ID: 1103323558

View in Genome Browser
Species Human (GRCh38)
Location 12:120105402-120105424
Sequence AAGAATGACCAGGGGGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 262}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103323550_1103323558 22 Left 1103323550 12:120105357-120105379 CCAGAAACAGCTGGTGGCTAACG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1103323558 12:120105402-120105424 AAGAATGACCAGGGGGTAGGAGG 0: 1
1: 0
2: 2
3: 15
4: 262
1103323549_1103323558 23 Left 1103323549 12:120105356-120105378 CCCAGAAACAGCTGGTGGCTAAC 0: 1
1: 0
2: 1
3: 9
4: 101
Right 1103323558 12:120105402-120105424 AAGAATGACCAGGGGGTAGGAGG 0: 1
1: 0
2: 2
3: 15
4: 262
1103323551_1103323558 -3 Left 1103323551 12:120105382-120105404 CCAAGCAAGCCAAAGAACAAAAG 0: 1
1: 0
2: 3
3: 20
4: 379
Right 1103323558 12:120105402-120105424 AAGAATGACCAGGGGGTAGGAGG 0: 1
1: 0
2: 2
3: 15
4: 262
1103323548_1103323558 24 Left 1103323548 12:120105355-120105377 CCCCAGAAACAGCTGGTGGCTAA 0: 1
1: 0
2: 0
3: 12
4: 177
Right 1103323558 12:120105402-120105424 AAGAATGACCAGGGGGTAGGAGG 0: 1
1: 0
2: 2
3: 15
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103323558 Original CRISPR AAGAATGACCAGGGGGTAGG AGG Intronic
900533518 1:3166064-3166086 AGGAAAGACCAGGGGCTAGGAGG - Intronic
901616548 1:10544657-10544679 AGGGATTACCAAGGGGTAGGAGG - Intronic
902408181 1:16197949-16197971 AAGGGTGACCAGGGGGCAGGGGG - Intronic
904420631 1:30388904-30388926 AAGAGTGGGAAGGGGGTAGGAGG - Intergenic
904748436 1:32725606-32725628 TAAAATGACCAGGTGGGAGGAGG + Intergenic
905541670 1:38764958-38764980 AGGAGAGACCAGGGGGTGGGGGG + Intergenic
906443826 1:45875730-45875752 AAGAATGACCCTGGGTTTGGTGG + Intronic
907756946 1:57319745-57319767 ACGAATAAACAGAGGGTAGGTGG + Intronic
908336462 1:63129988-63130010 AAGAATAACATGGGGGAAGGAGG + Intergenic
910280958 1:85501293-85501315 AAGAAAGGCCAGGCGGTAGGAGG - Intronic
910682680 1:89883412-89883434 AAGCATGACCAGAGGGTAAAGGG + Intronic
912469828 1:109898977-109898999 AAGAATGATCAGGAGGTGGTGGG + Intergenic
917430615 1:174964340-174964362 AAAAATGACGAGGAGGGAGGCGG - Intronic
917763656 1:178193596-178193618 AAGAAAGAACAGGGTGAAGGAGG - Intronic
917891592 1:179443568-179443590 GAGATTGCCCAGGGGGTTGGGGG - Intronic
922125314 1:222715256-222715278 AAAAATCACCTGGGGGTGGGTGG - Intronic
922624710 1:227027421-227027443 AAGAATTACTTGGGGGCAGGAGG - Intronic
922870170 1:228896288-228896310 AAGAAATACCACGGGCTAGGTGG - Intergenic
922912648 1:229230456-229230478 ATGAATTAGCAGGAGGTAGGCGG - Intergenic
923900957 1:238325938-238325960 TAGAATGAGCAGGGAGGAGGAGG + Intergenic
924113171 1:240720289-240720311 AAGAGTGAGCAGGGGGTCTGGGG - Intergenic
924246931 1:242094289-242094311 AGGACTGACAAGGGGGTAGCGGG - Intronic
924604151 1:245517766-245517788 AAGAATGAGCAGGAGGTGGCTGG + Intronic
1063319381 10:5038341-5038363 AGGAATAACCAGCGGGTAGAGGG - Intronic
1063403848 10:5774286-5774308 AAGAATGACCAAGGGGCATAAGG - Intronic
1063741873 10:8831978-8832000 AGGACTTACCAGGTGGTAGGTGG + Intergenic
1064166230 10:12988639-12988661 AAGAATTAAAAGAGGGTAGGTGG - Intronic
1065188254 10:23189679-23189701 ATGAATGAGCATGGGATAGGAGG - Intergenic
1065305846 10:24367943-24367965 AAGACTGACCAATGGGAAGGAGG - Intronic
1067415983 10:46103530-46103552 AAGTGTGACCAGGGGTTAAGAGG - Intergenic
1071602072 10:86963171-86963193 CAGAAGGACCAGAGGGTGGGTGG - Exonic
1072052500 10:91719961-91719983 AAGAAACTCCAGGAGGTAGGTGG + Intergenic
1074047426 10:109851467-109851489 AAGAAACATCAGGGGCTAGGAGG - Intergenic
1074411189 10:113230205-113230227 AAGGATGACCTGGGGGCAGCAGG - Intergenic
1074572763 10:114639426-114639448 TAGAATAACCACTGGGTAGGCGG - Intronic
1076296414 10:129388698-129388720 AAGGAAGACCATGGGGTGGGTGG - Intergenic
1079320811 11:19449828-19449850 AGGAAGGGCCAGGGGGTGGGAGG - Intronic
1080354672 11:31428973-31428995 TAGAAAAACAAGGGGGTAGGGGG + Intronic
1082752807 11:57038807-57038829 AAGACTCAGCAGGGGGTAGAGGG + Intergenic
1082770806 11:57206150-57206172 AAGCATCAACTGGGGGTAGGGGG - Intergenic
1083169688 11:60915669-60915691 ATGAATCACCAGGTGGCAGGAGG - Intronic
1083570609 11:63760124-63760146 AAGAATGAGGAGGGGTCAGGGGG + Exonic
1084692208 11:70734051-70734073 AAGAGTCACCAGGGGCTGGGAGG + Intronic
1084984949 11:72860732-72860754 AAGAATCACCTGGGAGGAGGAGG + Intronic
1085599519 11:77842576-77842598 AAGTATGGCCAGGGGGTAGTCGG + Exonic
1085889826 11:80565300-80565322 AGGACTAACCAGAGGGTAGGAGG - Intergenic
1085980782 11:81721680-81721702 ATGAATGACCAGTGGGTCAGTGG + Intergenic
1086486541 11:87308972-87308994 AAGAACTTCCAGGGGGCAGGGGG - Intronic
1086661547 11:89425643-89425665 AAAAATGATTTGGGGGTAGGAGG + Intronic
1086817724 11:91393912-91393934 GGGAATGACCATGGAGTAGGTGG + Intergenic
1087630814 11:100648159-100648181 GAGAAAGACCATGGGGTGGGGGG - Intergenic
1089294246 11:117458460-117458482 AAGAATGCCCATGGTGTGGGAGG + Intronic
1089325417 11:117653438-117653460 ATGAATGAGCTGGGGGAAGGGGG - Intronic
1089446128 11:118553814-118553836 AATAATTACCAGGGTCTAGGAGG + Intronic
1093027224 12:14255953-14255975 AAGCTTGACCAGAGGGTAGGAGG + Intergenic
1093217987 12:16384990-16385012 AAGAAGGAACAGGAGTTAGGTGG + Intronic
1093572798 12:20687627-20687649 AAGAAATATCAGGGGGTGGGTGG - Intergenic
1094489494 12:30950097-30950119 AAGAAAGAGAAGGGGGTGGGGGG - Intronic
1095257060 12:40051213-40051235 GACAATGACCAGGTGGTAGTTGG + Intronic
1098996366 12:77125412-77125434 AAGCAGGACCAGGGGCTGGGAGG + Intergenic
1100492947 12:95098742-95098764 AAAAAGTACCAGGGGCTAGGAGG - Intronic
1101224304 12:102672324-102672346 AAGGATAACTTGGGGGTAGGGGG + Intergenic
1103323558 12:120105402-120105424 AAGAATGACCAGGGGGTAGGAGG + Intronic
1107189156 13:37559108-37559130 TAGAATGAGCAGGGAGGAGGAGG - Intergenic
1107722935 13:43267727-43267749 AAGAACCACCAAGGGGTAGCAGG + Intronic
1108776734 13:53774121-53774143 AAGACTGATCTGGGAGTAGGAGG + Intergenic
1110277894 13:73660531-73660553 AAGAAGGAAAAGAGGGTAGGAGG + Intergenic
1111537772 13:89626555-89626577 AGGAATTACCTTGGGGTAGGGGG + Intergenic
1112333038 13:98491280-98491302 AGGTATGAGCATGGGGTAGGGGG + Intronic
1113674511 13:112197992-112198014 GAGAAAGACAAAGGGGTAGGGGG + Intergenic
1116527249 14:45920059-45920081 TAGAATGAGCAGGGAGGAGGAGG + Intergenic
1118377755 14:65191750-65191772 AAGAAGGATCAGGGGACAGGAGG - Intergenic
1119271158 14:73306451-73306473 ATGGATGACCAAGGGGTTGGTGG - Intronic
1120589812 14:86362447-86362469 AATAATGACAAGGAGGTAGATGG + Intergenic
1121326695 14:93024305-93024327 AAGGATGCCCAGGGGTTAGAGGG + Intronic
1122384525 14:101334832-101334854 AAACATCACCAGGAGGTAGGGGG + Intergenic
1123909651 15:24954836-24954858 CGGAATGACCTGGGGGGAGGGGG - Intronic
1125314516 15:38417074-38417096 AAGGATATCAAGGGGGTAGGAGG - Intergenic
1125526412 15:40378354-40378376 AAGAAGTACCAAGGGGAAGGAGG + Intergenic
1127305450 15:57701199-57701221 AAGGATGACAAAGGGGCAGGAGG - Intronic
1127598830 15:60514506-60514528 AATAATGAGGAGGGGGCAGGCGG + Intronic
1128617432 15:69121168-69121190 TAGAATGACCCGGGGGAGGGAGG + Intergenic
1128722194 15:69958245-69958267 ATGAATCACCTGGGGGTGGGGGG - Intergenic
1130744567 15:86637324-86637346 AGGAATGACCTGGGTGAAGGAGG + Intronic
1132226243 15:100143970-100143992 CAGAATGACCAGGTGCTGGGTGG - Intronic
1133297999 16:4764912-4764934 AAGAAAGACCAGGGGCATGGGGG - Intronic
1133629281 16:7603911-7603933 CAGAATGGACAGGGGGAAGGAGG + Intronic
1134287180 16:12872032-12872054 AAGAAGGAGGAGGGGGGAGGAGG - Intergenic
1134858636 16:17541171-17541193 AAGAATGGCCAGCAGGCAGGAGG - Intergenic
1135235037 16:20747259-20747281 GAGAATGATAAGGGGGAAGGCGG - Intronic
1136494734 16:30635402-30635424 AAGAAGGACTAGGGGGAATGGGG + Intergenic
1137843520 16:51664290-51664312 AAGAATGACCACCCTGTAGGTGG + Intergenic
1138070570 16:53989242-53989264 TAGAATGAACAGGGAGTTGGAGG + Intronic
1139324115 16:66138714-66138736 AAGAATGATCAGTGGTCAGGTGG + Intergenic
1140235453 16:73154525-73154547 ATGAATGACTTGGGGGTGGGCGG + Intergenic
1140380124 16:74479359-74479381 TATAGTGACTAGGGGGTAGGAGG - Intronic
1141845115 16:86603368-86603390 AAGAAGGAGGAGGGGGAAGGAGG - Intergenic
1144278328 17:13699040-13699062 AACAAGGATCAGGGGGTGGGTGG + Intergenic
1144676144 17:17163100-17163122 CAGAATGAGCAGGGGGTCTGTGG + Intronic
1145943544 17:28757093-28757115 AAGAATGGACAGAGGGCAGGAGG + Exonic
1146941633 17:36847557-36847579 GAGAAGGACCTGGGGGTGGGGGG + Intergenic
1147445229 17:40471283-40471305 AAGAATGAGGAGGGGGTAGGAGG - Intergenic
1149556705 17:57578544-57578566 AAGAATGCCCAGGGGATGAGGGG + Intronic
1150636686 17:66918194-66918216 AAGAATGACCAGGCTCTGGGAGG - Intergenic
1151546750 17:74797940-74797962 CAGAATGACCAGGGGGCAGCGGG - Intronic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1152928718 17:83099503-83099525 AGGGAAGACCTGGGGGTAGGGGG - Intergenic
1153097374 18:1422540-1422562 AAGAATGACCAGAAGGTAATTGG + Intergenic
1155298114 18:24403887-24403909 AATAGAGACCAGGGGGAAGGAGG + Intergenic
1157748338 18:50156983-50157005 AAGGATGACCTGGGGGAGGGTGG - Intronic
1158770637 18:60513047-60513069 AAAAATGACCATGAGGGAGGAGG - Intergenic
1159156890 18:64595553-64595575 TAGAATGAGCAGGGAGGAGGAGG + Intergenic
1160064506 18:75562259-75562281 AGGAATGGTCATGGGGTAGGGGG + Intergenic
1160583699 18:79901382-79901404 AAGGATGCCCAGGGGCTGGGTGG - Intergenic
1161404010 19:4081826-4081848 AAGGAGGAGCAGGGGGGAGGAGG - Intergenic
1161509650 19:4663375-4663397 TAGAATGAGGATGGGGTAGGTGG - Intronic
1161684962 19:5698074-5698096 CAGATTGACTAGGGGGTGGGGGG - Intronic
1163669299 19:18618077-18618099 AACCATGACCAGGAGGGAGGAGG - Intronic
1164774099 19:30837634-30837656 AAGAATAACCAATGGGTACGAGG - Intergenic
1165821183 19:38677099-38677121 AAGAATGAGGAGGAGGTAGGTGG - Intronic
1166785150 19:45363144-45363166 GAGAATGACCAAGGGATACGAGG - Intronic
1167481127 19:49732115-49732137 AGGAATAACCAGTGAGTAGGAGG - Intergenic
925145911 2:1583272-1583294 AAGAGTGACCAGCGGGAGGGAGG - Intergenic
926936798 2:18093961-18093983 ATGAGTGACCAGGGGCCAGGAGG - Intronic
928163430 2:28950781-28950803 AAGAGTGACAATGAGGTAGGAGG + Intergenic
932255065 2:70277651-70277673 AAGAATCACCTGGAGTTAGGAGG + Exonic
933800953 2:85960051-85960073 AGGAATGGCCAGGGGGTTAGGGG - Intergenic
934046493 2:88176992-88177014 AAAAAAGACAAGGGAGTAGGAGG - Intronic
934515141 2:94981602-94981624 GAGAATGTCTAGGGGCTAGGTGG + Intergenic
935037354 2:99391561-99391583 ATGAAAGGTCAGGGGGTAGGAGG - Intronic
935040028 2:99417290-99417312 AAAAATTAGCTGGGGGTAGGTGG - Intronic
935821291 2:106895502-106895524 CTGAGTGACCAGGGGGTGGGTGG - Intergenic
937981028 2:127615500-127615522 TAGAATGAGCAGGGAGGAGGAGG + Intronic
938726501 2:134113408-134113430 AAGACTGAGGAGGGGGGAGGGGG - Intergenic
940448052 2:153801495-153801517 ATGAATGAACAGCTGGTAGGTGG + Intergenic
944226608 2:197354923-197354945 AAGCATGATCAGAGGGTAGAGGG + Intergenic
944478626 2:200132030-200132052 AAGAATAATCAGGGGAAAGGAGG + Intergenic
946407714 2:219500818-219500840 AAAAATGGCCGGGGGGGAGGGGG + Intronic
946408040 2:219502596-219502618 GAGATTGACCAGGGGGAGGGGGG + Intronic
946462524 2:219881794-219881816 AAAAAATACCAGGGGGAAGGGGG - Intergenic
946862486 2:224013697-224013719 AGGAGTGACCAGGCGGTAGGTGG + Intronic
1170356704 20:15499833-15499855 AAGAATCACCATGAGGTAGGAGG + Exonic
1173267597 20:41499287-41499309 AAGACTGTCCAGGAGGTTGGTGG - Exonic
1173291273 20:41717336-41717358 TAGAATGTGCTGGGGGTAGGGGG + Intergenic
1173660593 20:44730756-44730778 TAGAATGAGCAGGGAGGAGGAGG - Intergenic
1173925984 20:46781670-46781692 AAGACAGACCAGGGGACAGGAGG + Intergenic
1174498865 20:50969528-50969550 AAGATTGGCCTGGGGGTGGGGGG - Intergenic
1175745203 20:61451702-61451724 AAGGAGGAGGAGGGGGTAGGAGG + Intronic
1176882971 21:14219835-14219857 AACAATGACCAGAAGGTAGAAGG - Intronic
1179236741 21:39554167-39554189 CAGAATGACTAGGAGGAAGGAGG - Intergenic
1179831098 21:43996573-43996595 TAGAATGAGCAGGGAGGAGGAGG + Intergenic
1181580899 22:23827556-23827578 AAGAGAGAGCAGGGGGCAGGGGG - Intronic
1181861765 22:25824261-25824283 AAAAATCACCAGGTGATAGGTGG + Intronic
1182146703 22:28001168-28001190 AAGAATGGCCAGGGGTCATGAGG + Intronic
1182551302 22:31102240-31102262 AAGACTGTCCTGGGGGTGGGAGG + Intronic
1182995599 22:34809163-34809185 AAGAATGACAAGGAGGTTGAAGG + Intergenic
1183492135 22:38122334-38122356 GACAATGTCCAGGGGGTTGGGGG + Intronic
949492456 3:4602436-4602458 GAGAATGACCCGGGCCTAGGAGG + Intronic
950128007 3:10522458-10522480 TGGAATGACCAGGAGGTAGAAGG - Intronic
952957065 3:38563991-38564013 TAGAATGAAATGGGGGTAGGGGG - Intronic
954872839 3:53780787-53780809 AGGAGTGACCAGGAGGTGGGGGG + Intronic
955556745 3:60146255-60146277 AAAAAAGGGCAGGGGGTAGGAGG + Intronic
956743082 3:72290058-72290080 AAGAATGAACAGGAGTTAGCAGG + Intergenic
956907057 3:73777360-73777382 AAGAATGGCAAGGTGGTTGGGGG + Intergenic
957903554 3:86529931-86529953 AAGAGTGACAAGGGGGCAAGTGG + Intergenic
961136141 3:124513166-124513188 AAGAAAATTCAGGGGGTAGGGGG + Intronic
961360854 3:126366197-126366219 AACAGTGACCAGTGGCTAGGTGG + Intergenic
961685204 3:128625166-128625188 AGGAATCACCAAGGGGGAGGTGG + Intronic
961978056 3:131047803-131047825 AGGAAGGATCAGGTGGTAGGTGG + Intronic
963837472 3:150071562-150071584 AATAATGAGCAGGGGGGCGGTGG + Intergenic
964984391 3:162721609-162721631 AAGAATAAGGAGGGGGTAGAAGG + Intergenic
966407932 3:179618524-179618546 AGGAAAAACGAGGGGGTAGGTGG + Intronic
966857554 3:184205700-184205722 AAGATGGACTAGGGGGAAGGGGG - Intronic
967078256 3:186024807-186024829 AAGAATGGCCCGAGGGAAGGAGG + Intergenic
968577171 4:1372934-1372956 AAGAAAAGCCAGGGGGCAGGGGG - Intronic
968758246 4:2427792-2427814 AAGAAAGCCCAGAGGGGAGGTGG + Intronic
968914271 4:3490374-3490396 CTGAATGAGCAGGGGGTGGGGGG - Intronic
968938837 4:3627552-3627574 ATGAATGGCTAGTGGGTAGGAGG + Intergenic
969951297 4:10838795-10838817 AGGGATGGGCAGGGGGTAGGGGG - Intergenic
971167924 4:24203246-24203268 AAGAATGACCAGGCCGGACGTGG + Intergenic
971303498 4:25461259-25461281 AAGGAAGACCAGGAGATAGGTGG + Intergenic
971344436 4:25798849-25798871 AAGAAAGACCGGGGAGGAGGGGG + Intronic
971862137 4:32121648-32121670 CAGAATGACCTGGGAGTATGAGG + Intergenic
972965920 4:44509548-44509570 GAGAATGACCATGCAGTAGGTGG + Intergenic
975079966 4:70265289-70265311 GAGAATCACCTGGGGGTGGGAGG + Intergenic
975493246 4:75011472-75011494 GGGAATGACAAGGGGGTATGGGG + Intronic
975656234 4:76643793-76643815 AATAATGATTTGGGGGTAGGAGG - Intronic
977937827 4:102826974-102826996 AAGAAAGGCAAGGGGGGAGGGGG + Intronic
977984289 4:103363568-103363590 AAGAAGTAGCAGGGGGAAGGGGG - Intergenic
978161158 4:105549845-105549867 AAGAATAGCATGGGGGTAGGAGG + Intergenic
979811322 4:125039642-125039664 AAGAATGAGCAGGGAGCATGTGG + Intergenic
981330287 4:143500316-143500338 AAGATTGAGTAGAGGGTAGGTGG - Intergenic
981909638 4:149964241-149964263 AAGAATGTCCAGGGTGATGGTGG + Intergenic
983300066 4:165913861-165913883 AAAAATGACCAGAGTGTGGGTGG + Intronic
983481820 4:168284211-168284233 AATAATGACCAAGGTGTGGGGGG - Intronic
986377567 5:7148155-7148177 AAGATGGACATGGGGGTAGGAGG + Intergenic
987558348 5:19484576-19484598 AAGTGTGACCTGGGGGCAGGTGG - Intronic
988933311 5:36058627-36058649 TAGAATGAGCAGGGAGGAGGAGG - Intronic
988933524 5:36060510-36060532 TAGAATGAGCAGGGAGGAGGAGG - Intronic
990876679 5:60494248-60494270 AAGAATGCACTGGGGGTAGGGGG + Intronic
991678155 5:69109575-69109597 AAGAATGAGTAGGGGGTTTGGGG - Intronic
992705464 5:79387003-79387025 AAGAAGGAAGAGGGGGAAGGGGG - Intronic
993159798 5:84275168-84275190 AAGAATAACTATGGAGTAGGTGG - Intronic
994727755 5:103456360-103456382 ACGATTGACCTGGGGGTTGGAGG - Intergenic
995320032 5:110824034-110824056 GAGAGTGACTAGGGGGTGGGTGG - Intergenic
996411608 5:123164860-123164882 AAGTATGACCAAGGGCGAGGTGG - Intronic
999112828 5:149136993-149137015 AAGAATGACCATCAGGAAGGAGG + Intergenic
999194999 5:149775816-149775838 GAGAAAGAGAAGGGGGTAGGGGG - Intronic
1000821740 5:165993309-165993331 AAGAGTGGCCAGGAGGAAGGAGG - Intergenic
1001115047 5:168932454-168932476 CAGAAAGACTAGGAGGTAGGAGG + Intronic
1001411335 5:171514600-171514622 AAGAGTGGCCGGAGGGTAGGAGG + Intergenic
1003025425 6:2550916-2550938 AAGAATTAGGAGGGGGCAGGTGG + Intergenic
1004796063 6:19086460-19086482 AAGAATGAGGTGGGGTTAGGAGG - Intergenic
1005512197 6:26521085-26521107 AAGAACAACAAGGGGGTGGGCGG + Intergenic
1006215273 6:32436727-32436749 CAGAAGGAAAAGGGGGTAGGGGG + Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1007769314 6:44180414-44180436 AAGAGTTACCAGGGGGAGGGAGG - Intronic
1008562532 6:52736569-52736591 AAGAAAGTCCAGGGGCCAGGGGG - Intergenic
1010188338 6:73167806-73167828 TAGAAAGACCAGAGGGTAGGAGG + Intronic
1013152966 6:107464247-107464269 CAGAATGACCAGGTGCTGGGTGG + Intergenic
1014155588 6:118105502-118105524 AAGAATGACCACGGTGTGAGTGG - Intronic
1017587278 6:155940943-155940965 AAGAAAGAGTAGGGGGGAGGTGG - Intergenic
1019146168 6:169976794-169976816 AAGTGTGACCAGGGAGGAGGAGG - Intergenic
1023064576 7:36364693-36364715 GGGAATGACCAGGGGAGAGGAGG + Intronic
1023551060 7:41370057-41370079 AGGAGGGACCAGGGGGTGGGGGG + Intergenic
1024367276 7:48535535-48535557 AAGAAGGATCAGGTGGTGGGTGG + Intronic
1024517511 7:50271952-50271974 AAGAGTGACGAGGGTGGAGGAGG + Intergenic
1025806018 7:64835510-64835532 AAGAAGGACCAGGGTGGAGAGGG + Intergenic
1025929396 7:65982165-65982187 AAGCATGGCCCGGGGGTCGGCGG - Exonic
1027836544 7:83251222-83251244 AAGGATTGCCAGGGGTTAGGGGG - Intergenic
1028351096 7:89849688-89849710 AAGAATGTCTTGGGTGTAGGTGG + Intergenic
1028450586 7:90977758-90977780 CAGAATAGCCAGGGGGAAGGAGG + Intronic
1029849584 7:103447921-103447943 AAGGATGGGAAGGGGGTAGGGGG - Intergenic
1030826357 7:114164166-114164188 AGGAATGACCAGTGTTTAGGTGG - Intronic
1032962041 7:137046862-137046884 AAGAAGGAGGAGGGGGAAGGAGG + Intergenic
1034155474 7:148952887-148952909 AAGAATATCCATGGGGTCGGGGG - Intergenic
1034369920 7:150585973-150585995 TAGAATGACCAGGGAGCAGAAGG - Intergenic
1034472165 7:151261027-151261049 AAGACTCACCAAGGGGTGGGCGG + Intronic
1035105000 7:156434853-156434875 AAGAATGAGGTGGGGGCAGGGGG + Intergenic
1036599130 8:10242937-10242959 ATGAATGACCAGGATGCAGGTGG - Intronic
1038313727 8:26465426-26465448 CAGAGGGACCAGGGGGTGGGAGG - Intronic
1038560419 8:28573164-28573186 AAGAATGACTAGGGGATAGAAGG - Exonic
1040770551 8:50970132-50970154 CAGAATGAGAAGGGGGAAGGGGG + Intergenic
1042867729 8:73370296-73370318 AAGAAAGTCCAGCAGGTAGGTGG + Intergenic
1042953021 8:74220551-74220573 AAGAATGTTAAGGGGGTGGGTGG - Intergenic
1043041939 8:75274928-75274950 AAAAAAGAACAGTGGGTAGGAGG + Intergenic
1044346182 8:91107092-91107114 AAGAATCACTATGGGCTAGGTGG - Intronic
1044550877 8:93511199-93511221 AGGAAAGACCTGGGGGTGGGAGG - Intergenic
1044775397 8:95681707-95681729 AAGAATGAGCAGGAGTTAGGGGG + Intergenic
1045811608 8:106227303-106227325 AAGAATGAGCAGGAGTTAGCTGG - Intergenic
1048696479 8:137034212-137034234 AACATTGACCTGGGGTTAGGTGG - Intergenic
1049128764 8:140817238-140817260 AAGTATGGGCAGGGGGTGGGGGG + Intronic
1050457402 9:5847074-5847096 AAGAATGCCCAGGGGATGGAGGG + Intergenic
1052124564 9:24759272-24759294 AACATGGACAAGGGGGTAGGGGG - Intergenic
1052254351 9:26436839-26436861 AGGAATTGCCAGGTGGTAGGTGG - Intergenic
1054451904 9:65407768-65407790 ATGAATGGCTAGTGGGTAGGAGG - Intergenic
1054917816 9:70511811-70511833 AATAATGAACATGGGGTAAGAGG - Intergenic
1054963592 9:70997157-70997179 AAATGTGACAAGGGGGTAGGAGG - Intronic
1055720059 9:79163406-79163428 AAGAATCACTAGGAGGTAGGAGG - Intergenic
1057762483 9:97888083-97888105 AAGAGTGACAAGAGGGAAGGAGG - Intergenic
1058033904 9:100230047-100230069 AGGAATGAGCACGGCGTAGGGGG - Intronic
1060151090 9:121288863-121288885 AAGCATGACCCAGGGGTAAGAGG + Intronic
1060424413 9:123492760-123492782 AGGAATGACCAGGGAGTGAGAGG + Intronic
1061264614 9:129497763-129497785 AAGAATGACAAGGGGGTAGCGGG + Intergenic
1062673823 9:137728064-137728086 AGGAATGAGCAGGAGGGAGGAGG - Intronic
1185563267 X:1076944-1076966 AAGAATAAGAAGGGGGTATGGGG - Intergenic
1186514549 X:10156833-10156855 ACGAATGCTCCGGGGGTAGGAGG + Intergenic
1187690047 X:21857061-21857083 AACAATGACCAAGGGGCAGTGGG + Exonic
1189834001 X:45002862-45002884 AAGAATGAAAAGGGGGGGGGGGG - Intronic
1190050101 X:47143115-47143137 GAGAATGACTTGGGTGTAGGGGG - Intronic
1190753182 X:53380001-53380023 AAAAAGGGCCAGGAGGTAGGGGG + Exonic
1193145903 X:78075211-78075233 GAGAATGAAAAGGGGGAAGGGGG + Intronic
1193218306 X:78891585-78891607 TAGAATGATAAGGGGATAGGAGG + Intergenic
1195389665 X:104348334-104348356 AAGAAGGAGCAGGGCATAGGAGG + Intergenic
1195593863 X:106665541-106665563 AACTATGACCGGGGGGTTGGGGG - Intronic
1196046874 X:111265768-111265790 CAGAATGTCCAGGGACTAGGAGG - Intronic
1196755095 X:119150787-119150809 AGGAATGACCCGGGGGTGGGCGG - Intergenic
1199859912 X:151792136-151792158 AGGAATGACCAGGAGACAGGTGG + Intergenic
1202343889 Y:23900807-23900829 CAGCATTACCATGGGGTAGGAGG - Intergenic
1202526879 Y:25769277-25769299 CAGCATTACCATGGGGTAGGAGG + Intergenic