic
901676600 1:10889102-10889124 GCCAGCCGGGGCGGGCGTGCCGG - Intergenic
901737705 1:11322858-11322880 TTCAGCTAGGCCGGGTGCGGTGG - Intergenic
901747152 1:11381516-11381538 TCAAGATGGGCCGGGCACGGTGG + Intergenic
901934727 1:12619350-12619372 TTCAGCAGGGCTGGGTGCGCTGG + Intergenic
902078977 1:13808202-13808224 TGATGCTGGGCCGGGCGCGGTGG + Intronic
902100585 1:13984295-13984317 TCCAAATAGGCCGGGCGCGGTGG - Intergenic
902314537 1:15608097-15608119 TCTAGCAGGGCCAGGCGCGGTGG - Intergenic
902316724 1:15625902-15625924 TCACTCTGGGCCGGGCACGCTGG - Intronic
902444398 1:16452781-16452803 TCAAGCTGGGCTGGGCGGGGCGG - Intronic
902798164 1:18813048-18813070 TGCAGCCAGGCCGGGCGCGGTGG + Intergenic
902874206 1:19331295-19331317 CCCATCTTGGCCGGGCGCGGTGG - Intergenic
903061792 1:20673814-20673836 TGGAGCAGGGCCGGGCGCGGTGG - Intronic
903230440 1:21919084-21919106 TCCAGCTGTGCCGAGCCTGCAGG + Intronic
903263522 1:22143377-22143399 TCTAGCCGGGCCGGGCTCGGCGG - Intronic
903374305 1:22856224-22856246 TCCATCTGGGCCTGGCACGGTGG - Intronic
903479274 1:23641356-23641378 TCAAGGTGGGCTGGGCGCGGTGG + Intergenic
903641652 1:24864102-24864124 GCCAGCTGGGCCGGGTGCGGTGG - Intergenic
903883253 1:26526732-26526754 GCCAGGTGGGCCGGGCGCGGTGG + Intergenic
903942450 1:26941214-26941236 TGATGCTTGGCCGGGCGCGCTGG - Intronic
903945195 1:26958418-26958440 AACAGCTAGGCCGGGCGCGGTGG - Intronic
904170114 1:28585794-28585816 ACCAAGTGGGCCGGGCGCGGTGG + Intergenic
904230435 1:29066131-29066153 TACATCTGGGCCGGGCGCGGTGG + Intronic
904837572 1:33349378-33349400 TCCAGGGGCGACGGGCGCGCAGG + Intronic
905579572 1:39073945-39073967 TTAATCTGGGCCGGGCGCGGTGG + Intergenic
905625928 1:39490937-39490959 TCCAGCTGGGCCAGAAGCTCTGG - Intergenic
905726178 1:40253747-40253769 TCCTTCTGGGCCGGGCGCAGTGG - Intergenic
906174763 1:43761661-43761683 TCAGGCTGGGCCGGGCGCGGTGG + Intronic
906210355 1:44009508-44009530 CCCATCTTGGCCGGGCGCGGTGG - Intronic
906252873 1:44324767-44324789 TCCATGTTGGCCGGGCGCGGTGG - Intronic
906262900 1:44406911-44406933 CCCAGCTGGCGAGGGCGCGCAGG + Intronic
906295463 1:44646548-44646570 TCCAGCTGAGCAGGGCGGGCGGG + Intronic
906301577 1:44685911-44685933 GCTATCTGGGCCGGGCGCGGTGG - Intronic
907042892 1:51279411-51279433 TACAACTGGGCCGGGCGTGGTGG + Intergenic
907128661 1:52075264-52075286 TCTCTCTGGGCCGGGCGCGGTGG + Intronic
907132409 1:52108567-52108589 TATAAATGGGCCGGGCGCGCTGG - Intergenic
907232641 1:53014190-53014212 TCTATCAGGGCCGGGCGCGGTGG - Intronic
907234001 1:53027791-53027813 TTAAGCTTGGCCGGGCGCGATGG - Intronic
907239401 1:53072771-53072793 TCTAACTAGGCCGGGCGCGGTGG + Intronic
907277927 1:53327318-53327340 TCCCACTGCGCCTGGCGCGCGGG - Intronic
907363031 1:53935972-53935994 TCTAACTAGGCCGGGCGCGGTGG + Intronic
907437227 1:54457708-54457730 CTCAGCTGGGCTGGGCGCGGTGG + Intergenic
908505502 1:64794121-64794143 CCCAGCTGGGCCAGGCGCAGTGG + Intronic
908548598 1:65187070-65187092 TCCAGGGAGGCCGGGCGCGGTGG + Intronic
908610087 1:65848429-65848451 TCAAGCTGGGCCAGGCGTGGTGG - Intronic
909636567 1:77823126-77823148 TCATGCTGGGCCGGGCGTGGTGG - Intronic
909686866 1:78359018-78359040 TCTATCTTGGCCGGGCGCGGTGG - Intronic
909914518 1:81300764-81300786 TCTACCTTGGCCGGGCGCGGTGG - Intergenic
910070261 1:83205751-83205773 TCTTTCTGGGCCGGGCGCGGTGG + Intergenic
910183182 1:84506767-84506789 CCCAGCGGAGCCGGGCGGGCGGG + Intergenic
910391990 1:86755337-86755359 ACCACCTGGGCCAGGCGCGGTGG + Intergenic
910449013 1:87328589-87328611 GCCGGCCGGGCCCGGCGCGCTGG - Exonic
910676546 1:89821546-89821568 TCCCGCAGGGCCGGCCGCCCGGG - Intronic
910707563 1:90146252-90146274 TCAAGATGGGCCGGGTGCGGTGG - Intergenic
910953209 1:92673617-92673639 TCTAGTTTGGCCGGGCGCGGTGG - Intronic
910963133 1:92783236-92783258 ACCACCTGGGCCAGGTGCGCTGG + Intronic
911246206 1:95520841-95520863 GCCATATGGGCCGGGCGCGGTGG + Intergenic
911311245 1:96294496-96294518 TGCTGCTGGGCCAGGCGCGGTGG + Intergenic
912491500 1:110065085-110065107 TCCAGCTGGGGAGGGGGCCCTGG + Intronic
912721350 1:112023063-112023085 TCAAGCCAGGCCGGGCGCGGTGG - Intergenic
912831328 1:112956351-112956373 TCTAGCTCGCCCGCGCGCGCCGG + Intronic
912854033 1:113151480-113151502 ACCGGGTGGGCCGGGCGCGGTGG + Intergenic
912922833 1:113885753-113885775 CCCAGATGGGCCAGGCGCGGTGG + Intronic
913560259 1:120011727-120011749 TACAGCTAGGCCGGGCGCGGTGG + Intronic
914252057 1:145929646-145929668 TCGAACTCGGCCGGGCGCGGTGG - Intergenic
914280847 1:146171142-146171164 TACAGCTAGGCCAGGCGCGGTGG + Intronic
914333006 1:146689744-146689766 TAAATCTGGGCCGGGCGCGGTGG + Intergenic
914541889 1:148622081-148622103 TACAGCTAGGCCAGGCGCGGTGG + Intronic
914702817 1:150149941-150149963 CCGCGCTGGGCCGGGCGGGCGGG + Intronic
914798479 1:150941852-150941874 TCCAGATGGGCCAGGCACGGTGG + Intronic
914811211 1:151029652-151029674 TCCAGCTCGGCTGGGCGCGGTGG - Intronic
914989736 1:152488343-152488365 TCCTCTTGGGCCGGGCGCGGTGG + Intergenic
915533220 1:156516424-156516446 ACCTGCTGGGCCGGGCGCAGTGG + Intergenic
916118084 1:161505176-161505198 TCCTGGTCGGCCGGGCGCGGTGG - Intergenic
916434231 1:164761728-164761750 TCCCAATGGGCCGGGCGCGGTGG - Intronic
916666942 1:166975397-166975419 GCCCGCCGGGCCGGCCGCGCAGG + Intronic
916762948 1:167833456-167833478 TCAACCTGGGCCGGGCACGGTGG + Intronic
917356905 1:174135143-174135165 CACAGCTAGGCCGGGCGCGGTGG - Intergenic
917862031 1:179155440-179155462 TACAGCTCGGCCAGGCGCGGTGG + Intronic
918284032 1:183034556-183034578 TTCAACTGGGCTGGGCGCGGTGG - Intronic
918362458 1:183772720-183772742 TCACTCTGGGCCGGGCGCGGTGG + Intronic
918620709 1:186601799-186601821 TACATCTGGGCTGGGCGCGGTGG + Intergenic
918770146 1:188546327-188546349 GTAAGCTGGGCCGGGCGCGGAGG - Intergenic
918950676 1:191132569-191132591 TACATCTGGGCCGGGCGCGGTGG + Intergenic
918963467 1:191309209-191309231 TACAGTAGGGCCGGGCGCGTTGG - Intergenic
919318704 1:196006622-196006644 TTCTGCTCGGCCGGGCGCGGTGG + Intergenic
919462159 1:197890649-197890671 CCCTGCTGGGCCGGGCGTGGTGG - Intergenic
920250459 1:204619231-204619253 ACCAGCTGGCCCGGGTGCCCAGG - Exonic
920898130 1:210078021-210078043 TGCATCTAGGCCGGGCGCGGTGG + Intronic
921381195 1:214526251-214526273 TCTAGCTTGGCCGGGCGTGGTGG - Intronic
921381250 1:214526802-214526824 AGCAGGTGGGCCGGGCGCGGTGG + Intronic
921399178 1:214701788-214701810 TGCAACTGGGCCGGGTGCGGTGG + Intergenic
921633079 1:217457938-217457960 TCTTGCTTGGCCGGGCGCGGTGG + Intronic
921866682 1:220094168-220094190 TCAAGCTGGGGCGGGAGCGGAGG + Exonic
922166374 1:223118814-223118836 TTCAGATGGGCCGGGCACGGTGG + Intronic
922469929 1:225870060-225870082 TGCACCTGGGCCGGGCGCGGTGG + Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
923564084 1:235063703-235063725 TACAACTGGGCCGGGCGCAGTGG + Intergenic
923702963 1:236317359-236317381 GAAAGCTGGGCCGGGCGCGGTGG - Intergenic
1063120427 10:3101962-3101984 TGAAGTTGGGCCGGGCGCGGTGG + Intronic
1063131797 10:3184676-3184698 TGCATCTGGGCCGGGTGCGGTGG - Intergenic
1063458507 10:6201562-6201584 CCCGGGTGGGGCGGGCGCGCGGG + Intronic
1063634782 10:7771603-7771625 CTCAACTGGGCCGGGCGCGGTGG + Intronic
1063699117 10:8367303-8367325 TTAAGATGGGCCGGGCGCGGTGG - Intergenic
1064072854 10:12245542-12245564 TCCAGCAGGGCCGGGCATGGTGG - Intronic
1064374353 10:14782369-14782391 TCTAGATAGGCCGGGCGCGGTGG + Intergenic
1064766841 10:18683913-18683935 TGCATCTGGGCCGGGCGTGGTGG - Intergenic
1064767839 10:18693025-18693047 TACAGCAAGGCCGGGCGCGGTGG - Intergenic
1064789827 10:18944865-18944887 TAGAACTGGGCCGGGCGCGGTGG - Intergenic
1064825443 10:19393740-19393762 CCCATCAGGGCCGGGCGCGGTGG - Intronic
1065006361 10:21384001-21384023 TTCCTCTGGGCCGGGCGCGGTGG + Intergenic
1065124600 10:22562259-22562281 TTCGGCTTGGCCGGGCGCGGTGG + Intronic
1065537605 10:26730197-26730219 TCCAACTAGGCTGGGCGCGGTGG - Intronic
1065776011 10:29120998-29121020 TCCAGTTAGGCCAGGCGCGGTGG + Intergenic
1065807634 10:29409679-29409701 TCCAGGTGAGGCGGGCGTGCGGG + Intergenic
1065911212 10:30307557-30307579 TCTAACTTGGCCGGGCGCGGTGG - Intergenic
1065991320 10:31013030-31013052 CCCAACTGGGCCGGGCGCGGTGG + Intronic
1066127127 10:32352332-32352354 TACAGCTGGGCGGGGCGCAGTGG - Intronic
1066380305 10:34895620-34895642 TCCACCAGGGCCAGGCGCGGTGG + Intergenic
1066428704 10:35332889-35332911 CTCAGGTGGGCCGGGCGCGGTGG - Intronic
1066622468 10:37372240-37372262 TACAGATGGGCCGGGCGTGGTGG - Intronic
1068353862 10:55884554-55884576 TCCAGCTGGGCCAGGTGCAGTGG - Intergenic
1068692568 10:59932079-59932101 TGCAGCCGGGCCGGGCGCGGTGG - Intergenic
1068767503 10:60779093-60779115 TCCAGGTGGGCCGGGGCCGTGGG - Intronic
1069390539 10:67930091-67930113 CACAGCTGGGCCGGGCGCGGTGG - Intronic
1069513455 10:69058896-69058918 TCCACCTTGGCCGGGCGCACTGG + Intergenic
1069522170 10:69131445-69131467 TCATTCTGGGCCGGGCGCGGTGG + Intronic
1069623606 10:69852998-69853020 TCCAGCTGGGGCGGGGGAGCGGG + Intronic
1069695510 10:70382627-70382649 GCCGGCGGGGCGGGGCGCGCGGG + Intronic
1069970650 10:72165401-72165423 TTCAACTTGGCCGGGCGCGGTGG - Intronic
1070162595 10:73874731-73874753 CCTCGCTGGGCCAGGCGCGCGGG + Intergenic
1070891062 10:79942467-79942489 TCCAGCTGGACCAGGCACACCGG + Exonic
1070976271 10:80608392-80608414 AGCATCTGGGCCGGGCGCGGTGG - Intronic
1071114427 10:82200908-82200930 GACAGCTGGGCCGGGCACGTTGG + Intronic
1071857842 10:89644572-89644594 TCCCGCTGGGAGGGGAGCGCGGG - Intronic
1072186990 10:93049346-93049368 TGCTGCTGGGCCGGGCACGGTGG - Intronic
1072244834 10:93534177-93534199 GCTAGCTGGGCCGGGTGCGGTGG - Intergenic
1072256555 10:93626973-93626995 GCTAGATGGGCCGGGCGCGGTGG + Intronic
1072351535 10:94562066-94562088 TACATCTTGGCCGGGCGCGGTGG - Intronic
1072723376 10:97795085-97795107 TCAAGCTGGGCCGGGCATGGTGG - Intergenic
1072920436 10:99572544-99572566 CCCACGTTGGCCGGGCGCGCTGG + Intergenic
1073236305 10:102019638-102019660 AAAAGCTGGGCCGGGCGCGGTGG + Intronic
1073481780 10:103790439-103790461 TCTTTCTGGGCCGGGCGCGGTGG - Intronic
1073504603 10:103974322-103974344 TTCATCTTGGCCGGGCGCGGTGG + Intronic
1075019235 10:118937687-118937709 GACAGATGGGCCGGGCGCGGTGG + Intergenic
1075037571 10:119081934-119081956 TCCTTCTGGGCTGGGCGCGGTGG - Intergenic
1075106511 10:119543059-119543081 TGAAGCTGGGCGGGGCGGGCCGG - Intergenic
1075109013 10:119562672-119562694 TCCATCAGGGCCGGGCACGATGG + Intergenic
1075110145 10:119572695-119572717 TACAACTGGGCCGGGCGCAGTGG - Exonic
1075127455 10:119711945-119711967 GCAAACTGGGCCGGGCGCGGTGG - Intergenic
1075403892 10:122181029-122181051 TCCCTCTTGGCCGGGCGCGGTGG - Intronic
1075586002 10:123658720-123658742 TCTTGCTCGGCCGGGCGCGGTGG + Intergenic
1075639232 10:124052746-124052768 TCTAGCCCGGCCGGGCGCGGTGG + Intronic
1075703846 10:124486743-124486765 TACAGCTGGGCCAGGGCCGCAGG + Intronic
1076149014 10:128148303-128148325 ACCAACCGGGCCGGGCGCGGTGG + Intergenic
1076274190 10:129182690-129182712 TCAAAGTGGGCCGGGCGCGGTGG - Intergenic
1076769788 10:132656670-132656692 GCCAGCTGGGCCAGGTGAGCCGG + Intronic
1076877264 10:133221992-133222014 CCTAGGTGGGCCGGGCGCGGTGG + Intronic
1076882058 10:133244430-133244452 ATCACCTGGGCCGGGCGCGGTGG + Intergenic
1077089004 11:769901-769923 TTCAGTTGGGCCGGGCGCAGTGG - Exonic
1077122982 11:919082-919104 TCCACCGGGGCCGGGCCCGGTGG - Intergenic
1077544970 11:3165242-3165264 TCCGGGCCGGCCGGGCGCGCGGG + Exonic
1077613948 11:3661783-3661805 TTCAGGTGGGCCGGGCACGGTGG - Intronic
1078530179 11:12131004-12131026 CCCAGTAGGGCCGGGCGCGGTGG + Intronic
1078545003 11:12240874-12240896 CCCAGCTGGGCCCGGCTTGCGGG + Intronic
1078622087 11:12917598-12917620 TGCTGCTGGGCCAGGCACGCTGG - Intronic
1078731783 11:13981611-13981633 TCTAGCTCGGCCGGGCACGGTGG - Intronic
1079116928 11:17645947-17645969 TCCAGCTAGCCCGGGCCCCCAGG - Intronic
1079480824 11:20878071-20878093 GCCATTTGGGCCGGGCGCGGTGG + Intronic
1079543881 11:21609434-21609456 TACAGCAGGGCCGGGTGCGGTGG + Intergenic
1080551284 11:33375988-33376010 TCGAGCCCGGCCGGGCGCGCGGG + Intergenic
1080631585 11:34082097-34082119 TTCAACTAGGCCAGGCGCGCTGG - Intronic
1080886853 11:36376007-36376029 GGCAGCTGGGCCGGGGGCGGGGG + Exonic
1080946486 11:36980142-36980164 CCCGGCTGGGCCGGGCACGGTGG - Intergenic
1081811678 11:45917735-45917757 TCCAGCTGGGCCGTGGCGGCCGG + Exonic
1081883014 11:46470299-46470321 GCCAGGTTGGCCGGGCGCGGTGG + Intronic
1082063806 11:47882576-47882598 TGCAGGTAGGCCGGGCGCGGTGG - Intergenic
1083223703 11:61270204-61270226 GTAAGCTGGGCCGGGCGCGGTGG - Intronic
1083413669 11:62511541-62511563 TACTGCTGGGCCGGACGCGGTGG - Intronic
1083564031 11:63697761-63697783 CACAGGTGGGCCGGGCGCGGTGG - Intronic
1084102708 11:66960228-66960250 TTAATCTGGGCCGGGCGCGGTGG - Intergenic
1084121897 11:67074174-67074196 TCCAGTTCGGCTGGGCGCGGTGG + Intergenic
1084214021 11:67637918-67637940 TTAAGGTGGGCCGGGCGCGGTGG + Intronic
1084397095 11:68918790-68918812 TGCAGCCAGGCCGGGCGCGGTGG - Intronic
1085354654 11:75824958-75824980 ACAAACTTGGCCGGGCGCGCTGG - Intronic
1085606348 11:77903055-77903077 GGCAGTTGGGCCGGGCGCGGTGG - Intronic
1085617111 11:78009024-78009046 GCAAGCAGGGCCGGGCGCGGTGG - Intergenic
1085848977 11:80098228-80098250 TCCAGGCCGGCCGGGCGCGGTGG + Intergenic
1086187275 11:84033749-84033771 CACAGCCGGGCCGGGCGCGGTGG + Intronic
1086459802 11:86995224-86995246 CCCAGCTGGGCCGGGCGCAGTGG - Intergenic
1086715475 11:90056245-90056267 TCCAGATGGGCTGGGCGCGGTGG - Intergenic
1087745282 11:101937864-101937886 TCCATTTTGGCCGGGCGCGGTGG + Intronic
1089153810 11:116385389-116385411 CCTAACTGGGCCGGGCGCGGTGG + Intergenic
1089356542 11:117857692-117857714 TCCACCTGGGCCGGGTGTGGTGG - Intronic
1089527638 11:119107627-119107649 TCCCCCGGGGCTGGGCGCGCGGG - Exonic
1089784357 11:120897345-120897367 TACATCTCGGCCGGGCGCGGTGG + Intronic
1089851260 11:121498586-121498608 CCCAGCTGGGCCGGGCATGGTGG + Intronic
1090190285 11:124762371-124762393 TCCTCCCGGGCGGGGCGCGCGGG + Intergenic
1090326359 11:125889443-125889465 CCAAACTGGGCCGGGCGCGGTGG + Intronic
1090408751 11:126493232-126493254 TGGAGCTGGGCTGGGCGCGGTGG + Intronic
1090620923 11:128560398-128560420 ACCATCTCGGCCGGGCGCGGTGG - Intronic
1090744520 11:129695660-129695682 TCCAGCTGAGCCAGGCCCGCGGG + Intergenic
1090803462 11:130188679-130188701 TCCTGCTGGGCTGTGTGCGCTGG + Intronic
1090930072 11:131289648-131289670 GCAAGGTGGGCCGGGCGCGGTGG - Intergenic
1091459694 12:634544-634566 TGCAACTAGGCCGGGCGCGGTGG - Intronic
1091616058 12:2052491-2052513 CCCTGCTGGGCCGGCCACGCCGG - Intronic
1091860663 12:3779594-3779616 TCAGGTTGGGCCGGGCGCGGTGG + Intergenic
1092894859 12:13001371-13001393 TCAAGCTGGGCCGGGCGGAGGGG + Intergenic
1093109046 12:15127003-15127025 GCTATCTGGGCCGGGCGCGGTGG - Intronic
1093220477 12:16414700-16414722 ACCACCTTGGCCGGGCGCGGTGG - Intronic
1094150856 12:27281370-27281392 TAAAGCCGGGCCGGGCGCGGTGG - Intronic
1094818137 12:34205904-34205926 TCCAGCTGTGGTGGGGGCGCAGG - Intergenic
1095476358 12:42590285-42590307 CCCAGCTCGGCAAGGCGCGCCGG - Intronic
1095549474 12:43416807-43416829 TTCAGTTTGGCCGGGCGCGGTGG - Intronic
1095653505 12:44641982-44642004 AGAAACTGGGCCGGGCGCGCTGG - Intronic
1095778315 12:46033116-46033138 TGCTGCCGGGCCGGGCGCGGTGG - Intergenic
1096062941 12:48717137-48717159 GGCAGATGGGCCGGGCGCGGTGG + Intergenic
1096232431 12:49903900-49903922 TGCAGCCGGGCCAGGCGAGCCGG + Intronic
1096680915 12:53254784-53254806 TCTAGCTGGGCTGGGCGTGGTGG - Intergenic
1096833396 12:54332036-54332058 TCCAGCAAGGCCGGGCGCGGTGG + Intronic
1097024880 12:56047498-56047520 GCCAGATAGGCCGGGCGCGGTGG + Intergenic
1097073954 12:56378464-56378486 TACATCTGGGCCGGGCGCAGTGG + Intergenic
1097081230 12:56432655-56432677 GGCAGCTTGGCCGGGCGCGGTGG + Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1098557027 12:71830736-71830758 TCAAAATGGGCCGGGCGCGGTGG - Intergenic
1099119548 12:78671032-78671054 TTCAGATGGGCCAGGCGCGGTGG - Intergenic
1099569944 12:84304623-84304645 TCCATACGGGCCGGGCGCGGTGG + Intergenic
1100251679 12:92831796-92831818 TCCAATTTGGCCGGGCGCGGTGG + Intronic
1100294735 12:93250100-93250122 TACATCTGGGCCGGGCACGGTGG - Intergenic
1100452807 12:94723613-94723635 TGCAGCTGGGCTGGGCGTGATGG - Intergenic
1100702270 12:97161263-97161285 CCAAGCTCGGCCGGGCGCGGTGG - Intergenic
1100812249 12:98350674-98350696 TTCTGCTGGGCCGGGCGCGGTGG + Intergenic
1100823046 12:98449575-98449597 CCCAGCTTGGCCGGGTGCACTGG - Intergenic
1101386962 12:104266674-104266696 TACAACAGGGCCGGGCGCGGTGG + Intronic
1101740365 12:107495407-107495429 TCCAGCTGGGACTGGCCTGCCGG - Intronic
1102120202 12:110434288-110434310 ACCAGCCGGGCCGGGTGCGATGG - Intergenic
1102307192 12:111814058-111814080 CCCATCTCGGCCGGGCGCGGTGG + Intergenic
1103005278 12:117415917-117415939 TCCAACTCGGCCGGGTGCGGTGG + Intronic
1103028819 12:117595648-117595670 TCTAGCAGGGCCGGGCGCGGTGG - Intronic
1103322090 12:120098169-120098191 TCCAGCTGGGCCGGGCGCGCCGG - Intronic
1103349705 12:120275618-120275640 TGGAGCTGGGCCAGGCGCGGTGG - Intergenic
1103419951 12:120772307-120772329 AGCAACTGGGCCGGGCGCGGTGG - Intronic
1103543544 12:121683229-121683251 GCCATCTGGGCCGGGCACGGTGG + Intergenic
1103616181 12:122154099-122154121 TGCTGCTGGGCCAGGCGCGGTGG - Intergenic
1103880403 12:124161606-124161628 TCCATGTTGGCCGGGCGCGGTGG - Intronic
1103984563 12:124758672-124758694 GCCAGCTGGGGCAGGGGCGCCGG - Intergenic
1104334018 12:127875856-127875878 GCTATCTGGGCCGGGCGCGGCGG + Intergenic
1104426412 12:128681955-128681977 ACCATCTGGGCCGGGCACGGTGG - Intronic
1104531226 12:129572734-129572756 ACCCTCTGGGCCGGGCGCGCTGG - Intronic
1104531581 12:129576059-129576081 TCTATCTGGGCCGGGCGCGGTGG - Intronic
1104620249 12:130306423-130306445 TCAATGTGGGCCGGGCGCGGTGG - Intergenic
1104658962 12:130595269-130595291 TTCATCTTGGCCGGGCGCGGTGG + Intronic
1104853550 12:131890915-131890937 TTAAGATGGGCCGGGCGCGGTGG + Intergenic
1104895754 12:132162919-132162941 GCCAGCTGGGCTGGGAGGGCAGG - Intergenic
1104977812 12:132560094-132560116 TCCGGCTGAGCAGGGCACGCGGG + Intronic
1105030289 12:132878087-132878109 TCAGGATGGGCCGGGCGCGGTGG - Intronic
1105363695 13:19744848-19744870 TCTAGTTGGGCCGGGCGCGGTGG - Intronic
1105375523 13:19840962-19840984 GCCAGGTGGGCCGGGCGCGGTGG - Intronic
1105517544 13:21104076-21104098 ACAATCTGGGCCGGGCGCGGTGG - Intergenic
1105902563 13:24768569-24768591 TACAGCTTGGCCAGGCGCGGTGG - Intronic
1106046945 13:26151548-26151570 ACCATCTGGGCCGGGCGCGGTGG - Intronic
1106218050 13:27720588-27720610 AGCAGATGGGCCGGGCGCGGTGG + Intergenic
1106480079 13:30130839-30130861 CACACCTGGGCCGGGCGCGGTGG + Intergenic
1107295585 13:38903812-38903834 GCCAAATGGGCCGGGCGCGGTGG + Intergenic
1108012291 13:46029713-46029735 TCCATCTCGGCCGGGCGCGGTGG - Intronic
1108711152 13:53033771-53033793 TCCAGAATGGCCGGGCGCGGTGG + Intronic
1108871411 13:54990987-54991009 TACAGTTCGGCCGGGCGCGGTGG + Intergenic
1109947877 13:69462269-69462291 ACAAGGTGGGCCGGGCGCGGTGG + Intergenic
1110226405 13:73124313-73124335 TCTGGCTAGGCCGGGCGCGGTGG + Intergenic
1111280531 13:86017012-86017034 GACAGCTCGGCCGGGCGCGGTGG - Intergenic
1111989526 13:95102977-95102999 TGAAGCTGGGCCGGGCGCAGTGG + Intronic
1112011868 13:95300124-95300146 TCCATCTTGGCCTGGCGCGGTGG - Intronic
1112344122 13:98576603-98576625 CCCGGCCGAGCCGGGCGCGCGGG + Intronic
1112393642 13:99008519-99008541 TCCACATGGGCCGGGCGCGGTGG - Intronic
1113424399 13:110196038-110196060 TCTAGCTGGGGTGGGCGAGCTGG - Intronic
1113432170 13:110260760-110260782 TCAAAGTGGGCCGGGCGCGGTGG + Intronic
1113843550 13:113373494-113373516 ACCAGCTTGGCTGGGCGCGGTGG + Intergenic
1113859770 13:113473714-113473736 TACAGCTGGGCCGGCCGCAGTGG + Intronic
1113860303 13:113479464-113479486 TCCATCTGGGCCAGGCACGGTGG + Intronic
1113982929 13:114291020-114291042 TCCACATGGGCCGGGCGTGGTGG - Intronic
1113987701 13:114331688-114331710 AACAGCTGGGCCGGGCGCAGTGG - Intergenic
1114144601 14:19959865-19959887 TCTACCTTGGCCGGGCGCGGTGG + Intergenic
1114287594 14:21259910-21259932 GTCAGGTGGGCCGGGCGCGGTGG + Intronic
1114470647 14:22958603-22958625 GACAGGTGGGCCGGGCGCGGTGG - Intronic
1114541147 14:23460331-23460353 TTCAGCTAGGCCAGGCGCGGTGG + Intergenic
1114575207 14:23706649-23706671 TCCTCCAGGGCCGGGCGCGGTGG - Intergenic
1115340959 14:32292518-32292540 ACCCTCTGGGCCGGGCGCGGTGG + Intergenic
1115452091 14:33559729-33559751 TTCAGCGTGGCCGGGCGCGGTGG + Intronic
1115545104 14:34458731-34458753 TCAATCTTGGCCGGGCGCGGTGG - Intronic
1115549249 14:34490394-34490416 ACTATCTGGGCCGGGCGCGGTGG - Intergenic
1115567465 14:34637134-34637156 TCATGCTGGGCCGGGCGCGGTGG - Intergenic
1115573735 14:34691033-34691055 TCCTGCTTGGCCGGGTGCGGTGG - Intergenic
1115708697 14:36026246-36026268 TTCATCTTGGCCGGGCGCGGTGG - Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116824458 14:49658361-49658383 ACCAGAGGGGCCGGGCGCGGTGG - Intronic
1117156979 14:52951121-52951143 CCTGGCTGGGCTGGGCGCGCTGG + Intronic
1117368219 14:55051866-55051888 TCCCGCTTGGCCGCGCCCGCGGG - Intronic
1117803155 14:59465134-59465156 GCCAGGTGGGCCGGCCGCGGAGG + Exonic
1118286940 14:64483562-64483584 TCCAGCTAGGCCAGGCGTGGTGG - Exonic
1118344317 14:64925383-64925405 TCCAGCTGGGATGGGTGCGGTGG + Intronic
1118373228 14:65155364-65155386 TACAGCAGGGCCAGGCGCGGTGG + Intergenic
1118714557 14:68549699-68549721 TCCAGGGCGGCCGGGCGCGGTGG - Intronic
1118856539 14:69627749-69627771 ACCATCTGGGCCGGGCACGGTGG - Intronic
1119055942 14:71419782-71419804 TCCTCCTTGGCCGGGCGCGGTGG - Intronic
1119161136 14:72453326-72453348 TCCTTCAGGGCCGGGCGCGGTGG + Intronic
1119252391 14:73168066-73168088 TTCAGCTGGGCTGGGTGCGGTGG + Intronic
1119373497 14:74168379-74168401 ACCAGCTTTGCCGGGCGCGGTGG + Intronic
1119466919 14:74865553-74865575 TTGAACTGGGCCGGGCGCGGTGG + Intronic
1119635115 14:76267370-76267392 TGCACCTGGGCCGGGCGTGGTGG - Intergenic
1119724800 14:76915461-76915483 TCCTGGTGGGCTGGGCGCGGTGG + Intergenic
1119834862 14:77739845-77739867 TACAGAGGGGCCGGGCGCGGTGG + Intronic
1119968074 14:78939130-78939152 TCACTCTGGGCCGGGCGCGGTGG - Intronic
1120153935 14:81070339-81070361 GCCAGCAAGGCTGGGCGCGCTGG + Intronic
1120315344 14:82885677-82885699 TCCAGTTAGGCCGGGCGCGGTGG + Intergenic
1120993006 14:90395215-90395237 TGCATCTTGGCCGGGCGCGGTGG - Intergenic
1121094526 14:91206668-91206690 TGCAGCTGGGCCAGGCGCAGTGG - Intronic
1121197772 14:92089623-92089645 TCTAACAGGGCCGGGCGCGGTGG - Intronic
1121534588 14:94682419-94682441 TCCAGGAGGGCCGGGCACACAGG - Intergenic
1121765984 14:96486069-96486091 CCTAGCTGGGCTGGGCGCGGTGG - Intronic
1122197487 14:100099858-100099880 TAAAGCTGGGCCGGGCGCAGTGG - Intronic
1122242577 14:100378669-100378691 TCCAGGCAGGCCGGGCGCGGTGG + Intronic
1122372266 14:101235343-101235365 TCCTCCTGGGCAGGGCCCGCTGG + Intergenic
1122513108 14:102286010-102286032 TGCATCCGGGCCGGGCGCGGTGG + Intronic
1122576927 14:102748722-102748744 TCCTTGTGGGCTGGGCGCGCTGG - Intergenic
1122627379 14:103091429-103091451 CCCTGCTGGACGGGGCGCGCTGG - Intergenic
1122703333 14:103605007-103605029 TACAGCAGGGCCTGGCACGCAGG - Intronic
1122818677 14:104328757-104328779 TCCAGCTGGGCCTGGTGCCTGGG + Intergenic
1123001940 14:105300567-105300589 TCGAGCTGGACGCGGCGCGCGGG - Exonic
1123034319 14:105465734-105465756 TCCAGCTGGGCCAGGGTAGCCGG - Intronic
1123540130 15:21281651-21281673 TACAACTGGGCCGGGCGCGGTGG + Intergenic
1124060000 15:26282534-26282556 TACAGGTTGGCCTGGCGCGCTGG - Intergenic
1124476787 15:30041633-30041655 TCCATCTTGGCTGGGCGCGGTGG - Intergenic
1124626117 15:31308413-31308435 TGCAGGTGGGCCGGGCCAGCAGG + Intergenic
1124639022 15:31383611-31383633 TCAAGATGGGCCGGGCGCGGTGG + Intronic
1124647327 15:31447634-31447656 ACCAGATGGGCCGGGCGCAGTGG - Intergenic
1124700424 15:31907615-31907637 TCCAGCAGGGGCGGGCCCGTGGG + Intergenic
1124709884 15:31999311-31999333 ACGAGCTGGGCCGGGCGCGGTGG - Intergenic
1126511094 15:49475698-49475720 TACAGCTGGGGCGGGCACGGTGG + Intronic
1126597768 15:50399013-50399035 TGTAGCTTGGCCGGGCGCGGTGG + Intergenic
1127186113 15:56482464-56482486 TCCAGGGAGGCCGGGCGCGGTGG - Intergenic
1127834223 15:62777247-62777269 TCCCGCCCGGCCGGGCGCGGTGG + Intronic
1127910743 15:63414171-63414193 TCCATTTGGGCCAGGCGCGGTGG + Intergenic
1128067659 15:64774986-64775008 TCGAGGCGGGCCGCGCGCGCCGG - Intronic
1128547581 15:68578673-68578695 TCCCGCTGGCCCGGGGACGCTGG - Intergenic
1129016757 15:72475032-72475054 GCCAGCTGGACCGGGCCCGACGG + Intronic
1129275159 15:74440616-74440638 TCCCCCTTGGCCGGGCGCGGTGG + Intergenic
1129285890 15:74524612-74524634 GCCAGGTTGGCCGGGCGCGGTGG + Intergenic
1129340134 15:74880448-74880470 TCAGGCTGGGCCGGGTGCGGTGG - Intergenic
1129532250 15:76277788-76277810 TCCAGGTGGGCAGGGCACGGTGG - Intronic
1129774244 15:78224430-78224452 TCAAGCTGGGCCGGGCGTGGTGG + Intronic
1129801580 15:78418868-78418890 TCTAGCTCGGCTGGGCGCGGTGG - Intergenic
1129860325 15:78855535-78855557 TCCAAAGGGGCCGGGCGCGGTGG + Intronic
1129861828 15:78869169-78869191 TACAACTGGGCCGGGCGTGGTGG + Intronic
1129883523 15:79022885-79022907 ACCCTCTGGGCCGGGCGCGGTGG + Intronic
1129896857 15:79114832-79114854 TCCTGCTAGGCCGGGCGCGGTGG - Intergenic
1130239265 15:82170399-82170421 TCCAGTGGGGCCGGGCGCGGTGG - Intronic
1130288928 15:82579623-82579645 TCAAGCACGGCCGGGCGCGGTGG + Intronic
1131045468 15:89311455-89311477 TCCAACTGATCCGGGCGGGCAGG - Intronic
1131490144 15:92855515-92855537 TGTGGCTGGGCCGGGCGCGGTGG - Intergenic
1131884696 15:96899265-96899287 TGGAGATGGGCCGGGCGCGGTGG + Intergenic
1132006672 15:98233592-98233614 CCCAGCTGGGCCGGGCACGGTGG - Intergenic
1202948440 15_KI270727v1_random:8809-8831 TACAACTGGGCCGGGCGCGGTGG + Intergenic
1132488628 16:211862-211884 TGCTGCTGGGCCGGGAGAGCTGG - Intronic
1132566004 16:623360-623382 TCATGCTGGGCCGGGCGCGGTGG + Intronic
1132566854 16:627506-627528 GCCAGCGGGGCCGGGGGCGGCGG + Exonic
1132583070 16:694152-694174 CCGCGCTGGGCCGGGGGCGCGGG + Exonic
1132752108 16:1462871-1462893 TGAAGCTGGGCCGGGCGCAATGG + Intronic
1133121171 16:3609114-3609136 CACAACTGGGCCGGGCGCGGTGG + Exonic
1133800655 16:9082444-9082466 CACAGCTGGGCCGGGCACGGTGG - Intergenic
1134159458 16:11874902-11874924 AACAGCTGGGCCGGGCACGGTGG + Intronic
1134164310 16:11917581-11917603 TACAGATCGGCCGGGCGCGGTGG - Intergenic
1135070999 16:19351554-19351576 TCCTTCTTGGCCGGGCGCGGTGG + Intergenic
1135166712 16:20145679-20145701 TCATGCTGGGCCGGGCGCGGTGG + Intergenic
1135486000 16:22865265-22865287 TCCTGCTAGGCCGGGCGCGGTGG + Intronic
1136237259 16:28922297-28922319 TTCAGCTGGGCCGGGCGTGCTGG + Intronic
1136249921 16:28997712-28997734 TCCACCTCGGCCGGGCGCGGTGG + Intergenic
1136579912 16:31145080-31145102 TCCGTCTCGGCCGGGCGCGGTGG + Intronic
1137294625 16:47078992-47079014 TACAGCTGGGCTGGGCGCCTTGG + Exonic
1137457810 16:48631452-48631474 TTCACCTGGGCCGGGCGCGGTGG + Intergenic
1138450784 16:57092584-57092606 TCCTCCCGGGCCGGGCGGGCGGG - Exonic
1138450817 16:57092684-57092706 TCCTGCTCGGCCGGGCCCGCGGG - Exonic
1138518129 16:57550263-57550285 TATAGATGGGCCGGGCGCGGTGG - Intronic
1138693633 16:58791115-58791137 TCCAGCTGGCCCAGAAGCGCCGG + Intergenic
1138972192 16:62159195-62159217 TCAAACCGGGCCGGGCGCGGTGG + Intergenic
1139391160 16:66606703-66606725 TCTACCTGGGCCGGGCGTGGTGG + Intronic
1139457838 16:67096685-67096707 TACATCTGGGCCGGGCGCGGTGG + Intronic
1139458906 16:67106836-67106858 CCAAGCTCGGCCGGGCGCGGTGG + Intergenic
1139703869 16:68726864-68726886 CACAGCTGGGGCGGGCGCGGTGG - Intergenic
1140906471 16:79413518-79413540 CACAGCTCGGCCGGGCGCGGTGG - Intergenic
1140927619 16:79599291-79599313 GCCCGCGGCGCCGGGCGCGCCGG + Exonic
1140976089 16:80061605-80061627 ACCATCTGGGCCGGGCGCGGTGG - Intergenic
1141052276 16:80780689-80780711 TACATCTGGGCCGGGCGCGGTGG - Intronic
1141054507 16:80803674-80803696 CCCGGCTGGGCCGGGGGCGCGGG - Intronic
1141443009 16:84041598-84041620 TAAAGCTGGGCCGGGCACGGTGG - Intronic
1141511385 16:84514406-84514428 TTGAGCTGGGCCGTGCGCGTGGG - Intronic
1141743101 16:85907390-85907412 GCTACCTGGGCCGGGCGCGGTGG + Intronic
1142023171 16:87796669-87796691 TCCATCTCAGCCGGGCGCGGTGG - Intergenic
1142159399 16:88548921-88548943 TTCATGTGGGCCGGGCGCGGTGG - Intergenic
1142233001 16:88908570-88908592 CCCAGCTGGGCAGGGCGGGCTGG - Intronic
1142402226 16:89865680-89865702 TAAGGCTGGGCCGGGCGCGGTGG + Intronic
1142415972 16:89942279-89942301 TCCCTCTGGGCCGGGCGCAGTGG - Intergenic
1142520712 17:502802-502824 TACAGTGGGGCCGGGCGCGGTGG - Intergenic
1142580399 17:938392-938414 CCCAGCCCGGCCGGGCGCGGCGG + Intronic
1142623842 17:1180221-1180243 TCCTGCTGAGCCCGGCGCGGGGG - Intronic
1142631887 17:1230512-1230534 GGGAGCTGGGCCGGGCGCGGTGG + Intergenic
1142685964 17:1577149-1577171 CCCAGCAGGGCCGGGCGCGGTGG - Intronic
1142740003 17:1926377-1926399 CCAAACTGGGCCGGGCGCGGTGG - Intergenic
1143147700 17:4787327-4787349 TCCTGTTGGACCGGGCGCGGTGG - Intergenic
1143586657 17:7853867-7853889 TGCATCTGCGCCGGGCGGGCGGG - Exonic
1143915285 17:10287411-10287433 TCCAGCAAGGCAGGGCGCGGTGG - Intergenic
1144069377 17:11654066-11654088 TCGATCTAGGCCGGGCGCGGTGG + Intronic
1144113902 17:12066962-12066984 GCCATGTGGGCCGGGCGCGGTGG - Intronic
1144124542 17:12190190-12190212 TGCAGCTAGGCCGGGCACGGTGG + Intergenic
1144485455 17:15660609-15660631 TACAGAGGGGCCGGGCGCGGTGG + Intronic
1144537708 17:16107180-16107202 TCTATCTGGGCCGGGCGCAGTGG - Intronic
1144551753 17:16246974-16246996 TTGATCTGGGCCGGGCGCGGTGG - Intronic
1144810699 17:17997087-17997109 CCCAGCTGGGACCGGCTCGCAGG + Intronic
1145886264 17:28384482-28384504 TCCAGCTGGGCACGGAGGGCAGG - Exonic
1145995915 17:29104891-29104913 GCCAGTTGGGCCAGGCGCGGTGG + Intronic
1146010088 17:29187163-29187185 TCAGGCCGGGCCGGGCGCGGTGG + Intergenic
1146023705 17:29301196-29301218 TCCAGGTGAGCCGGGCGCAGTGG - Intergenic
1146190417 17:30760707-30760729 TCCTGGTGGGCCGGGCACGGTGG + Intergenic
1146256181 17:31392402-31392424 TCCTGCTGGGCCGGGCCAGGGGG + Intronic
1146307598 17:31742559-31742581 TCCAGCTGAGCCAGGCACGGTGG + Intergenic
1146335584 17:31967359-31967381 TCCTGGTGGGCCGGGCACGGTGG + Intronic
1146429470 17:32777656-32777678 TCCTGTTCGGCCGGGCGCGGTGG + Intronic
1146773319 17:35588427-35588449 TCAAGTTTGGCTGGGCGCGCTGG - Intronic
1146806704 17:35870755-35870777 AGCAGGTGGGCCGGGCGCGGTGG - Intergenic
1146853845 17:36247670-36247692 CCAAGCTCGGCCGGGCGCGGTGG - Intronic
1146869752 17:36371562-36371584 CCAAGCTCGGCCGGGCGCGGTGG - Intronic
1146877107 17:36422642-36422664 CCAAGCTCGGCCGGGCGCGGTGG - Intronic
1146955476 17:36934534-36934556 CCCAGCTGGGACGGGGGCGGAGG + Intergenic
1147004381 17:37390339-37390361 GCCAGCTGGGCCGGGCACGGTGG + Intronic
1147072631 17:37972186-37972208 CCAAGCTCGGCCGGGCGCGGTGG - Intergenic
1147084153 17:38051724-38051746 CCAAGCTCGGCCGGGCGCGGTGG - Intronic
1147100101 17:38175690-38175712 CCAAGCTCGGCCGGGCGCGGTGG - Intergenic
1147142360 17:38466699-38466721 GCCAGCTGGGCCAGGAGGGCTGG + Exonic
1147246686 17:39125964-39125986 TGCACATGGGCCGGGCGCGGTGG + Intronic
1147407684 17:40224531-40224553 GCAGGCTGGGCCGGGCGCGGTGG - Intronic
1147431490 17:40373838-40373860 TCCATGTTGGCCGGGCGCGGTGG - Intergenic
1147558579 17:41495315-41495337 TGCAGCTGTGCAGGGAGCGCTGG - Intergenic
1147582816 17:41636596-41636618 GCCAGCTGGGCCAGCCGGGCAGG + Intergenic
1147592618 17:41694542-41694564 TCATGATGGGCCGGGCGCGGTGG + Intergenic
1147646043 17:42034490-42034512 AACAGCTGGGCCAGGCGCGGTGG + Intronic
1147670449 17:42173986-42174008 TCCAGCTTGGCCGGGCGCAGTGG - Intronic
1147716395 17:42511679-42511701 AACAGCTGGGCCAGGCGCGGGGG + Intronic
1147818195 17:43225375-43225397 TCATGCTGGGCCGGACGCGGTGG + Intergenic
1147922658 17:43927541-43927563 TCCAGCGGGGCGGGGCGGGAAGG - Intergenic
1147962147 17:44174330-44174352 GCCAGTTGGGCCGGGCGCGGTGG - Intronic
1148249329 17:46061802-46061824 TACAGATTGGCCGGGCGCGGTGG + Intronic
1148503518 17:48109543-48109565 TCCAGATGGGCCGGGTGCGGTGG - Intronic
1148575726 17:48709656-48709678 GGCAGATGGGCCGGGCGCGGTGG - Intergenic
1148601630 17:48898778-48898800 TCCTGCTCGGCCGGGCGCGGTGG + Intergenic
1148735339 17:49861886-49861908 GGCATCTGGGCCGGGCGCGGTGG + Intergenic
1148774585 17:50088345-50088367 CCCAGGTGGGCCGGGGGCGGGGG - Intronic
1149705505 17:58691379-58691401 GCCAACAGGGCCGGGCGCGGTGG + Intronic
1149799756 17:59556637-59556659 CCCAGTTGTGCCGGGCGCGGTGG + Intergenic
1149854070 17:60064020-60064042 TCCCACTGGGCCGGGTGCGGTGG + Intronic
1150298222 17:64026396-64026418 TCAATTTGGGCCGGGCGCGGTGG + Intergenic
1150394689 17:64812071-64812093 TGAAGCTGGGCCGGGCACGGTGG + Intergenic
1150610262 17:66727852-66727874 TCCAGGTGGGCAGGGCGCCAGGG - Intronic
1150810232 17:68350496-68350518 TTGGGCTGGGCCGGGCGCGGTGG + Intronic
1150896279 17:69214226-69214248 TTCAGTTCGGCCGGGCGCGGTGG + Intronic
1151204688 17:72497610-72497632 TCAAGCTAGGCCGGGCACGGTGG + Intergenic
1151300544 17:73221746-73221768 GCCAGGTGGGCCGGGCGCGGTGG + Intronic
1151464092 17:74273462-74273484 CCCAGCTTTGCCGGGCGCGGTGG + Intergenic
1151499712 17:74481034-74481056 TCCAGCTGGGCCGGGTGCGGTGG - Intronic
1151518921 17:74614767-74614789 TCCACATGGGCCGGGCGCGGTGG - Intronic
1151621549 17:75248497-75248519 ACCAGCTGGGCCGGGTGCAGTGG + Intronic
1151632394 17:75319725-75319747 CCCACCTGGGCTGGGCGCGGTGG - Exonic
1151673632 17:75587270-75587292 TCCAGGTTGGCCGGGCGCGGTGG - Intergenic
1151972861 17:77467736-77467758 TCCCTCTGTGCCGGCCGCGCTGG - Intronic
1151986631 17:77548073-77548095 TCCAGCTTGGCCGGGTGCGGTGG - Intergenic
1152373231 17:79903554-79903576 TCCATCAAGGCCGGGCGCGGTGG - Intergenic
1152557479 17:81060833-81060855 TCCAACAGGGCCGGGCGCGGTGG + Intronic
1152635008 17:81427280-81427302 CACAGCTGGGCCGGCCGGGCTGG + Intronic
1152678580 17:81654101-81654123 AGCAGCTGGGCCGGGTGCGGTGG - Intronic
1152724368 17:81937797-81937819 ACCATTTGGGCCGGGCGCGGTGG + Intronic
1153127900 18:1818105-1818127 AAAAGCTGGGCCGGGCGCGGTGG + Intergenic
1153225941 18:2899789-2899811 ACAAGCTGGGCCGCGCGCGGTGG - Intronic
1153354031 18:4115749-4115771 ACCAGATGGGCTGGGCGCGGTGG - Intronic
1153794282 18:8608945-8608967 TCCAGCTACACCGAGCGCGCGGG + Intergenic
1153873206 18:9340079-9340101 TAGGGCTGGGCCGGGCGCGGTGG + Intronic
1153916767 18:9752510-9752532 CCGAGCTGGGCCGGGCACGATGG - Intronic
1154034863 18:10790989-10791011 GCCAGTTGGGCCGGGCGCCGTGG - Intronic
1154203757 18:12319431-12319453 GTCAGCAGGGCCGGGCGCGGTGG - Intronic
1154271632 18:12925489-12925511 ACAGGCTGGGCCGGGCGCGGTGG + Intronic
1154381510 18:13854950-13854972 TGCAGAGGGGCCGGGCGCGGTGG - Intergenic
1155287772 18:24308844-24308866 CCCAGCGGGGCGGGGCGCACAGG - Intronic
1155322686 18:24634011-24634033 AGAAGCTGGGCCGGGCGCGGTGG - Intergenic
1155660995 18:28248231-28248253 TTCATCTTGGCCGGGCGCGGTGG - Intergenic
1155816260 18:30314956-30314978 TACAGCTTGGCCGGGCGCGGAGG - Intergenic
1155929971 18:31696977-31696999 GCCAGCTAGGCCAGGCGCGGTGG + Intergenic
1156431553 18:37080487-37080509 TCATGCTGGGCCGGGCGCGGTGG + Intronic
1156656805 18:39298165-39298187 TACAACTTGGCCGGGCGCGGTGG + Intergenic
1156845277 18:41658741-41658763 CCCAGCTCGGCCGGGCGCAGTGG + Intergenic
1157233833 18:45944465-45944487 CACAGATGGGCCGGGCGCGGTGG + Intronic
1157260264 18:46171029-46171051 CCAACCTGGGCCGGGCGCGGTGG - Intergenic
1157373102 18:47136352-47136374 TGCAGCTGTGCCAGGCGCACAGG - Exonic
1157693920 18:49705572-49705594 TTCAGATGGGCTGGGCGCGGTGG - Intergenic
1157815960 18:50729657-50729679 TCCACCGGGGCCGGGCGGCCGGG - Exonic
1157849154 18:51030778-51030800 ACGAGCCGGGCCGGGCGGGCCGG + Intronic
1157863472 18:51161639-51161661 TCCAATTGGGCCAGGCGCGGTGG - Intergenic
1158201963 18:54951193-54951215 GACATCTGGGCCGGGCGCGGTGG - Intronic
1158465025 18:57682289-57682311 TCCAGCAGGGCTGGGCGCGGTGG - Intronic
1159166339 18:64705864-64705886 ACCATCTAGGCCGGGCGCGGTGG + Intergenic
1159491788 18:69145933-69145955 TTGAGCTGGGCCGGGCGCAATGG + Intergenic
1159522913 18:69548804-69548826 TCTACCTTGGCCGGGCGCGGTGG + Intronic
1159618167 18:70606449-70606471 TCCAGAGCGGCCGGGCGCGGTGG + Intergenic
1159728436 18:71993458-71993480 GCCAGATGGGCCGGGCACGGTGG - Intergenic
1159872745 18:73776982-73777004 TCCAACACGGCCGGGCGCGGTGG + Intergenic
1160134486 18:76260952-76260974 TGAATCTGGGCCGGGCGCGGTGG - Intergenic
1160188697 18:76696735-76696757 TGCACCTGGGCCGGGCGCAGTGG - Intergenic
1160242383 18:77132875-77132897 TCCAGGTGGGGCGGGCCCGGCGG - Intronic
1160592469 18:79951928-79951950 TCCTGGAGGGCCGGGGGCGCGGG + Intergenic
1160680346 19:409227-409249 TCCCGCGGGGGCGGGGGCGCGGG - Intergenic
1160698547 19:495844-495866 TGCAGGCGGGCCGGGCGCGGTGG + Intronic
1160719668 19:591636-591658 GCTAGCGAGGCCGGGCGCGCGGG + Intronic
1160723270 19:606386-606408 TCCAACCAGGCCGGGCGCGGTGG - Intronic
1160755608 19:755403-755425 TCCAGCTGGGCAGGGCAGGGTGG + Intronic
1160758503 19:771050-771072 GCCCGCAGGGCCGGGCGCGGTGG + Intergenic
1160949846 19:1660666-1660688 TACAAATGGGCCGGGCGCGGTGG + Intergenic
1161072469 19:2269772-2269794 TCCAGAAGCGCCGGCCGCGCAGG + Intronic
1161111409 19:2472806-2472828 TCCAGCCGGGCCAGGCGTGGTGG - Intergenic
1161220885 19:3117667-3117689 CACAGCCGGGCCGGGCGCGGTGG - Intronic
1161458580 19:4382542-4382564 AGCACCTGGGCCGGGCGCGGTGG - Intronic
1161471423 19:4458577-4458599 TGCACCTGGGCCGGGCGCGGTGG + Intergenic
1161550430 19:4909604-4909626 CCCAGCCGGGCCACGCGCGCAGG + Exonic
1161595011 19:5146637-5146659 TTCAGGTGGGCTGGGCGCGGTGG + Intronic
1161642115 19:5430704-5430726 TCCATCCCGGCCGGGCGCGGTGG + Intergenic
1161722916 19:5913697-5913719 CCCAGGTGGGCTGGGCGCGGTGG - Intronic
1161746515 19:6063503-6063525 TCCAGCAGGGCCAGGCAGGCTGG + Intronic
1161870119 19:6863468-6863490 TTCCTCTGGGCCGGGCGCGGTGG - Intergenic
1161909370 19:7181231-7181253 GCCACCTGGGCCAGGCGCGGTGG - Intronic
1161960917 19:7522732-7522754 TCATGCTGGGGCGGGAGCGCGGG - Exonic
1162418786 19:10553981-10554003 GCCAGCTGGGCCGGCAGCGGAGG - Exonic
1162504449 19:11074870-11074892 TTCGGATGGGCCGGGCGCGGTGG + Intergenic
1162522684 19:11191324-11191346 GACAGCTGGGCCGGGCGCAGTGG - Intronic
1162891031 19:13733214-13733236 TCCAGCAAGGCCGGGCGTGGTGG - Intronic
1163025555 19:14509365-14509387 TCAAGCTGGGCCGGGCACAGTGG - Intergenic
1163273541 19:16268497-16268519 TCCAGCTCAGCCGGGCGTGGTGG - Intergenic
1163277203 19:16292558-16292580 GCCAGCTTGGCCAGGCGCGGTGG - Intergenic
1163558223 19:18004532-18004554 CCCACCTTGGCCGGGCGCGGTGG - Intronic
1163586566 19:18167564-18167586 TCCTGCTGGGCTGGGCGCAATGG + Intronic
1163590073 19:18188198-18188220 TCTACCTGGGCCGGGCACGGTGG + Intergenic
1163640582 19:18459811-18459833 TCCCCATGGGCCGGGCGCGGTGG - Intronic
1163809256 19:19420308-19420330 TCAAGATGGGCTGGGCGCGACGG - Intronic
1163875596 19:19865211-19865233 TCCAGCTAGGCTAGGCGCGGTGG + Intergenic
1164280202 19:23762386-23762408 TCCAAATGGGCAGGGCGCGGTGG + Intergenic
1164625444 19:29724496-29724518 CCCATCTGTGCCGGGCGCGGGGG + Intergenic
1164691400 19:30213356-30213378 TCAATCTCGGCCGGGCGCGGTGG - Intergenic
1165247709 19:34506932-34506954 TTCAGCCTGGCCGGGCGCGGTGG + Exonic
1165736151 19:38177072-38177094 TTTAGCTGGGCCGGGCGCGGTGG + Intronic
1165809524 19:38603694-38603716 CCAAGCTGGGCCGGGCGCGGTGG + Intronic
1165946198 19:39444120-39444142 CACACCTGGGCCGGGCGCGGTGG - Intronic
1165988460 19:39791357-39791379 TCTAGCTCGGCCGGGCGCCGTGG + Intergenic
1166720901 19:44995265-44995287 TCTAGCTGGGCCGGGCAGGGTGG - Intergenic
1166769433 19:45272042-45272064 TCCTGCTTGGCCGGGTGCGGTGG + Intronic
1167096027 19:47375536-47375558 TGCAGCAGCGCCGGGAGCGCCGG + Exonic
1167156340 19:47741519-47741541 TACAGCTGGGCAGGGAGGGCAGG - Exonic
1167947573 19:53001302-53001324 TACTACTGGGCCGGGCGCGGTGG + Intergenic
1168014750 19:53563371-53563393 TCCAGCTTGGCTGGGTGCGGTGG - Intronic
1168099364 19:54133136-54133158 CCCATCTCGGCCGGGCGCGGTGG - Intergenic
1168161349 19:54512354-54512376 TAAAGCTCGGCCGGGCGCGGTGG - Intergenic
1168219997 19:54953713-54953735 TCCAGCCAGGCCGGGCGCGGTGG + Intronic
1168240246 19:55085450-55085472 ACTAGCTAGGCCGGGCGCGGTGG - Intronic
1168394168 19:56034099-56034121 CCCTTCTGGGCCGGGCGCGGTGG + Intronic
1168584733 19:57583476-57583498 TCCAGGGGGGCCGGGCGAGCTGG - Intronic
1168599875 19:57708985-57709007 TAGAGCTGGGCCGGGAGCGACGG + Exonic
1168693103 19:58388914-58388936 TACATCTGGGCCGGGCGCGGTGG - Intronic
925155790 2:1648282-1648304 TCCAGCGGGGCCGGGACCACGGG - Exonic
925228334 2:2206263-2206285 TACAGCTTGGCCGGGCACGGTGG - Intronic
925595863 2:5555143-5555165 TCCTTCCGGGCCGGGCGCGGTGG - Intergenic
925619790 2:5781341-5781363 TGCATCTTGGCCGGGCGCGGTGG - Intergenic
926718116 2:15940675-15940697 TCCGGGTGGGCCGGGGGGGCGGG - Exonic
926842497 2:17097754-17097776 TCAAACTGGGCCGGGCGCGGTGG - Intergenic
927015143 2:18951541-18951563 TACATCTTGGCCGGGCGCGGCGG + Intergenic
927183636 2:20466910-20466932 GCCATGTGGGCCGGGCGCGGTGG + Intergenic
927691779 2:25213455-25213477 TGGAGCTGGGCTGGGCCCGCTGG - Intergenic
927823699 2:26292172-26292194 GGCAACTGGGCCGGGCGCGGTGG + Intergenic
927923956 2:26996513-26996535 TTCACCAGGGCCGGGCGCGGTGG + Intronic
927930295 2:27039543-27039565 TCCTGCTGGGCCAGGTGTGCAGG - Intronic
927962125 2:27247430-27247452 ACCAGCCTGGCCGGGCGCGGTGG - Intergenic
927991005 2:27446984-27447006 GCCAGGTTGGCCGGGCGCGGTGG - Intronic
928331432 2:30360756-30360778 TCCAGATGGGCCGGGCGCGGTGG - Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
929203513 2:39263564-39263586 TCTATATGGGCCGGGCGCGGTGG - Intronic
929226022 2:39512416-39512438 TCCAGCTTGGCCAGCCTCGCAGG - Intergenic
929242329 2:39665817-39665839 GCGAGCCGGGCCGGGCTCGCAGG + Intronic
929930420 2:46251360-46251382 CCAGGCTGGGCCGGGCGCGGTGG - Intergenic
930123635 2:47780035-47780057 TCCAGCTTGGCTGGGCGCAGTGG + Intronic
930823063 2:55667305-55667327 TACAGGTAGGCCGGGCGCGGTGG + Intronic
931300185 2:60972174-60972196 TTAATCTGGGCCAGGCGCGCTGG + Intronic
931506636 2:62935040-62935062 TCCATCTTGGCCGGGCACGGTGG + Intronic
931733665 2:65175714-65175736 TTCATCTGAGCCGGGCGCGGTGG - Intergenic
932578666 2:72978568-72978590 TTCATCTGGGCCGGGCGTGGTGG - Intronic
932711319 2:74066042-74066064 ACCAGGTGGGCCAGGCGCGGTGG - Intronic
932877667 2:75470658-75470680 TCAAACTGGGCCGGGCGTGGTGG - Intronic
933951831 2:87337756-87337778 TGTATCTGGGCCGGGCGCGGTGG + Intergenic
934134227 2:88979716-88979738 TGTATCTGGGCCGGGCGCGGTGG - Intergenic
934236075 2:90234070-90234092 TGTATCTGGGCCGGGCGCGGTGG + Intergenic
935088728 2:99873885-99873907 AGAAGCTGGGCCGGGCGCGGTGG + Intronic
935279870 2:101507762-101507784 GCCAGGTGGGCCGGGCACGGTGG - Intergenic
935301682 2:101698202-101698224 CCCAGGTCGGCCGGGCGCTCGGG + Intronic
935612215 2:105037677-105037699 TCCACCTGGGCAGGGCGGCCGGG - Intergenic
936031806 2:109078693-109078715 ACCATGTGGGCCGGGCGCGTTGG + Intergenic
936079185 2:109420730-109420752 TCCTGTTTGGCCGGGCGCGGTGG - Intronic
936341983 2:111641901-111641923 TAAATCTGGGCCGGGCGCGGTGG + Intergenic
936467345 2:112764949-112764971 TCCAGCTGGGGTTGGCGCGCCGG + Intergenic
937283180 2:120734647-120734669 CCCTGTTGGGCCGGGCGCGGTGG - Intergenic
937383780 2:121406928-121406950 GCCAGATGGGCTGGGCGCGGTGG + Intronic
937737732 2:125312658-125312680 TGCTCCTGGGCCGGGCGCGGTGG + Intergenic
938022511 2:127917695-127917717 TGAAGCTGGGCCGGGCACGGTGG - Intergenic
938393552 2:130924166-130924188 TGCAGCTAGGCCGGGAGCGGTGG - Intronic
939435547 2:142172678-142172700 GTCAGCTCGGCCGGGCGCGGTGG + Intergenic
939458536 2:142468852-142468874 TAGTGCTGGGCCGGGCGCGGTGG + Intergenic
939461756 2:142505424-142505446 TCAAGATGGGCCAGGCGCGTTGG + Intergenic
940671762 2:156678834-156678856 ACAAGGTGGGCCGGGCGCGGTGG + Intergenic
940957492 2:159744273-159744295 TCCTACTAGGCCGGGCGCGGTGG - Intronic
941176814 2:162207603-162207625 TACAGCTGGGCTGGGCGCGGTGG + Intronic
941176863 2:162207968-162207990 TACAGCTGGGCCAGGGGCGGTGG + Intronic
941408241 2:165119047-165119069 TCCAGGTGGGCCAGGCACGGTGG - Intronic
942049640 2:172127175-172127197 TCTGGATGGGCCGGGCGCGGTGG - Intergenic
942103762 2:172612945-172612967 ACTAGCTGGGCCGGGTGCGGTGG - Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
942402058 2:175613062-175613084 GCCTGCTGGGCCGGGCACGGTGG - Intergenic
942565238 2:177259643-177259665 TCCATCTAGGCCAGGCGCGGTGG + Intronic
942714445 2:178875275-178875297 TCCAGATTGGCCGGGCGCTGTGG + Intronic
943395056 2:187323425-187323447 TGTAGATGGGCCGGGCGCGGTGG - Intergenic
944173483 2:196803573-196803595 TCCAGCTGGGCTGGGCACAGTGG + Intergenic
944790478 2:203119711-203119733 TGCAACTGGGCCGGGCACGGTGG - Intronic
945061508 2:205913104-205913126 TCTATCTGGGCCAGGCGCGGTGG + Intergenic
945189729 2:207175071-207175093 TCCATTTGGGCCGGCCGCGGTGG + Intergenic
945284728 2:208070830-208070852 TCCAGCTAGGCCGCGCGCAGTGG + Intergenic
945550058 2:211210179-211210201 TGCATCTGGGCCGGGCGCGGTGG - Intergenic
945833120 2:214809697-214809719 GCCAGAGGGGCGGGGCGCGCGGG + Exonic
946235399 2:218321909-218321931 TCAAGCTCGGCCGGGAGCGGTGG - Intronic
946235445 2:218322207-218322229 TCAAGCTCGGCCAGGCGCGGTGG - Intronic
946251681 2:218417946-218417968 TCCAGGTGGGCCGGGTGCAGTGG + Intergenic
946745164 2:222838354-222838376 TCCATCTCGGCCGGGCGCGGTGG + Intergenic
947182223 2:227421410-227421432 TCAATCTGGGCTGGGCGCGGTGG + Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
947589557 2:231377714-231377736 CCAAACTGGGCCGGGCGCGGTGG - Intergenic
947623366 2:231604697-231604719 GCCTGCTGGGCCGGGCCTGCTGG - Intergenic
947623372 2:231604711-231604733 GCCTGCTGGGCCGGGCCTGCTGG - Intergenic
947623378 2:231604725-231604747 GCCTGCTGGGCCGGGCCTGCTGG - Intergenic
947754318 2:232550790-232550812 CCCAGCGGGGGCGGGCGCGGGGG - Intronic
947964266 2:234266260-234266282 TAGATCTGGGCCGGGCGCGGTGG + Intergenic
948286726 2:236792023-236792045 TCAAGCTGGGCCGGGCGTGGTGG + Intergenic
948556100 2:238812455-238812477 TGAAGCTAGGCCGGGCGCGGTGG - Intergenic
948767553 2:240231143-240231165 ACAGGCTGGGCCGGGCGCGGTGG + Intergenic
1169095236 20:2892000-2892022 GTCAACTGGGCCGGGCGCGGTGG + Intronic
1169204559 20:3732574-3732596 CACATCTGGGCCGGGAGCGCGGG + Intergenic
1169207074 20:3746587-3746609 TCCATCTTGGCCGGGCGCGGTGG - Intronic
1169233845 20:3912662-3912684 TACAGGCGGGCCGGGCGCGGTGG + Intronic
1169381582 20:5112129-5112151 AACAGTTAGGCCGGGCGCGCTGG - Intronic
1169438154 20:5611293-5611315 CCCACGTGGGCCGGGCGCGGTGG + Intergenic
1169615408 20:7437948-7437970 GCCAACTAGGCCGGGCGCGGTGG - Intergenic
1170453484 20:16510362-16510384 TACAGATGGGCCGGGCGTGGTGG + Intronic
1170674758 20:18468360-18468382 TAAAACTGGGCCGGGCGCGGTGG - Intronic
1171367428 20:24635160-24635182 TCCTGCTGGGCCGTGGGCCCAGG + Intronic
1171942347 20:31343408-31343430 CACAACTGGGCCGGGCGCGGTGG + Intergenic
1171977614 20:31605514-31605536 TCGCGCTGCGCCGGGGGCGCCGG + Exonic
1172305339 20:33876519-33876541 CCCAACTCGGCCGGGCGCGGTGG - Intergenic
1172350259 20:34233432-34233454 TCCATGTGGGCCGGGCGCGGTGG - Intronic
1172403945 20:34673765-34673787 TACAGCTTGGCCGGGCGTGGTGG + Intronic
1172409342 20:34710113-34710135 TCCAGCAGCGCCGCCCGCGCTGG - Exonic
1172652421 20:36513259-36513281 TTAATCTGGGCCGGGCGCGGTGG + Intronic
1172717008 20:36972052-36972074 TCCCTCTGGGCTGGGCGCGGTGG + Intergenic
1172771259 20:37384021-37384043 GGCAGCAGGGCCGGGCGCGGTGG - Intronic
1173638326 20:44580633-44580655 ACCAGCCTGGCCGGGCGCGGTGG - Intronic
1173922023 20:46753417-46753439 CCAAGCTTGGCCGGGCGCGGTGG + Intergenic
1174419257 20:50389060-50389082 TCCACCTGGGCCGGGCGCGGTGG + Intergenic
1174510529 20:51048101-51048123 TACAGGTGGGCCGGGCGCAGTGG - Intergenic
1174636734 20:52007539-52007561 TCAGGCTGGGCCGGGCACGGTGG + Intergenic
1175137406 20:56834694-56834716 TCCAGCTGGGCCTGTTGCGGGGG + Intergenic
1175142395 20:56870681-56870703 ACCTGCAGGGCCGGGCGCGGTGG + Intergenic
1175253026 20:57621162-57621184 ACCAGCGGGGCCGGGCGTGGGGG - Intergenic
1175269610 20:57724567-57724589 TGGTGCTGGGCCAGGCGCGCTGG - Intergenic
1175335161 20:58191153-58191175 TCCATCCTGGCCGGGCGCGGTGG + Intergenic
1175567142 20:59989239-59989261 ACCAGCTCGGCCGGGCGCGGTGG + Intronic
1175992359 20:62796052-62796074 TACAGATGGGCCGGGCGCGGTGG - Intergenic
1176164773 20:63667124-63667146 CAGAGCTGGGCCGGGCGCGGTGG - Intronic
1176263798 20:64197996-64198018 TTCTGCTGGGCCGGGCGCGGTGG + Intronic
1176413740 21:6463029-6463051 GCAGGCTGGGCCGGGCGCGGTGG + Intergenic
1176418178 21:6491885-6491907 TAGAGCTGGGCCGGGCGCGGTGG - Intergenic
1176613016 21:9003196-9003218 TGCAGGTAGGCCGGGCGCGGTGG - Intergenic
1177379210 21:20316428-20316450 TCCTTGTGGGCCGGGCGCGGTGG - Intergenic
1178083897 21:29093776-29093798 TCCTTCTCGGCCGGGCGCGGTGG - Intronic
1178220741 21:30656329-30656351 TACAACTTGGCCGGGCGCGGTGG + Intergenic
1178937032 21:36872133-36872155 TTCAGCTGGGCTGGGCGCGGTGG + Intronic
1178947923 21:36963472-36963494 TCCACTTAGGCCGGGCGCGGTGG + Intronic
1179206596 21:39286303-39286325 TTCATATGGGCCGGGCGCGGTGG - Intronic
1179216677 21:39373164-39373186 CCCACCTTGGCCGGGCGCGGCGG - Intergenic
1179351705 21:40617409-40617431 TCATTCTGGGCCGGGCGCGGTGG - Intronic
1179456093 21:41501319-41501341 TCCAGCTGGGCCGGGCACGGCGG + Intronic
1179474201 21:41632947-41632969 TCCAGCTGGGCCTGGTGCCCAGG - Intergenic
1179569552 21:42269976-42269998 TGCCCCTGGGCCGGGCGCGGTGG + Intronic
1179689238 21:43071351-43071373 GCAGGCTGGGCCGGGCGCGGTGG + Intronic
1179693671 21:43100207-43100229 TAGAGCTGGGCCGGGCGCGGTGG - Intronic
1179805542 21:43834890-43834912 CCCAGCTGGGCAGAGAGCGCTGG + Intergenic
1180151291 21:45949618-45949640 AGCATCTGGGCCGGGCGCGGTGG + Intergenic
1180650212 22:17370302-17370324 TCCGGCGGGGCCGGGCGCGGGGG + Intronic
1180733192 22:17997349-17997371 ACCAGATGGGCCGGGCGCAGTGG - Intronic
1180785581 22:18545697-18545719 TCTTTCTGGGCCGGGCGCGGTGG + Intergenic
1181242487 22:21485049-21485071 TCTTTCTGGGCCGGGCGCGGTGG + Intergenic
1181542665 22:23581889-23581911 TCAAGATGGGCCAGGCGCGGTGG - Intergenic
1181571321 22:23769140-23769162 TCAAGCTCAGCCGGGCGCGATGG - Intronic
1181667348 22:24407333-24407355 TCCAGGTGGGGCGGGGGTGCTGG + Intronic
1181753114 22:25003697-25003719 TCCAAGTGGGCCGGGCGCAGTGG - Intronic
1181923909 22:26342400-26342422 TCCATCTCGGCCGGGCGCAGTGG + Intronic
1181959363 22:26611759-26611781 TCTAGCCCGGCCGGGCGCGGTGG - Intronic
1181969726 22:26681079-26681101 CACAGTTGGGCCGGGCGCGATGG - Intergenic
1182221046 22:28759036-28759058 TCCAACAAGGCCGGGCGCGGTGG + Intergenic
1182635337 22:31722140-31722162 TAAATCTGGGCCGGGCGCGGTGG + Intronic
1182642670 22:31780928-31780950 ATCATCTGGGCCGGGCGCGGTGG + Intronic
1182808615 22:33096850-33096872 TCCAGATCCGCCGGGCGCGGTGG - Intergenic
1182923659 22:34103008-34103030 TCCCTCAGGGCCGGGCGCGGTGG + Intergenic
1183037884 22:35153800-35153822 TCACTCTGGGCCGGGCGCGGTGG + Intergenic
1183292961 22:37014074-37014096 GCCAGTTTGGCCGGGCGCGGTGG + Intronic
1183441717 22:37826821-37826843 TACCTCTGGGCCGGGCGCGGTGG - Intergenic
1183473125 22:38020059-38020081 TCCAGGTGGGCCGGCCGTGGTGG + Intronic
1183577456 22:38700934-38700956 GCCAACTGGGCCGTGCGGGCGGG + Intronic
1183590635 22:38777445-38777467 TCCAGCTGGTCCTGGCCCTCTGG - Intronic
1183948848 22:41341454-41341476 AGCATCTGGGCCGGGCGCGGTGG + Intronic
1183980360 22:41536103-41536125 TGGAGGTGGGCCGGGCGCGGTGG + Intronic
1184117238 22:42429326-42429348 TCAAACTGGGCCGGGTGCGGTGG + Intronic
1184132680 22:42526863-42526885 CTCTGCTGGGCCGGGCGCGGTGG - Intergenic
1184168492 22:42744528-42744550 TCCAGTTTGGCCGGGCGCGGTGG + Intergenic
1184200743 22:42967599-42967621 TGCAAATGGGCCGGGCGCGGTGG + Intronic
1184220359 22:43096028-43096050 CCCAGCCGGGCCGGGTGCGGTGG + Intergenic
1184509145 22:44921944-44921966 TCCATCAGGACCGGGCGCGGTGG - Intronic
1184568880 22:45309901-45309923 CGCGGCTGGGGCGGGCGCGCGGG + Intronic
1184589776 22:45474308-45474330 GCCTGCTGGGCCGGGCGAGGTGG + Intergenic
1184616802 22:45643967-45643989 TACAGATCGGCCGGGCGCGGTGG + Intergenic
1184655740 22:45941220-45941242 TGCAGAAGGGCCGGGCGCGGTGG + Intronic
1185243736 22:49761667-49761689 ATCACCTGGGCCGGGCGCGGTGG + Intergenic
1185341574 22:50293506-50293528 GCGAGCTGGGCCGGGTGAGCGGG - Intronic
949331999 3:2933107-2933129 ACCATCTGGGCCGGGCGCGGTGG - Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
949913024 3:8929932-8929954 TCCAGCTGTGCCGGGCGCAGTGG - Intronic
950000964 3:9655915-9655937 CCCATCTTGGCCGGGCGTGCTGG + Intronic
950251753 3:11471259-11471281 TCAAGCTGGCCCTGGCGCTCTGG + Intronic
950272396 3:11628531-11628553 TCAATCTCGGCCGGGCGCGGTGG + Intronic
950275829 3:11659873-11659895 CCCATCTTGGCCGGGCGCGGTGG + Intronic
950276520 3:11665961-11665983 TCATTCTGGGCCGGGCGCGGTGG + Intronic
950342687 3:12261427-12261449 CCCAGCTCGGCCGGGCACGGTGG + Intergenic
950347137 3:12306807-12306829 AACCGCTGGGCCGGGCGCGGTGG + Intronic
950446633 3:13042496-13042518 ACAAGCTGCGCCGGGCGGGCTGG - Intronic
950638061 3:14330102-14330124 TCCATCTGGGCTGGGCGTGGTGG - Intergenic
951065244 3:18256718-18256740 GCCATCTGGGCCAGGCGCGGTGG - Intronic
951417947 3:22448045-22448067 TGCCGGTGGGCCGGGCGCGGTGG - Intergenic
951844382 3:27069908-27069930 GTAAGCTGGGCCGGGCACGCTGG + Intergenic
952334147 3:32390833-32390855 ATTAGCTGGGCCGGGCGCGGTGG - Intergenic
952770475 3:36995231-36995253 TCCACTTGAGCCGGGCGCGGTGG - Intronic
952949216 3:38505665-38505687 TCCAACTGGGCCGGGTGCAGTGG + Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953313664 3:41905928-41905950 GCCAGGTGGGCCGGGCACGGTGG + Intronic
953341942 3:42141846-42141868 ACCAGCAGGGCCGGGCACGGTGG + Intronic
953692860 3:45134409-45134431 TAGATCTGGGCCGGGCGCGGTGG - Intronic
953810058 3:46104633-46104655 TCAAGCTGGGGCGGGGGGGCAGG - Intergenic
953866672 3:46589529-46589551 TCGAACTGGGCCGGGCGCAGTGG + Intronic
954004662 3:47581122-47581144 TCAAGTTGGGCCGGGCACGGTGG - Intergenic
954071913 3:48149247-48149269 TCCAACTGGGCCAGGCACGGTGG - Intergenic
954200587 3:49021214-49021236 ACCCGCGGGGCCGGGCGAGCGGG - Exonic
954275985 3:49541976-49541998 TCGGGCTGGGCCGAGCGCGGTGG - Intergenic
955033171 3:55240681-55240703 TCCGACTCGGCCGGGCGCGGTGG + Intergenic
955273840 3:57528436-57528458 TTCTGCTGGGCCAGGCGCGGTGG + Intronic
955321946 3:57980883-57980905 CACAGCTAGGCCGGGCGCACTGG + Intergenic
955520068 3:59767209-59767231 GAGAGCTGGGCCGGGCGCGGTGG + Intronic
955685389 3:61544067-61544089 ACCAGTTGGGCCGGGCGCGGTGG + Intergenic
956204690 3:66743039-66743061 TTCATCTTGGCCGGGCACGCTGG + Intergenic
956432242 3:69198981-69199003 TTCACCTCGGCCGGGCGCGGTGG + Intronic
956435560 3:69231573-69231595 TGCAGCTGGGCCGGGCACAGTGG - Intronic
956547985 3:70427450-70427472 TCCAAAAGGGCCGGGCGCGGTGG + Intergenic
956728470 3:72176236-72176258 GACAGATGGGCCGGGCGCGGTGG - Intergenic
957328426 3:78727337-78727359 TACATCTCGGCCGGGCGCGGTGG + Intronic
958033942 3:88148926-88148948 TATAGCTTGGCCGGGCGCGGTGG - Intronic
958535455 3:95397665-95397687 TCAGGTTGGGCCGGGCGCGGTGG - Intergenic
958820997 3:98973546-98973568 TCAACCTAGGCCGGGCGCGGTGG - Intergenic
959000547 3:100959201-100959223 TAAGGCTGGGCCGGGCGCGGTGG + Intronic
959446397 3:106445424-106445446 AGCAGCTGGGCCAGGCGCGGTGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960953821 3:123017173-123017195 TGCATCTGGGCCAGGCGCGGGGG - Intronic
961391417 3:126554549-126554571 TACAGCCGGGCCAGGCGCGGTGG - Intronic
961490668 3:127254980-127255002 TCCAGCTGGGCCTGTGGTGCTGG - Intergenic
961690488 3:128665998-128666020 TCACTCTGGGCCGGGCGCGGTGG - Intronic
961728961 3:128953226-128953248 CCAATCTGGGCCGGGCGCGGTGG + Intronic
962419475 3:135215448-135215470 TACATCTGGGCCGGGCGTGGTGG - Intronic
963016932 3:140833247-140833269 TACAGATGGGCCGGGTGCGGTGG + Intergenic
963040452 3:141066195-141066217 TCCAGCCGCGCCGGCCGCCCGGG - Exonic
963099774 3:141589124-141589146 GCTATCTGGGCCGGGCGCGCTGG - Intronic
963348167 3:144121134-144121156 TGCAGCTCGGCCGGGCGCGGTGG - Intergenic
963806549 3:149728620-149728642 TTCTCCTGGGCCGGGCGCGGTGG + Intronic
963866584 3:150368445-150368467 TCCATCCCGGCCGGGCGCGGTGG + Intergenic
964109888 3:153077207-153077229 TGCAACTGGGCCGGGCACGGTGG + Intergenic
964112377 3:153101108-153101130 TTCAGTTAGGCCGGGCGCGGTGG - Intergenic
964424740 3:156540316-156540338 TCAATCTAGGCCGGGCGCGGTGG + Exonic
965403892 3:168248068-168248090 CCCAAATGGGCCGGGCGCGGTGG + Intergenic
965409622 3:168313644-168313666 TTCATCTCGGCCGGGCGCGGTGG - Intergenic
965410277 3:168321349-168321371 TCAACCTGGGCCGGGCACGGTGG - Intergenic
965653609 3:170960391-170960413 GCCTGCTTGGCCGGGCGCGGTGG + Intergenic
965874985 3:173305774-173305796 TGAAGGTGGGCCGGGCGCGGTGG - Intergenic
966401577 3:179552775-179552797 TTAGGCTGGGCCGGGCGCGGTGG - Intergenic
966554522 3:181244107-181244129 TGCAGCTTGGCCGGGCGCGGTGG + Intergenic
966864149 3:184247583-184247605 TCCAGCTAGGCTGGGCGCAGCGG - Intronic
967509802 3:190296835-190296857 TAAATCTGGGCCGGGCGCGGTGG - Intergenic
967847569 3:194056464-194056486 TGCATCTAGGCCGGGCGCGGTGG - Intergenic
967949455 3:194829603-194829625 TGCTGCGGGGCCGGGCGCGGTGG + Intergenic
968259509 3:197308458-197308480 TGAAGCTGGGCCGGGCGTGGTGG - Intergenic
968270379 3:197398994-197399016 CCCACCTGGGCCAGGCGCGGTGG + Intergenic
968418992 4:466929-466951 TGCGGCTTGGCCGGGCGCGGTGG + Intronic
968511353 4:997291-997313 GCCCGCTGGGCTGGGGGCGCGGG - Intronic
968651362 4:1761480-1761502 GCCGGCTGGGTGGGGCGCGCGGG - Intergenic
968682901 4:1933679-1933701 TCTTGCAGGGCCGGGCGCGGTGG - Intronic
968690128 4:1986052-1986074 CCCAACTGGGCAGGGCCCGCAGG + Intronic
968720882 4:2203292-2203314 TCAAACTGGGCCGGGCGCGGTGG + Intronic
969559853 4:7939907-7939929 CCCAGCGGAGCCGGGCGCCCAGG + Exonic
969582753 4:8075069-8075091 TCAGGCTGGGCCGGGAGCGGTGG - Intronic
969850862 4:9955203-9955225 TCCAAGTCGGCCGGGCGCGGTGG + Intronic
971083585 4:23244260-23244282 TACAGCTGGGCCGGGCACAGTGG + Intergenic
972148028 4:36053289-36053311 GCATGCTGGGCCGGGCGCGGTGG - Intronic
972454800 4:39242953-39242975 TAGAGATGGGCCGGGCGCGGTGG - Intronic
972505464 4:39716534-39716556 TCCATCTGGGCTGGGCGCAGCGG - Intronic
972545059 4:40072529-40072551 GCCAGGTGGGCCGAGCGCGGTGG - Intronic
972691196 4:41399967-41399989 TCCACCTCGGCCGGGCACGGTGG - Intronic
973127874 4:46611035-46611057 TACATCTCGGCCGGGCGCGGTGG + Intergenic
974045868 4:56898024-56898046 ACCTGCTGGGCCGGGCGCGGTGG + Intergenic
975117218 4:70693482-70693504 TCACACTGGGCCGGGCGCGGTGG + Intergenic
975167480 4:71193444-71193466 CCCACATGGGCCGGGCGCGGTGG - Intronic
975689423 4:76949640-76949662 ACCACCGCGGCCGGGCGCGCAGG + Intergenic
976469609 4:85412901-85412923 TCCAGGTAGGTCGGGCGCGGTGG - Intergenic
978319398 4:107477560-107477582 TCAAGCTCGGCCGGGCGCGGTGG + Intergenic
978514982 4:109560183-109560205 TCCAGCTTGGGCGGGCTCACGGG - Exonic
978801333 4:112758185-112758207 TCCATCTTGGCCGGACGCGGTGG - Intergenic
979361410 4:119769999-119770021 TGTATCTGGGCCGGGCGCGGTGG + Intergenic
979393743 4:120160693-120160715 TAGAGCTGGGCCGGGTGCGGTGG + Intergenic
979587435 4:122437660-122437682 TTCATCTGGGCTGGGCGCGGTGG + Intergenic
979861350 4:125697476-125697498 CAAAGCTGGGCCGGGCGCGGTGG + Intergenic
980130459 4:128811950-128811972 TCGGGCTGGGGCGGGCGCGCCGG - Intronic
980393178 4:132171995-132172017 TTCATCTCGGCCGGGCGCGGTGG + Intergenic
980677456 4:136105734-136105756 TCTAGAGGGGCCGGGCGCGATGG - Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
981504222 4:145482158-145482180 TCGTGCTGGGCTGGGGGCGCGGG + Intronic
982437951 4:155399426-155399448 TCCACCTGGGCTGGGCACGGTGG + Intergenic
982718164 4:158830547-158830569 TAAATCTGGGCCGGGCGCGGTGG - Intronic
982949107 4:161665518-161665540 TCTCTCTGGGCCGGGCGCGGTGG - Intronic
983295230 4:165858816-165858838 TTCATGTGGGCCGGGCGCGGTGG + Intergenic
983499220 4:168480272-168480294 TCCAGATGGACCGGGCGGGGAGG - Intronic
984722474 4:182988057-182988079 ATAAGCTGGGCCGGGCGCGGTGG + Intergenic
984891147 4:184494554-184494576 ACCATCTGGGCCAGGCGCGGTGG + Intergenic
985626805 5:993188-993210 CCCAGGTCGGCCGGGCGCGGTGG + Intergenic
986330234 5:6712528-6712550 TCCAGCTGCACCGAGCGGGCAGG - Intergenic
986350742 5:6877575-6877597 TACTGCTGGGCTGGGCGCGGTGG + Intergenic
986498593 5:8373653-8373675 TCAATGTGGGCCGGGCGCGGTGG + Intergenic
986704404 5:10443333-10443355 TACATTTGGGCCGGGCGCGGTGG + Intronic
986881058 5:12171837-12171859 TCTAGTTGGGCTGGGCGCGGTGG - Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
987386202 5:17332005-17332027 TGTAGGTGGGCCGGGCGCGGTGG + Intergenic
987891333 5:23882007-23882029 ATCAGCTCGGCCGGGCGCGGTGG - Intergenic
988722475 5:33892241-33892263 GCCAGCTGGGCCTGGCGTTCGGG - Intergenic
988852230 5:35191355-35191377 CACATCTGGGCCGGGCGCGGTGG - Intronic
988905506 5:35784413-35784435 TCCATCTCGCCCGGGCGCGGTGG - Intronic
989201664 5:38770144-38770166 GCCAACTGGGCCGGGTGCGGTGG + Intergenic
989330932 5:40257556-40257578 TTCAACTCGGCCGGGCGCGGTGG - Intergenic
989641508 5:43587791-43587813 TCCCACTTGGCCGGGCGCGGTGG + Intergenic
990311296 5:54541313-54541335 ACCAGGAGGGCCGGGCGCGGTGG - Intronic
990383464 5:55236808-55236830 TCCAGTGTGGCCGGGCGCGGTGG - Intergenic
990911706 5:60858885-60858907 TCCACCTGGGCCGGGCATGGTGG - Intergenic
991059995 5:62364431-62364453 ACCCTCTGGGCCGGGCGCGGTGG - Intronic
991764605 5:69961193-69961215 TGTAGCTGGGCCGGGCACCCTGG - Intergenic
991782719 5:70156960-70156982 TGTAGCTGGGCCGGGCACCCTGG + Intergenic
991843837 5:70836274-70836296 TGTAGCTGGGCCGGGCACCCTGG - Intergenic
991875162 5:71157278-71157300 TGTAGCTGGGCCGGGCACCCTGG + Intergenic
992481190 5:77153860-77153882 TACAGCTGGGCCGGGCATGGTGG - Intergenic
992916182 5:81455330-81455352 TCCTTCTAGGCCGGGCGCGGTGG + Intronic
993106950 5:83610546-83610568 TCCAGTCAGGCCGGGCGCGGTGG - Intergenic
993183267 5:84583321-84583343 TACACGTGGGCCGGGCGCGGTGG + Intergenic
993667784 5:90722421-90722443 CTCTGCTGGGCCGGGCGCGGTGG + Intronic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
994067413 5:95558851-95558873 ACCAGTTTGGCCGGGCGCGGTGG + Intronic
994628841 5:102255916-102255938 TGGAGCTTGGCCGGGCGCGGTGG + Intronic
995106374 5:108381467-108381489 GCCGGCGGGGGCGGGCGCGCCGG + Exonic
995358545 5:111267427-111267449 TCATTCTGGGCCGGGCGCGGTGG + Intronic
995873200 5:116763883-116763905 TAAAACTGGGCCGGGCGCGGTGG - Intergenic
996019619 5:118577141-118577163 TTCAGCTGGGCCGGGCGCAGTGG - Intergenic
996073727 5:119163860-119163882 TACAATTAGGCCGGGCGCGCTGG - Intronic
996666347 5:126064594-126064616 TGAAGCTCGGCCGGGCGCGGTGG - Intergenic
996717935 5:126602232-126602254 GGAAGCTGGGCCGGGCGCGGTGG - Intronic
996733380 5:126737126-126737148 ACCATCTCGGCCGGGCGCGGTGG + Intergenic
996761032 5:126985760-126985782 TCCAGGTAGGCCGGGCGCAGTGG - Intronic
996778639 5:127159890-127159912 CCATGCTGGGCCGGGCGCGGTGG + Intergenic
996919004 5:128745451-128745473 TCCTGAGGGGCCGGGCGCGGTGG - Intronic
997048206 5:130345591-130345613 ACAAGCTGGGCCGGGCGTGGTGG - Intergenic
997282147 5:132656135-132656157 TGCCGCTCGGCCGGGCCCGCGGG + Intergenic
997304995 5:132830381-132830403 TGCAGCTGGGAGAGGCGCGCTGG + Intronic
997339531 5:133132000-133132022 TCCAGCAGGGCCGGGCACAGTGG + Intergenic
997454079 5:134004795-134004817 GCGCGCCGGGCCGGGCGCGCAGG - Intronic
997552978 5:134769832-134769854 CCCAACTCGGCCGGGCGCGGTGG - Intronic
997673409 5:135694872-135694894 TCCATCTGGGCTGGGCACGGTGG - Intergenic
998176810 5:139906291-139906313 TCAGTCTGGGCCGGGCGCGGTGG - Intronic
998344378 5:141448651-141448673 TCCATATTGGCCGGGCGCGGTGG + Intronic
998457800 5:142287252-142287274 AGCAGGTGGGCCGGGCGCGGTGG - Intergenic
998463393 5:142325319-142325341 TGCAGCTGGGCCAGCTGCGCGGG + Intronic
999288689 5:150409237-150409259 GCAAGCTAGGCCGGGCGCGGTGG + Intronic
999299874 5:150484830-150484852 TCCAACTGGGCCGGGCGCGGTGG - Intergenic
999682833 5:154075848-154075870 TAAAGCTGGGCTGGGCGCGGTGG - Intronic
1000099188 5:157998563-157998585 CCCAGCTGGGCCGGGTGTGGTGG + Intergenic
1000267118 5:159648215-159648237 CCCTGCTGGGCTGGGCGCGGTGG + Intergenic
1000544859 5:162586673-162586695 GTCAGCTCGGCCGGGCGCGATGG + Intergenic
1001119446 5:168967725-168967747 TTGAGATGGGCCGGGCGCGGTGG - Intronic
1001279686 5:170377857-170377879 CCCCTCTGGGCCGGGCGCGGTGG - Exonic
1001437081 5:171707757-171707779 TCCAGCAGGGCCTGGCACACAGG + Intergenic
1001651301 5:173318067-173318089 TCCACCTGGGGCTGGCGCTCGGG + Exonic
1001705161 5:173736302-173736324 AACAGCTGGGCTGGGCGCGGTGG - Intergenic
1002183415 5:177442943-177442965 TCCAGCTGGGCCAGGGGAGCAGG - Intergenic
1002350158 5:178577535-178577557 TTCAGCAGGGCCTGGCGCGCGGG + Intronic
1002402610 5:178999640-178999662 TGCAAGTGGGCCGGGCGCGGTGG + Intergenic
1002584365 5:180232748-180232770 CACAACTGGGCCGGGCGCGGCGG + Intergenic
1002620112 5:180482141-180482163 TCAAGCGCGGCCGGGCGCGGTGG - Intergenic
1002649065 5:180678492-180678514 TGGAGTTGGGCCGGGCGCGGTGG + Intergenic
1002822261 6:736625-736647 CACAGCTGGGCCGGGCGCGGTGG - Intergenic
1004083024 6:12414562-12414584 TACAGTTGGGCCGGGCACGATGG + Intergenic
1004225623 6:13781927-13781949 TCCACATAGGCCGGGCGCGGAGG - Intergenic
1004308677 6:14524033-14524055 TTGAACTGGGCCGGGCGCGGTGG - Intergenic
1005044269 6:21627278-21627300 TCTATCAGGGCCGGGCGCGGTGG + Intergenic
1005381954 6:25244421-25244443 AGCAGCTGGGCTGGGCGCGGTGG - Intergenic
1005796176 6:29364509-29364531 CAAAGCTGGGCCGGGCGCGGTGG + Intronic
1005834038 6:29694171-29694193 ACCACCTGGGCTGGGCGCGGTGG - Intergenic
1005882439 6:30071542-30071564 CCCAGCTGTGCTGGGTGCGCAGG - Exonic
1006102575 6:31694676-31694698 CACAGCTAGGCCGGGCGCGGTGG - Intronic
1006382919 6:33711299-33711321 TCCAGATGGGCCGGGTGCGGCGG - Intronic
1006488929 6:34368923-34368945 TACTGTTGGGCCGGGCGCGGTGG - Intronic
1006563675 6:34935773-34935795 TCCTGGTGGGCCGGGCGCGGTGG + Intronic
1006634557 6:35452591-35452613 TCCAGCTGCGCCCAGGGCGCCGG - Exonic
1006908256 6:37547278-37547300 CACAGCTGGGCCGGGCGCGGGGG + Intergenic
1006914167 6:37584006-37584028 TACAGGTGGGCCGGGCACGGTGG + Intergenic
1006929810 6:37680918-37680940 TCCAGCTGAGCAGGGCCTGCTGG + Intronic
1007127914 6:39442824-39442846 TCCAGATCGGCTGGGCGCGATGG + Intronic
1007296683 6:40827757-40827779 TCCATCTTGGCCGGGTGCGGTGG - Intergenic
1007456973 6:41985914-41985936 TTAAACTGGGCCGGGCGCGGTGG - Intronic
1007759833 6:44127425-44127447 CCGGGCTGGGCCTGGCGCGCAGG - Exonic
1007904481 6:45445309-45445331 TCTTCCTGGGCCGGGCGCGGTGG - Intronic
1007967883 6:46019397-46019419 GAAAGCTGGGCCGGGCGCGGTGG + Intronic
1008092798 6:47309539-47309561 TCCAGCTGCCCCGCGCGCCCCGG - Exonic
1008226094 6:48918834-48918856 TCCACATTGGCCGGGCGCGGTGG - Intergenic
1008902198 6:56633511-56633533 TCCGTCTCGGCCGGGCGCGGTGG - Intronic
1009413536 6:63393171-63393193 TCCATCTTGGCTGGGCGCGGTGG - Intergenic
1010532192 6:76982007-76982029 TCTATTTGGGCCGGGCGCGGTGG - Intergenic
1010534916 6:77014317-77014339 TGCAATTGGGCCGGGCGCGCAGG - Intergenic
1010882636 6:81198573-81198595 AGCATCTGGGCCGGGCGCGGTGG - Intergenic
1011444360 6:87422159-87422181 TCTAGATGGGCCGGGCGTGGTGG + Intronic
1011444554 6:87423534-87423556 TAAGGCTGGGCCGGGCGCGGTGG - Intronic
1011980122 6:93364234-93364256 TCCATCAGGGCCGGGCACGGTGG + Intronic
1012409059 6:98935500-98935522 GCCATCTGGGCCGGGCGCGGTGG + Intronic
1012770013 6:103420862-103420884 ACAAGCTCGGCCGGGCGCGGTGG + Intergenic
1012838018 6:104294649-104294671 TCCAGATAGGCCGGGCGCGGTGG - Intergenic
1013105817 6:107025951-107025973 TCCTCCTGGGCTGGGCGCGGTGG - Intergenic
1013130370 6:107226956-107226978 TTTGGCTGGGCCGGGCGCGGTGG - Intronic
1013182079 6:107726244-107726266 TCTAGCTGGGCTGGGCGCGGTGG + Intronic
1013361954 6:109402008-109402030 TGAATCTGGGCCGGGCGCGGTGG - Intronic
1013513070 6:110861069-110861091 GCCAGATGGGCTGGGCACGCTGG + Intronic
1013974182 6:116058621-116058643 TCCATTTTGGCCGGGCGCGGTGG + Intronic
1013981721 6:116137792-116137814 CCCAGCTTGGCCGGACGCACTGG + Intronic
1014582753 6:123159000-123159022 GCCATCTGGGCCGGGCACGGTGG - Intergenic
1014761663 6:125363624-125363646 GGCAGCTGGACCGGGCGCGCCGG - Intergenic
1015928480 6:138333727-138333749 TGAAGCTGGGCCGAGCGCGGTGG - Intronic
1016022684 6:139252702-139252724 TCCTGTTGGGCCGGGCGCAGTGG + Intronic
1016033082 6:139357731-139357753 TCAAACTGGGCCGGGCACGGTGG - Intergenic
1016036756 6:139391145-139391167 TCATACTGGGCCGGGCGCGGTGG + Intergenic
1017406571 6:154126087-154126109 TCTAGCCGGGCCGGGCGCGGTGG - Intronic
1017768568 6:157626884-157626906 TCCAGCTGGGGGGGGGGCGGCGG + Intronic
1018682072 6:166272442-166272464 TCAATCTGGGCCGGGCGCAGTGG + Intergenic
1019164503 6:170088938-170088960 ACCAGCTGGGCTGGGTGCGGTGG + Intergenic
1019169378 6:170123448-170123470 TCCATCTCGGCCGGGCACGGTGG + Intergenic
1019373027 7:673360-673382 TTCAGCTCAGCCGGGCGCGGTGG + Intronic
1019437211 7:1028376-1028398 TCCAGCCGCGCCGGGCCGGCCGG - Intronic
1019504563 7:1384262-1384284 TCCGGCTGGGGCAGGGGCGCAGG + Intergenic
1019511973 7:1422185-1422207 GCCAGCTGGGCCGGCCACCCAGG + Intergenic
1019531270 7:1504553-1504575 TCCAGGTGGGTCGGCGGCGCGGG + Intergenic
1019689416 7:2402250-2402272 TTAAGATGGGCCGGGCGCGGCGG + Intergenic
1019807258 7:3137083-3137105 GCCACCTGGGCTGGGCGCGTTGG - Intergenic
1019860841 7:3657032-3657054 TCCACCAAGGCCGGGCGCGGTGG - Intronic
1019909974 7:4094347-4094369 CCCGGCTGGGCCGGGCGCGGTGG - Intronic
1019942288 7:4301075-4301097 TCCTGCTGGGCCGGGCGTGGTGG - Intergenic
1020062134 7:5160546-5160568 CCCAGCAGGGCCGGGCGCGGTGG + Intergenic
1020067966 7:5204177-5204199 TTCATCTGGGCCGGGCGCGGTGG + Intronic
1020109638 7:5440799-5440821 CACAACTGGGCCGGGCGCGGTGG - Intronic
1020166010 7:5808131-5808153 CCCAGCAGGGCCGGGCGCGGTGG - Intergenic
1020201350 7:6082413-6082435 CCCACCCGGGCCGGGCGCGGTGG - Intergenic
1020231497 7:6322520-6322542 TGCAGCTGGGCCGGGTGCAGTGG + Intergenic
1020276171 7:6625941-6625963 TCCAGCAAGGCTGGGCGCGGTGG - Intergenic
1020394964 7:7704466-7704488 TGCTTCTGGGCCGGGCGCGGTGG + Intronic
1022670633 7:32452112-32452134 TCCACTTCGGCCGGGCGCGGTGG - Intergenic
1023321788 7:39006174-39006196 TACAGTTGGGCCGGGCGCGGTGG + Intronic
1023375682 7:39552757-39552779 TACAACTAGGCCGGGCGCGGTGG - Intergenic
1023757421 7:43432424-43432446 AACAACTGGGCCGGGCGCGGTGG - Intronic
1024898010 7:54282275-54282297 TCCACCTGGGCTGGGCGTGGTGG - Intergenic
1025018439 7:55461701-55461723 ACTAGCTGGGCCGGGCGCAGTGG - Intronic
1025055982 7:55765360-55765382 TTCATCTCGGCCGGGCGCGGTGG - Intergenic
1025083855 7:56006828-56006850 GACAGCAGGGCCGGGCGCGGTGG + Intergenic
1025215022 7:57049284-57049306 ACCAGCTGGGCTGGGCGCAGTGG + Intergenic
1025656929 7:63527532-63527554 ACCAGCTGGGCTGGGCGCAGTGG - Intergenic
1025848222 7:65219069-65219091 TCCAGCCAGGCCAGGCGCGGTGG - Intergenic
1026092858 7:67315800-67315822 TGCAGTTGGGCCGGGCGTGGTGG - Intergenic
1026209305 7:68289202-68289224 CCCATCTGGGCCGGGCGCAGTGG - Intergenic
1026411194 7:70124846-70124868 TGAAGCTGGGCTGGGCGCGGTGG - Intronic
1026423141 7:70261032-70261054 TACAGGTTGGCCGGGCGCGGTGG - Intronic
1026575059 7:71564977-71564999 TCAGGCTGGGCCGGGCACGGTGG + Intronic
1026712539 7:72755386-72755408 TCCAGCCTGGCCGGGCGTGATGG + Intronic
1026988566 7:74570073-74570095 AACAGCAGGGCCGGGCGCGGTGG + Intronic
1026994457 7:74606535-74606557 GCCAGGTGGGCCGGGCCCGGGGG - Intergenic
1027271422 7:76521430-76521452 TCCAGGTGGGCCGGGTGCAGTGG + Intergenic
1027321188 7:77011369-77011391 TCCAGGTGGGCCGGGTGCAGTGG + Intergenic
1028843477 7:95453579-95453601 TGTACCTGGGCCGGGCGCGGTGG - Intergenic
1029139956 7:98402204-98402226 TACTACTGGGCCGGGCGCGGTGG - Intergenic
1029209221 7:98891823-98891845 ACATGCTGGGCCGGGCGCGGTGG - Intronic
1029248956 7:99222532-99222554 ATCACCTGGGCCGGGCGCGGTGG + Intergenic
1029621264 7:101691221-101691243 GCCAGGTGGGCCGGGCGCGGTGG - Intergenic
1029807762 7:103014634-103014656 GCAAACTGGGCCGGGCGCGGTGG + Intronic
1030787456 7:113680010-113680032 TCAAGATGGGCCGGGCGCGGTGG - Intergenic
1031192004 7:118564455-118564477 TACACCTGGGCCGGGCGCAGTGG - Intergenic
1031754812 7:125625358-125625380 TCAAGTTAGGCCGGGCGCGGTGG - Intergenic
1032021873 7:128411187-128411209 TCCAGATGCGCCGGGCGCGGTGG - Intergenic
1032077382 7:128842496-128842518 TGAGGCTGGGCCGGGTGCGCTGG + Intronic
1032801556 7:135321028-135321050 ACCAGCAGGGCCGGGCGCAGTGG + Intergenic
1032818796 7:135504771-135504793 GCCGGATGGGCCGGGCGCGGTGG - Intronic
1032833942 7:135655876-135655898 GACAACTGGGCCGGGCGCGGTGG - Intergenic
1032853315 7:135813591-135813613 ACCATCTGGGCCGGGCGCAGTGG - Intergenic
1033084151 7:138326643-138326665 TCAGGATGGGCCGGGCGCGGTGG - Intergenic
1033095551 7:138427496-138427518 ACAAGCAGGGCCGGGCGCGGTGG + Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1034952196 7:155306285-155306307 ACAGGCTGGGCCGGGCGCGGTGG - Intronic
1035163980 7:156973209-156973231 ACCAGCTTGGCCGGGCACGGTGG + Intergenic
1035685282 8:1519735-1519757 CCCAGCTGGGCCAGGCCCGCAGG - Intronic
1035870218 8:3129699-3129721 TGGAGCTGGGCCGGGCGGGGTGG + Intronic
1036060033 8:5306710-5306732 TCCAAGAGGGCCGGGCGCGGTGG + Intergenic
1036067982 8:5405559-5405581 TAGAACTGGGCCGGGCGCGGTGG - Intergenic
1036562248 8:9906901-9906923 TCCATCTGGCCCGGGCGCGCTGG - Intergenic
1036567694 8:9951589-9951611 TTTAGTTGGGCCGGGCGCGGTGG - Intergenic
1036784113 8:11674249-11674271 TACAGTGGGGCCGGGCGCGGTGG + Intergenic
1037892846 8:22632994-22633016 TGCAGCTGGGCTGGGCGCAGTGG - Intronic
1037965208 8:23128553-23128575 TGAAGCTAGGCCGGGCGCGGTGG + Intergenic
1038552869 8:28484879-28484901 TCCATCTTGGCCGGGCGCGGTGG - Intronic
1039415611 8:37391472-37391494 TCCAGATGGGCTGGGTGCGATGG + Intergenic
1039508769 8:38072157-38072179 TCCATCTTGGCCAGGCGCGGTGG + Intergenic
1039541758 8:38378216-38378238 TCCATCTTGGCCGGGCGTGTTGG + Intronic
1039881588 8:41628619-41628641 AACAACTGGGCCGGGCGCGGTGG - Intergenic
1039890065 8:41679849-41679871 TCCAGGAAGGCCGGGCGCGGTGG - Intronic
1039904015 8:41773186-41773208 TCCAGCCAGGCCGGGTGCCCAGG - Intronic
1040502052 8:48013594-48013616 TTCATGTGGGCCGGGCGCGGTGG - Intronic
1042367279 8:67952123-67952145 AGCAGCGGGGCCGGGCGCGCAGG + Exonic
1042716891 8:71783968-71783990 ACCATATGGGCCGGGCGCGGTGG + Intergenic
1042830712 8:73025463-73025485 ATTAGCTGGGCCGGGCGCGGTGG + Intronic
1043321239 8:78989190-78989212 TGTATCTGGGCCGGGCGCGGTGG + Intergenic
1043524950 8:81086266-81086288 GCCAGATTGGCCGGGCGCGGTGG - Intronic
1043679962 8:83011066-83011088 TTGAGCTTGGCCGGGCGCGGTGG + Intergenic
1044108110 8:88237360-88237382 TGCATCTTGGCCGGGCGCGGTGG + Intronic
1044302768 8:90605318-90605340 TCCACATGGGCCGGGGGCGGTGG - Intergenic
1044666362 8:94638540-94638562 TCTTTCTGGGCCGGGCGCGGTGG - Intergenic
1044713775 8:95081772-95081794 TCCTGTTGGGCCGGGCGTGGTGG + Intronic
1044729320 8:95217698-95217720 TCCAGGTGGGCCGGGCACAGTGG - Intergenic
1045099102 8:98826735-98826757 TCAAGATGGGCCGGGCGCGGTGG + Intronic
1045099148 8:98827046-98827068 TCAAGATGGGCCGGGCGCGGTGG + Intronic
1045296853 8:100878966-100878988 TCAAAATGGGCCGGGCGCGGTGG - Intergenic
1045300468 8:100906397-100906419 GCCAGGTGGGCCGGGCGCGGTGG - Intergenic
1045313585 8:101024983-101025005 TAAAGTTGGGCCGGGCGCGGTGG + Intergenic
1045461731 8:102431441-102431463 ACCATCTGGGCCGGGCGTGGTGG - Intergenic
1045580070 8:103468649-103468671 TCAAGCTGGGCCAGGCGCGGTGG - Intergenic
1046307380 8:112386782-112386804 TTTAGTTGGGCCGGGCGCGGTGG - Intronic
1046693732 8:117315300-117315322 CACAGCTAGGCCGGGCGCGGTGG + Intergenic
1046735587 8:117773020-117773042 TCTAGCTTGGCCGGGCGCAGTGG - Intergenic
1046999547 8:120560193-120560215 TTCATCTGGGCCGGGTGCGGTGG + Intronic
1047485271 8:125324859-125324881 TCAAAATGGGCCGGGCGCGGTGG - Intronic
1047559398 8:125970265-125970287 TTCATCTTGGCCGGGCGCGGTGG + Intergenic
1047998842 8:130359908-130359930 GCAAGATGGGCCGGGCGCGGTGG - Intronic
1048346141 8:133576276-133576298 GGCAGCAGGGCCGGGCGCGGTGG + Intergenic
1049110695 8:140640804-140640826 ACCAGCTGGGCCAGGCGTGGTGG - Intergenic
1049411597 8:142476061-142476083 TCCGGCTGGGGCAGGCGGGCTGG - Intronic
1049645290 8:143733365-143733387 TCCAGCTAGGCCGCGAGGGCGGG + Intronic
1049732739 8:144186803-144186825 TCAGGCTAGGCCGGGCGCGGTGG + Intronic
1049754844 8:144306017-144306039 ACCAGAGGGGCCGGGCGCGGTGG - Intronic
1049764706 8:144349393-144349415 TCCAAATAGGCCGGGCGCGGTGG + Intergenic
1049843201 8:144787245-144787267 CCCGGCGGGGGCGGGCGCGCGGG - Intronic
1050359719 9:4818206-4818228 AGCAACTGGGCCGGGCGCGGTGG - Intronic
1050521814 9:6508994-6509016 TTAATCTGGGCCGGGCGCGGTGG + Intergenic
1050530292 9:6582540-6582562 AACTGCTGGGCCGGGCGCGGTGG + Intronic
1050575998 9:6995953-6995975 ACCTGCAGGGCCGGGCGCGGTGG - Intronic
1051101249 9:13524488-13524510 TCCAACTGGGCTGGGCGAGGTGG + Intergenic
1051774592 9:20621012-20621034 CCAAGCCGGGCCGGGCGGGCGGG - Intronic
1052803758 9:32994004-32994026 TAGAGCTGGGCCGGGCGCGGTGG - Intronic
1052927527 9:34030156-34030178 GCCAGGTGAGCCGGGCGCGGTGG + Intronic
1052948046 9:34184342-34184364 TCGCTCTGGGCCGGGCGCGGTGG + Intronic
1053039038 9:34853539-34853561 ACCAGCTCGGCCGGGCGCGGTGG + Intergenic
1053235321 9:36448715-36448737 CCCAAATGGGCCGGGCGCGGTGG + Intronic
1053345394 9:37374486-37374508 CTCAGGTGGGCCGGGCGCGGTGG - Intergenic
1053528870 9:38857920-38857942 GCTGGCTGGGCCGGGCGCGGTGG - Intergenic
1053557195 9:39149628-39149650 TTCATCTTGGCCGGGCGCGGTGG - Intronic
1053570943 9:39306437-39306459 GCCTGCTCGGCCGGGCGCGGTGG + Intergenic
1054113980 9:61141047-61141069 GCCTGCTCGGCCGGGCGCGGTGG + Intergenic
1054126202 9:61312575-61312597 GCCTGCTCGGCCGGGCGCGGTGG - Intergenic
1054201098 9:62082355-62082377 GCTGGCTGGGCCGGGCGCGGTGG - Intergenic
1054637262 9:67506009-67506031 GCTGGCTGGGCCGGGCGCGGTGG + Intergenic
1055002631 9:71469847-71469869 ACTAGCAGGGCCGGGCGCGGTGG - Intergenic
1056208716 9:84344474-84344496 CCCATCTGGGCCGGGTGCGGTGG - Intergenic
1056572211 9:87825659-87825681 TCCAGCTGGGCTGTGTGAGCTGG - Intergenic
1056602097 9:88054402-88054424 TGCAGCTGGGACGGGAGCCCAGG + Intergenic
1056929971 9:90866184-90866206 TCCATATGGGCCGGGCACGGTGG - Intronic
1057002787 9:91528307-91528329 TCCAGATTGGCCGGGCGCAGTGG + Intergenic
1057311989 9:93948649-93948671 CCCAGCTGGGCCCAGCACGCAGG - Intergenic
1057502935 9:95610215-95610237 TCTTGCAGGGCCGGGCGCGGTGG - Intergenic
1057565891 9:96166020-96166042 TGCAACTGGGCCAGGCGCGGTGG - Intergenic
1057665230 9:97039330-97039352 GGAAGCTGGGCCGGGCGCCCGGG + Intronic
1058157892 9:101535192-101535214 TCAAGGCGGGCCGGGCGCGGTGG - Intronic
1058403028 9:104638700-104638722 TCCTCCTTGGCCGGGCGCGGTGG + Intergenic
1058530893 9:105903555-105903577 TCCAATTTGGCCGGGCGCGGTGG - Intergenic
1058540885 9:106011568-106011590 TGCAGCCAGGCCGGGCGCGGTGG + Intergenic
1058688518 9:107499713-107499735 TCGGGATGGGCCGGGCGCGGTGG - Intergenic
1058971233 9:110085025-110085047 TGCATCTAGGCCGGGCGCGGTGG - Intronic
1059495136 9:114703083-114703105 TCCTGTCGGGCCGGGCGCGGTGG - Intergenic
1059934829 9:119299324-119299346 TACAAGTGGGCCGGGCGCGGTGG + Intronic
1060092261 9:120753744-120753766 TCATGCTCGGCCGGGCGCGGTGG + Intronic
1060215088 9:121734088-121734110 TGTTGCTGGGCCGGGCGCGGTGG + Intronic
1060541790 9:124435871-124435893 GCCAGGTGGGCCGGGCGTGGAGG + Intergenic
1060640433 9:125233627-125233649 TCCAGATAGGCCGGGCACGGTGG - Intronic
1061006473 9:127930943-127930965 TCCGGCTGGGGCGGGGCCGCCGG + Intergenic
1061148889 9:128817819-128817841 CCAATCTGGGCCGGGCGCGGTGG + Intergenic
1061159931 9:128887927-128887949 TCCAGGGGAGCCGGGCGCGGTGG - Intronic
1061301944 9:129710444-129710466 GCTAGCTTGGCCGGGCGCGGTGG + Intronic
1061365957 9:130172583-130172605 AGCGGCTGGGCCGGGCGGGCCGG - Exonic
1061514029 9:131078202-131078224 CTCAGCTTGGCCGGGCGCGGTGG + Intronic
1061620567 9:131808851-131808873 TTCAGCTGGACCCGGCGCTCTGG - Intergenic
1061706830 9:132459356-132459378 TCCAGGGTGGCCGGGCGCGGTGG - Intronic
1061776803 9:132971149-132971171 TCCATCTGGGCCGGGCGCAGTGG - Intronic
1061805653 9:133136348-133136370 TTCACCTTGGCCGGGCGCGGTGG + Intronic
1061866586 9:133494511-133494533 TCCAGCTGGTCCTGTCGCCCTGG + Intergenic
1061869797 9:133514667-133514689 TCCAGCTTGGCCGGGGTCCCCGG + Exonic
1062230769 9:135480236-135480258 TCCAGGAGCGCGGGGCGCGCGGG - Intronic
1062503265 9:136860230-136860252 TCCTCCTTGGCCGGGCGCGGTGG + Intronic
1062561541 9:137144365-137144387 CCCAGGTTGGCCGGGCGCGGTGG + Intronic
1062593144 9:137283698-137283720 TCCACCTGGGCCAGGCGCAGTGG + Intergenic
1203583218 Un_KI270746v1:34166-34188 TCATGGTGGGCCGGGCGCGGTGG + Intergenic
1185509758 X:654973-654995 TCCTCCTGGGCCAGGCGCGGTGG - Intronic
1185760934 X:2689987-2690009 TCAAACTAGGCCGGGCGCGGTGG - Intergenic
1186370998 X:8947250-8947272 GGCAGCTGGGCTGGGCGCGGTGG + Intergenic
1187131102 X:16503919-16503941 TCTAACTGGGCCAGGCGCGGTGG + Intergenic
1187331296 X:18342422-18342444 TACAGTTGGGCCGGGCGCAGTGG + Intronic
1187398624 X:18939778-18939800 ACCAGCTTGGCCAGGCGCGGTGG - Intronic
1187886073 X:23889946-23889968 CCCAGGTGGGCCAGGCGCGGTGG - Intronic
1187911529 X:24115698-24115720 ACTGGCTGGGCCGGGCGCGGTGG - Intergenic
1188307302 X:28573623-28573645 TCCATCTGGGCCAGGCGCGGTGG - Intergenic
1188386504 X:29566224-29566246 CCCACATGGGCCGGGCGCGGTGG - Intronic
1188488721 X:30713019-30713041 TCCAACAAGGCCGGGCGCGGTGG - Intronic
1188547856 X:31329683-31329705 TCCACCTCGGCCGGGCGCGGTGG + Intronic
1188594729 X:31885320-31885342 ATCATCTGGGCCGGGCGCGGTGG + Intronic
1188695463 X:33185007-33185029 CCTTGCTGGGCCGGGCGCGGTGG - Intronic
1189430759 X:40944835-40944857 TACACCAGGGCCGGGCGCGGTGG - Intergenic
1189818558 X:44847808-44847830 TCAAGGAGGGCCGGGCGCGGTGG - Intergenic
1190108292 X:47574094-47574116 TCCAGCGGGGCCCGGGCCGCTGG + Exonic
1190154814 X:47981611-47981633 TCCAGTGGGGCCGGGCACGGTGG + Intronic
1190292727 X:49003341-49003363 TCCAGCAGGGCCGGGCGCGGTGG + Intergenic
1190476868 X:50836803-50836825 TCCCTCTGGGCCGGGTGCGGTGG - Intergenic
1190878428 X:54475778-54475800 CTCAGCTAGGCCGGGCGCGGTGG + Intronic
1192327228 X:70143207-70143229 TCCATCTCGGCCGGGCGCAGTGG - Intronic
1192434382 X:71133940-71133962 TCAAGCATGGCCGGGCGCGGTGG + Intronic
1192466983 X:71364359-71364381 TTAACCTGGGCCGGGCGCGGAGG + Intergenic
1192601794 X:72472352-72472374 TAAAGTTGGGCCGGGCGCGGTGG - Intronic
1194659560 X:96614654-96614676 TCCAATTCGGCCGGGCGCGGTGG + Intergenic
1195051479 X:101100708-101100730 TCCATCTCGGCCGGGCGTGGTGG - Intronic
1195072248 X:101291948-101291970 GCGAGTTGGGCCGGGCGCGGTGG + Intronic
1195272404 X:103244606-103244628 TGCATCTGGGCCGGGCGCAATGG - Intergenic
1195547736 X:106132091-106132113 ACCATCTTGGCCGGGCGCGGTGG + Intergenic
1195878813 X:109571592-109571614 AACAGCTAGGCCGGGCGCGGTGG - Intergenic
1196436606 X:115680474-115680496 TGCAGGCGGGCCGGGCGCGGTGG + Intergenic
1196795247 X:119497045-119497067 TCCATCTCGGCCGGGCGCGGTGG + Intergenic
1196833956 X:119797965-119797987 TGCAGCTCGGCCGGGCGCGATGG + Intergenic
1196846047 X:119897444-119897466 TCCATTTGGGCCGGGCGCAGTGG - Intronic
1197218615 X:123890301-123890323 AACAACTGGGCCGGGCGCGGTGG - Intronic
1198219964 X:134589906-134589928 TACAAATGGGCCGGGCGCGGTGG + Intronic
1198391630 X:136181028-136181050 TCAATCAGGGCCGGGCGCGGTGG - Intronic
1198911174 X:141616476-141616498 CACATCTGGGCCGGGCGCGGTGG + Intronic
1199119906 X:144039321-144039343 TCCATCATGGCCGGGCGCGGTGG - Intergenic
1199305179 X:146259063-146259085 ACCAGCAGGGCCCGGCGCGGTGG - Intergenic
1199709241 X:150456827-150456849 TACAGCTGGGCCGGAGGGGCTGG + Intronic
1199724498 X:150567839-150567861 ACAATCTGGGCCGGGCGCGGTGG - Intergenic
1199752394 X:150832760-150832782 TCCACCAGGGCCGGGCGTGGTGG + Intronic
1199816527 X:151402672-151402694 TCCAGCTGGGGAGGGCGCACTGG + Intronic
1200409949 Y:2851128-2851150 ACCCTCTGGGCCGGGCGCGGTGG - Intronic
1200896198 Y:8378392-8378414 TACAGCTGGGCCAGGCACACAGG - Intergenic
1202347123 Y:23943406-23943428 TTCTTCTGGGCCGGGCGCGGTGG + Intergenic
1202523648 Y:25726684-25726706 TTCTTCTGGGCCGGGCGCGGTGG - Intergenic