ID: 1103325150

View in Genome Browser
Species Human (GRCh38)
Location 12:120115553-120115575
Sequence TTGGAGTGTGGCAGGTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 320}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103325150_1103325160 30 Left 1103325150 12:120115553-120115575 CCTGCTCACCTGCCACACTCCAA 0: 1
1: 0
2: 0
3: 28
4: 320
Right 1103325160 12:120115606-120115628 AAACCAGTCTACCTTTTCGAAGG 0: 1
1: 0
2: 0
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103325150 Original CRISPR TTGGAGTGTGGCAGGTGAGC AGG (reversed) Intronic
901390871 1:8945286-8945308 TTGGAATGTGGCTCATGAGCTGG + Intergenic
901803654 1:11724263-11724285 GTGGAGTGGGGGAGCTGAGCAGG + Exonic
902078054 1:13803086-13803108 ATGGAGTGGGGAAGGTGGGCTGG + Intronic
902513985 1:16980278-16980300 TTGGAATGTGGCGGGTGGGGTGG - Intronic
904298647 1:29540213-29540235 GTGGAGTGTAGCAGGGTAGCTGG + Intergenic
905030740 1:34882848-34882870 GTGGAGTGGGGCAGGGGAGTGGG - Intronic
905380763 1:37559879-37559901 GAGGAATGTGGCAGGAGAGCAGG + Intronic
905789546 1:40783003-40783025 TGGGAGTGGGGCAGGGGAGCAGG + Intergenic
906316582 1:44790249-44790271 TTGGTCTGGGGCAGGTTAGCAGG - Intergenic
906524251 1:46485366-46485388 TTGGAGGGTGGGAGTGGAGCAGG + Intergenic
906546794 1:46625314-46625336 TGGGAGGTGGGCAGGTGAGCAGG - Intergenic
909051592 1:70774321-70774343 TTGGAGTGTTCGAGGTGACCAGG - Intergenic
909296486 1:73955580-73955602 TTGGATGGTGGCAGTTGAGAGGG + Intergenic
909972527 1:82007750-82007772 TTGGAGAGTGGAGGGGGAGCAGG - Intergenic
910732646 1:90414739-90414761 ATGCTGTGTGGCATGTGAGCAGG - Intergenic
912450944 1:109767389-109767411 AGGGAGTGTGGCAGGAGAACAGG - Intronic
913118117 1:115715048-115715070 CTGGAAGGTGGCAGGTGAGGTGG + Intronic
914863409 1:151405466-151405488 ATGGAGTCTGGCATGTTAGCAGG + Exonic
915170280 1:153972813-153972835 TTGGTGAGGGGCAGGTGAGAGGG - Exonic
915580465 1:156809848-156809870 TTGGGGTGGGGGAGGTGATCAGG + Intronic
915732622 1:158064982-158065004 TTGGGGGGTGGGAGGTGAGGAGG + Intronic
916016331 1:160753062-160753084 GTAGAGTGAGGGAGGTGAGCAGG - Intronic
916684790 1:167134643-167134665 TTGGGGTGGGGAAGCTGAGCCGG + Intergenic
917213687 1:172656744-172656766 GTGGAGAGTGGGATGTGAGCAGG + Intergenic
918024414 1:180728981-180729003 GTGGAGGGTGGCAGGAGAGTGGG - Intronic
918121657 1:181546010-181546032 TTGGGGTGCTGCAGGAGAGCGGG + Intronic
918809274 1:189094381-189094403 GTGGAGTTTGGCAGGGGAGACGG + Intergenic
918920521 1:190703905-190703927 TTGGACTGAGCCCGGTGAGCAGG + Intergenic
922193408 1:223339504-223339526 TGGGAGCATGGCAGGTGAGAAGG - Intronic
922681955 1:227606227-227606249 GGGGAGTGTGGCAGGAGAACGGG + Intronic
924300048 1:242627774-242627796 CTGGAGTTTTTCAGGTGAGCAGG - Intergenic
1063940028 10:11118945-11118967 TCGGAGACTGGCAGGGGAGCAGG - Intronic
1064252592 10:13718231-13718253 AGGGAGTGAGGCGGGTGAGCAGG + Intronic
1067410977 10:46064315-46064337 TGGTAGTGTGGCAGGTGGGAAGG - Intergenic
1067527485 10:47047286-47047308 CTGGAGTGTGGGTGGTGTGCGGG + Intergenic
1067834823 10:49632111-49632133 TGAGAGGGTGGCAGGGGAGCGGG + Intronic
1069030887 10:63595067-63595089 AAGGTGTGTGGGAGGTGAGCAGG - Intronic
1069908148 10:71744288-71744310 TTGGAGTGTGGGTGGGGAGTGGG - Intronic
1070148954 10:73793767-73793789 TTGGGGTGGGGCATGGGAGCAGG - Intronic
1070592429 10:77810631-77810653 CTGGAGTGTGGCAGGGGAGGTGG - Intronic
1071290600 10:84186036-84186058 TCCGAGTGGGGCAGGTGAGGCGG + Intergenic
1071343648 10:84670876-84670898 TGGGAGAGTGGCATGTGAGTTGG - Intergenic
1072265837 10:93727096-93727118 CTGGAGTGTGGCAGGGAACCAGG - Intergenic
1072407506 10:95168765-95168787 GAGGAGTGGGGCAGGGGAGCAGG + Intergenic
1073095834 10:100979158-100979180 GTGGAATGTGGCAGATGAGACGG - Exonic
1073224685 10:101907903-101907925 TTGAAGTGCGGCATGGGAGCTGG - Intronic
1073329558 10:102661418-102661440 TTGGGGTGGGGCAGGGCAGCTGG + Intergenic
1073591335 10:104760146-104760168 TTGGAGAATGGCAGCTGAGCAGG + Intronic
1073618136 10:105018874-105018896 TTGGAGTTTGGCAGATGATGTGG - Intronic
1074510820 10:114110382-114110404 CTAGAGTGTGGCTGGAGAGCAGG + Intergenic
1075068361 10:119304706-119304728 TTGGTGGATGGCTGGTGAGCAGG - Intronic
1075075097 10:119345282-119345304 TTGGGGTTTGGCAGGTCAGCAGG + Intronic
1076135563 10:128043460-128043482 GAGGTGAGTGGCAGGTGAGCAGG - Intronic
1076799515 10:132814102-132814124 TTGCAGTGTGGCAGGTCTGGGGG - Intronic
1077163381 11:1123858-1123880 TTGGGGTGTGGAAAGAGAGCAGG + Intergenic
1077324654 11:1958558-1958580 ATGGAGTGTGCCTGGTGCGCTGG - Intronic
1077703216 11:4460674-4460696 GAGGAATGTGGCAGGAGAGCAGG + Intergenic
1078907877 11:15704364-15704386 CTGGAGGGTGGGAGGGGAGCAGG - Intergenic
1079116624 11:17644184-17644206 TTGGTGGGTGCCAGGTGAGCGGG - Intronic
1079125194 11:17714051-17714073 TAGGAGTCTGGCAGCTGAGCTGG - Intergenic
1079481923 11:20890198-20890220 TGGGAGTGAAGCAGGTGAACAGG + Intronic
1081535835 11:43995672-43995694 GTGGACAGTGGTAGGTGAGCTGG + Intergenic
1081754150 11:45532695-45532717 TTGGAGTGTGGGTGTCGAGCTGG - Intergenic
1081883320 11:46472842-46472864 GTGGAGTTTGCCTGGTGAGCAGG - Intronic
1083258450 11:61510369-61510391 TTGGAGTGGGGCTGGTGCCCGGG + Exonic
1083557885 11:63646721-63646743 TTGGGATGTGGGATGTGAGCAGG - Intronic
1085118175 11:73948964-73948986 TTGCAGTGTGGCACTGGAGCTGG + Intergenic
1085266329 11:75240186-75240208 TTGGTGGGTGGGAGGGGAGCGGG + Intergenic
1085461744 11:76698217-76698239 TTGGCCTGTGGCAGGGGAGAAGG - Intergenic
1086858993 11:91902118-91902140 CTGGACTGAGGCAGGGGAGCAGG + Intergenic
1087002749 11:93437084-93437106 TTGGAGTTAGCCAGGTGAGAGGG - Intronic
1089454736 11:118619340-118619362 GAGGAGTGTGGCTGGGGAGCCGG + Intronic
1089693994 11:120205125-120205147 TTGGACTGGGGCAAGTGAGCAGG - Intergenic
1090128589 11:124116089-124116111 TAGGAGGGTGGGAGGGGAGCTGG - Intronic
1090258659 11:125303417-125303439 TGGGAATGTGGCAGGGGGGCTGG - Intronic
1090351553 11:126111463-126111485 CTGGAGTGAGACAGGAGAGCTGG - Intergenic
1090411710 11:126513733-126513755 TTGGAGTGCAGCAGGAGGGCAGG + Intronic
1090469710 11:126969362-126969384 CTGCAGTGTGGCAGGTGTGAAGG + Intronic
1090649826 11:128796654-128796676 TTGTGGCCTGGCAGGTGAGCAGG - Intronic
1202807633 11_KI270721v1_random:13735-13757 ATGGAGTGTGCCTGGTGCGCTGG - Intergenic
1092170573 12:6371512-6371534 TTGGAGCGTGGCGGGGGGGCGGG + Intronic
1092262289 12:6959199-6959221 TGTGTGTGTGGCGGGTGAGCAGG - Intronic
1092611221 12:10175160-10175182 TTGGAGTGTAGCAGAGGTGCTGG + Intronic
1092930559 12:13311557-13311579 TTGGTGTGTGGCAGAGCAGCAGG + Intergenic
1092997319 12:13962704-13962726 TTGGAGGCTGGCAGGCGGGCGGG + Intronic
1093761217 12:22913803-22913825 TGGGAGAGTGGAAGTTGAGCTGG - Intergenic
1094395065 12:29996681-29996703 TTGGACTTTGAGAGGTGAGCAGG - Intergenic
1094596184 12:31868825-31868847 TTGGGGTGGGGCAGGTGGGTTGG - Intergenic
1096626542 12:52899396-52899418 TTACAGTGTCGCAGGTGAGAAGG - Intronic
1097149876 12:56968803-56968825 AGGGAGTGTGGCAGGAGAACAGG + Intergenic
1102228513 12:111246427-111246449 TTGGAGGGTGGCCAGTGTGCTGG - Intronic
1102762220 12:115397958-115397980 TTGGCATGTGGCAGGTGCTCAGG - Intergenic
1103325150 12:120115553-120115575 TTGGAGTGTGGCAGGTGAGCAGG - Intronic
1103728837 12:123012816-123012838 TAGGAGTGGAGCTGGTGAGCGGG + Intronic
1103934022 12:124465927-124465949 GTGGACTGTGGCTGGTCAGCAGG - Intronic
1105213307 13:18270650-18270672 TCGGAGATTGGGAGGTGAGCGGG - Intergenic
1105867135 13:24471068-24471090 TTAGAGTGTGCCTGGTGAGGAGG + Intronic
1106910844 13:34461955-34461977 TTGGAGTGAGGCAGGGAAGGAGG - Intergenic
1107177110 13:37411627-37411649 TTGGAGTTTGGCAGGTGGGTGGG + Intergenic
1107408987 13:40141171-40141193 GTGGAGTGTGGCAGGTGCACAGG + Intergenic
1108795722 13:54027569-54027591 TTTGAGGGTGGCAGGTGGGAGGG + Intergenic
1110035119 13:70673093-70673115 TTGGAGTGTCTGAGGTGACCAGG - Intergenic
1111872365 13:93848879-93848901 TTTGAGTGAGGCAAGCGAGCTGG - Intronic
1112580952 13:100675508-100675530 TGGGAGTGTGGTGGGTGTGCCGG - Intergenic
1113712240 13:112474791-112474813 TTGGAGAGTTGCAGGAGAGTTGG - Intergenic
1113720558 13:112552948-112552970 TGGCAGTGTGGCTGGTGAGTAGG - Intronic
1113720611 13:112553216-112553238 CTGTAGTGTGGCTGGTGGGCAGG - Intronic
1113720624 13:112553286-112553308 TAGGAGGGTGGCTGGTGAGTAGG - Intronic
1113810516 13:113139511-113139533 CTGAAGAGTGGCAGGTGGGCGGG + Intronic
1113922073 13:113918795-113918817 TTGGAGGGTGGGCGGGGAGCAGG + Intergenic
1114042068 14:18688267-18688289 TGGGTGTGTGGCAGGAGAGTGGG - Intergenic
1115021004 14:28681897-28681919 GAGGTGAGTGGCAGGTGAGCAGG - Intergenic
1117716497 14:58586952-58586974 TTGGAGGGTGGGAGGTGTCCAGG - Intergenic
1118478555 14:66141520-66141542 TTGCAGTGTGGGAAGGGAGCAGG - Intergenic
1118750963 14:68807647-68807669 CTTGACTGTGGCAGGAGAGCTGG - Intergenic
1118989347 14:70783796-70783818 GTGTAGTCTGGGAGGTGAGCGGG - Intronic
1119026244 14:71155200-71155222 CTGGAGTGGGGCGGATGAGCTGG - Intergenic
1119211612 14:72836282-72836304 TGGGAGTTTGGCAGGAGAGAGGG - Intronic
1120855110 14:89205445-89205467 TGGGAGTGTGGCAGGCCAGAAGG - Intronic
1122413860 14:101539298-101539320 TGGGAGTGTGCAAGGTGGGCAGG + Intergenic
1124158664 15:27250163-27250185 GGGGAGTGTGGCAGGTGCACAGG - Intronic
1125132645 15:36301925-36301947 TTTGATTCTGGCAGGTGACCTGG + Intergenic
1127396386 15:58546935-58546957 TTGGAGTGGGGGAGGTGGGAGGG - Intronic
1127986546 15:64076835-64076857 TGGGAGTGTGGGAGCTGAGGTGG - Intronic
1128139461 15:65288058-65288080 TTGGAGTGGGTCAGGAGACCAGG + Intronic
1128637695 15:69313767-69313789 TGGGGGGGTGACAGGTGAGCAGG + Intronic
1128721560 15:69954291-69954313 TCTGTGTGTGACAGGTGAGCCGG - Intergenic
1129541495 15:76352380-76352402 TTTGAGTGTGTAAGGTGTGCTGG - Intronic
1132663214 16:1070667-1070689 CTGGGGTGTTCCAGGTGAGCTGG + Intergenic
1133230833 16:4365762-4365784 CTGGAGTGACGCAGGTGTGCAGG - Intronic
1133379339 16:5316833-5316855 GAGGAGATTGGCAGGTGAGCCGG + Intergenic
1133671805 16:8030060-8030082 TTGGAGGGTGGAAGGTGAGAGGG - Intergenic
1134198357 16:12176684-12176706 TTGGACTGTGGTATGTGAGGTGG + Intronic
1135049032 16:19177625-19177647 CTGGCATGTGGCAGATGAGCTGG + Intronic
1135064707 16:19299713-19299735 AGGGAGTGTGCCAGGAGAGCTGG - Intronic
1135948497 16:26888357-26888379 TTGGAGGGTGGGAGGGGAGTAGG + Intergenic
1135973019 16:27086020-27086042 GTGGAGGGTGGGAGGGGAGCAGG + Intergenic
1136670716 16:31854705-31854727 TGGGAGAGAGGCAGGTGAGGTGG - Intergenic
1137558223 16:49486513-49486535 TTGGGATTTGGCAGGTGAGGCGG - Intergenic
1137666377 16:50251994-50252016 TGGGACTGTGACAGGAGAGCAGG - Intronic
1137743981 16:50807477-50807499 TTCTAGAGTGGCAGGTGAGGGGG - Intergenic
1137811471 16:51356851-51356873 TTGGAGTGTGGAGGGTGAGAGGG + Intergenic
1140125109 16:72112117-72112139 TTGGAGTGGCGCACGTGAGGTGG + Intronic
1140249890 16:73286824-73286846 TCGGTGTGTGGCTGGTGAGTCGG + Intergenic
1140450219 16:75064698-75064720 ATGGAGTGGGGCAAGTGAGTAGG - Intronic
1140817793 16:78637036-78637058 TTGGTGTGCTGCAGATGAGCAGG - Intronic
1141623587 16:85249809-85249831 CTGCAGTTTGGCAGGTGGGCAGG + Intergenic
1141875423 16:86820793-86820815 GATGAGTATGGCAGGTGAGCTGG - Intergenic
1141966379 16:87447249-87447271 TTGCAGTCTGGCAGGTGTCCAGG - Intronic
1141992729 16:87619876-87619898 AGGGAGTGAGGCTGGTGAGCGGG + Intronic
1142352225 16:89585772-89585794 TTGAGGAGGGGCAGGTGAGCAGG + Exonic
1142604548 17:1074254-1074276 TCTGCGTGTGGCAGGTGTGCTGG - Intronic
1142650107 17:1343519-1343541 TTTAAGTGTAGCAGGTGTGCTGG + Intergenic
1142807467 17:2379057-2379079 TTGCTGTGTGGGAGGTGATCTGG + Exonic
1143568465 17:7739684-7739706 TTGGAGTTTGGAAGGAAAGCAGG + Intronic
1144223395 17:13120605-13120627 CTGGAGTTTGGCAGCTCAGCTGG + Intergenic
1144533010 17:16058523-16058545 CTGGGGTGGCGCAGGTGAGCTGG + Exonic
1144848074 17:18230381-18230403 ATGGAGGGTGGCAGGTGGGCTGG + Intronic
1145933645 17:28702776-28702798 TTGGAGGGGAGCAGGTGAGCAGG - Intergenic
1146759125 17:35460684-35460706 CTGGAGTGTGGCAGCCCAGCGGG - Intergenic
1147899219 17:43773052-43773074 CTGGAGTGGAGGAGGTGAGCAGG + Intronic
1148152315 17:45404171-45404193 ATAGAGAGTGGCAGCTGAGCAGG - Intronic
1150265523 17:63830189-63830211 TGTGAGTGTAGCAGGTGAGGTGG + Exonic
1151008961 17:70471908-70471930 TTGGAAAGTGGCAGGTAAGAAGG - Intergenic
1151010577 17:70489902-70489924 TGGAAGTGTGTCAGATGAGCTGG + Intergenic
1152106821 17:78335010-78335032 TCGGAGTTTGACAGGGGAGCAGG + Intergenic
1156403857 18:36765131-36765153 TTGGAGGGAGGAAGGTCAGCGGG + Intronic
1157825121 18:50805551-50805573 CTGGAGTGTGGCATGTGGGTGGG + Intronic
1157969365 18:52248544-52248566 TTGGAGGGTGGCAAGTGTGAAGG + Intergenic
1161276879 19:3423422-3423444 TTGGGGTCTGGCGGGTGGGCAGG + Intronic
1163167318 19:15507371-15507393 TTGGAGTGTGAGAGGTGTGGAGG - Intergenic
1165282877 19:34813390-34813412 GTGGAGTGTGGCATCTGGGCAGG + Intergenic
1166416048 19:42595616-42595638 TTGGGTTCTGGCAGCTGAGCTGG + Intronic
1166465449 19:43027162-43027184 ATGGGGTCTGGCAGCTGAGCTGG + Intronic
1166482720 19:43187182-43187204 CTGGGGTCTGGCAGCTGAGCTGG + Intronic
1167313982 19:48753228-48753250 TTTGAGTGTGGACGGTGAGGCGG - Intronic
1168076634 19:53983832-53983854 GGGTAGTGAGGCAGGTGAGCGGG + Exonic
1168529983 19:57119764-57119786 GTGGGGTGTGGTAGGTGGGCTGG - Intronic
925686119 2:6475743-6475765 TTTGGTGGTGGCAGGTGAGCTGG - Intergenic
926306393 2:11640086-11640108 CTGGGATGTGGCAGGTGTGCGGG - Intronic
927852927 2:26511164-26511186 TTGGAGGGGAGCAGGGGAGCAGG - Intronic
928173620 2:29019640-29019662 TTTATGTTTGGCAGGTGAGCGGG + Intronic
928462294 2:31485915-31485937 TTGGAGAGTCCAAGGTGAGCAGG - Intergenic
929128131 2:38539266-38539288 TTAAAGTGTGACAGGTGAGGGGG + Intergenic
929484274 2:42340500-42340522 CTGGACTCTGGCTGGTGAGCAGG - Intronic
929654551 2:43717457-43717479 TAGGAGTGTGGTAAGTGAGAGGG + Intronic
929983004 2:46698926-46698948 TTGGAGTCTGGCAGCTGCGACGG - Intergenic
930280192 2:49360695-49360717 TTGGGGTGGGGGAGGTGGGCAGG - Intergenic
930296273 2:49558360-49558382 TTGGAGGGTGGCAGGTGGCATGG - Intergenic
931776361 2:65544451-65544473 TTTGAGTGAGGCAGGTGAAGAGG - Intergenic
932816985 2:74869941-74869963 TTGAAGTGTGGCTGGTGTGACGG + Intronic
932838558 2:75060429-75060451 TTGGAGGTAGGCAGGTGAGTTGG + Intronic
934301016 2:91776094-91776116 TCGGAGATTGGGAGGTGAGCGGG + Intergenic
934650706 2:96089798-96089820 GTGGAGGGTGGAGGGTGAGCAGG + Intergenic
934893049 2:98087308-98087330 TGGGAGGGTGGCTGCTGAGCGGG + Exonic
937378026 2:121351166-121351188 ATGGAGAGTGGGAGGTCAGCAGG - Intronic
937391933 2:121496440-121496462 CTGGAGTGTTGCATATGAGCTGG - Intronic
943502185 2:188705950-188705972 TAGGAGAGTGGCAGGAGAACAGG + Intergenic
943942384 2:194014928-194014950 TGCTAGTGTGGCATGTGAGCTGG - Intergenic
944899335 2:204198441-204198463 TTGGACTGAGACAGGAGAGCAGG - Intergenic
945858344 2:215093228-215093250 TTGGAGTTTGGGAGATTAGCCGG - Intronic
946804139 2:223452937-223452959 TTGAAGGGTTGCAGGTTAGCAGG + Intergenic
947736211 2:232456749-232456771 ATGGAGTGTGGCAGGAGGGAGGG + Intronic
1170233549 20:14076675-14076697 TTGGGGGGTGGAAGGTGAGGGGG - Intronic
1171055326 20:21900926-21900948 TGGCATTGTGGCAGGTGAGTTGG + Intergenic
1171448824 20:25222413-25222435 TGGGAGCTTGGCAAGTGAGCTGG + Intronic
1172189843 20:33055313-33055335 TTGGGCTGTGCCAGGTGGGCAGG + Intergenic
1172840867 20:37902212-37902234 TGTGAGTGTGGCAGGGGAGGGGG - Intergenic
1173000510 20:39102136-39102158 CTGGAGTCTGGCTGTTGAGCAGG - Intergenic
1173195129 20:40907987-40908009 TTGGAGTGTAGGAGTTGAGCAGG - Intergenic
1173237056 20:41256172-41256194 TTTGAGTGAGGTAGGTGTGCTGG + Intronic
1174541676 20:51294615-51294637 GTTGAGTGAGGCAGGTGAGTGGG - Intergenic
1176977146 21:15335018-15335040 TTGGAGTGTGCAAGGTGACTGGG - Intergenic
1177230541 21:18314709-18314731 TTGAGGTGTGGAAGGGGAGCTGG + Intronic
1180094393 21:45549295-45549317 CTGGAAGGAGGCAGGTGAGCAGG + Intergenic
1180221797 21:46363982-46364004 TTGGAGGGTAGAAGGTGGGCAGG + Intronic
1180816134 22:18791050-18791072 TTGGAGATTGGGAGGTGAGCGGG - Intergenic
1181202321 22:21225382-21225404 TTGGAGATTGGGAGGTGAGCGGG - Exonic
1181555684 22:23670529-23670551 TTGGAGATTGGGAGATGAGCAGG - Intergenic
1182030719 22:27157364-27157386 TTTGCAAGTGGCAGGTGAGCAGG + Intergenic
1182258685 22:29056651-29056673 TTGGGGTGTGGCAGTTGGGCAGG + Exonic
1183265778 22:36824214-36824236 CTGGAGTGTGAAAGGGGAGCAGG + Intergenic
1184955816 22:47885324-47885346 CTGGAGTGTTCCAGGTGGGCAGG - Intergenic
1185367027 22:50441454-50441476 TTTAAGTCTGGCAGGCGAGCGGG + Intronic
1203224589 22_KI270731v1_random:70031-70053 TTGGAGATTGGGAGGTGAGCGGG + Intergenic
1203266237 22_KI270734v1_random:16761-16783 TTGGAGATTGGGAGGTGAGCGGG - Intergenic
950092212 3:10304071-10304093 ATGTGGTGTGGCATGTGAGCTGG - Exonic
950188624 3:10960824-10960846 GTGGAGTGTGGCAGGGGAGGGGG + Intergenic
950672700 3:14536710-14536732 TTAGAGTAGGGCAGGAGAGCAGG - Intronic
951905989 3:27708076-27708098 TTGGAGGGTGATAGGTGGGCTGG + Intergenic
953103291 3:39851418-39851440 TGGGAGTGGGGCAAGGGAGCAGG - Intronic
953922366 3:46960976-46960998 GTGGAGTGTTGGAGGTGTGCAGG + Intronic
954576965 3:51681665-51681687 TGGGGGTGTGGCGGGTGAGGAGG + Intronic
955584303 3:60459871-60459893 TTGGGGTTGGGGAGGTGAGCAGG + Intronic
958782543 3:98560095-98560117 TTGGGGTGTGTCATGGGAGCAGG + Intronic
960203587 3:114867720-114867742 TTGGATTGGGGCAGGTGCGGTGG - Intronic
961765150 3:129204689-129204711 TTGGAGTGTAGCCCGTGGGCAGG - Intergenic
962626931 3:137235097-137235119 TGTGTGTGTGGCAGGTGAGCTGG + Intergenic
965541690 3:169877801-169877823 TGGGGATGTGGGAGGTGAGCTGG - Intergenic
967171404 3:186825825-186825847 TTGGCCTGTGGCAGGGCAGCTGG - Intergenic
967971361 3:195002000-195002022 TGGGAATGTGGCAGGAGGGCTGG - Intergenic
969644860 4:8421888-8421910 TTGCAGTGGGGGAGGTAAGCTGG - Intronic
970434273 4:16018314-16018336 CTGAACTGAGGCAGGTGAGCAGG - Exonic
970600157 4:17635771-17635793 CAGAAGTGAGGCAGGTGAGCAGG + Intronic
973655848 4:53047123-53047145 TTTGAGAATGGCAGGGGAGCAGG - Intronic
973988117 4:56375719-56375741 TAAGAGTGTGGGAGGTGAGGTGG - Intronic
975868728 4:78753877-78753899 TTGCAGTGTGGCAGGGGCGGGGG + Intergenic
978751952 4:112259744-112259766 CTGGAGTGGGGCAGGAGAGATGG + Intronic
978754178 4:112285493-112285515 TGAGCGTGTGCCAGGTGAGCAGG + Intronic
979044964 4:115851626-115851648 TTGGAGTGTCCAAGGTGACCAGG + Intergenic
981582243 4:146261361-146261383 TTGGAGAGAGGCAGCAGAGCAGG - Intronic
981926966 4:150151043-150151065 CTGGGATGTGGCAGGAGAGCTGG - Intronic
982355443 4:154462054-154462076 TGGGAGTGGGGCGGGTGAGGTGG - Intronic
984509529 4:180661637-180661659 TTTCAGTGTGGAGGGTGAGCAGG - Intergenic
984653847 4:182296545-182296567 GTGGAGTTTGTCAGATGAGCTGG + Intronic
984881345 4:184412447-184412469 TTGGAAGGTGGGAGGTGGGCTGG - Intronic
985022879 4:185710777-185710799 ATGCAGCGTGGGAGGTGAGCGGG + Intronic
985029245 4:185772358-185772380 TTGGAGTATATCAGTTGAGCAGG + Intronic
985544398 5:501883-501905 TTGGCGTGGGACAGGGGAGCCGG + Intronic
985684615 5:1275499-1275521 GTGGTGTGTGGCCGGTGGGCAGG - Intronic
987332611 5:16870446-16870468 TTGGGGTGGGGCTGGAGAGCGGG - Intronic
988865503 5:35330322-35330344 ATGGAGGGTGGCAGGAGAGAAGG + Intergenic
990664731 5:58059484-58059506 TGGGAGTGTGGAAAGTGACCGGG + Intergenic
990760837 5:59127618-59127640 CTGGAGTGTGGGGGGTGAGGTGG - Intronic
991650417 5:68847093-68847115 TTGGTGTGTTCCAAGTGAGCAGG + Intergenic
993351355 5:86853727-86853749 TTGGAGTGTCTGAGGTGACCAGG - Intergenic
995145722 5:108785520-108785542 TGTGAGTGTGGCAGGTGACATGG + Intronic
995204812 5:109467542-109467564 TGAGAGTGTGTCAGGTGAGAAGG + Intergenic
998029174 5:138849587-138849609 TTGAAGTGAGGCACGTGCGCTGG + Intronic
999089304 5:148921356-148921378 TTGGAATGTGGAAGGAGAGAAGG + Intergenic
999624067 5:153501703-153501725 ATGGAGTCTGGCAGATGGGCAGG + Intronic
1000133618 5:158323237-158323259 ATGGAGGGTGACAGGTGAGGAGG + Intergenic
1001143927 5:169167783-169167805 TTGCTGGGTGGCAGGTGGGCGGG - Intronic
1001148670 5:169207142-169207164 TGGGAGTGAGCGAGGTGAGCGGG - Intronic
1001920830 5:175597989-175598011 CTGGAGTGCTGCAGGGGAGCAGG + Intergenic
1002075417 5:176705540-176705562 CTGGGGCGTGGCAGGTGAGGTGG + Intergenic
1002101654 5:176860886-176860908 CCGGAGTCTGGCAGGTGGGCAGG + Intronic
1003069233 6:2931610-2931632 TTGGAATATGGCATGTCAGCAGG + Intergenic
1003109737 6:3243526-3243548 TTGGAGTGTGGTAGGTTGGGAGG + Intronic
1003140493 6:3467587-3467609 TGGGAGTGTGCCAGGTGCGATGG + Intergenic
1006630102 6:35424785-35424807 TGAGAGTGGGGCAGGTGGGCTGG + Intronic
1007184813 6:39960568-39960590 GTGGAGTGTGGGAGGAGAGAGGG - Intergenic
1008682088 6:53883452-53883474 TTGGAGAGTGGGAGTGGAGCTGG + Intronic
1011029753 6:82909043-82909065 AGGGAGTGTGGCAAGTGTGCAGG + Intronic
1011766084 6:90621781-90621803 ATGCAGTGAGCCAGGTGAGCAGG + Intergenic
1012191733 6:96287909-96287931 CTGGAGTGTGGCAGCTCAGCTGG + Intergenic
1013628082 6:111957457-111957479 TTGCAGTGTGACAGGTGCCCGGG + Intergenic
1017400269 6:154053321-154053343 GTGCAGGGTGGCAGGTGTGCAGG - Intronic
1018647770 6:165963867-165963889 TCAGAGTTTGGCAGGTGAGACGG - Intronic
1018771011 6:166971461-166971483 TGGGTGTGTGGCAGGTGTCCGGG - Intergenic
1019303094 7:318897-318919 TTGAAGGGAGGCAGGTGAGGTGG - Intergenic
1019525239 7:1477744-1477766 GCGGACGGTGGCAGGTGAGCTGG - Exonic
1019566099 7:1679753-1679775 TTGGAGTGTGGCCAGGGGGCAGG - Intergenic
1022763945 7:33389262-33389284 ATGGAGTGGGGCAGGGGAGAAGG - Intronic
1024053562 7:45645564-45645586 CTGGAGTGGGACAGGTGTGCAGG - Intronic
1025757049 7:64353737-64353759 TAGGAGTGTGGTAAGTGATCAGG + Exonic
1025932218 7:66004888-66004910 GAGGAATGTGGCAGGAGAGCAGG + Intergenic
1028082843 7:86599622-86599644 TTGGAGTGTCTGAGGTGACCAGG + Intergenic
1029711470 7:102302342-102302364 CTGGAGTCTGGCAGCTGAGCTGG - Intronic
1030346972 7:108444983-108445005 ATGCAGTGTGGCTTGTGAGCAGG - Intronic
1030358108 7:108565763-108565785 TTTCAGGGTGGCAGGTGATCAGG - Intronic
1030514361 7:110521501-110521523 TGGGAGTTTGGCATGTGAACGGG - Intergenic
1032349712 7:131149224-131149246 TTTGATGGTGGCAGGAGAGCTGG + Intronic
1032483891 7:132268539-132268561 TTGGAGTGTGGCTGGCGGGAGGG + Intronic
1033635260 7:143206150-143206172 TTGGGCTGTGGCAGGAAAGCAGG - Intergenic
1035518069 8:253552-253574 AAGGAATGTGGCAGGAGAGCAGG - Intergenic
1035794727 8:2344327-2344349 ATGGAGTGTCGCAGGTGTTCTGG + Intergenic
1036388911 8:8307605-8307627 TGGGGGTGCGGCAGGTGGGCAGG + Intergenic
1037767710 8:21782272-21782294 GTGGGGTGGGGGAGGTGAGCAGG - Intronic
1038664267 8:29524026-29524048 TTAGGCTGTGACAGGTGAGCAGG + Intergenic
1039495400 8:37976409-37976431 TTGGTGAGGGGCAGGTGAGCTGG - Intergenic
1040556030 8:48478189-48478211 ACTGAGTGGGGCAGGTGAGCCGG - Intergenic
1042955420 8:74244918-74244940 AAGGAGTGTGGCTGATGAGCAGG - Exonic
1043191179 8:77225120-77225142 TTGGAGTGTCCGAGGTGACCAGG - Intergenic
1045127944 8:99114595-99114617 AATGAGTGTGGGAGGTGAGCAGG - Intronic
1049056371 8:140240453-140240475 CAGGAGTGTGCCAGGTGAGCTGG - Intronic
1049355235 8:142184440-142184462 GAGAAGTGTGGCAGGTGGGCGGG - Intergenic
1049555502 8:143279392-143279414 TTGGAGATTGGCCGTTGAGCTGG - Intergenic
1049734869 8:144199566-144199588 TGGGAGGCTGGCAGGTGACCAGG - Intronic
1050896273 9:10888249-10888271 TTGGGGTTTGGGAGGTTAGCCGG - Intergenic
1051668994 9:19491816-19491838 TTGAAATGTTGCAGGTGACCAGG - Intergenic
1052966860 9:34346932-34346954 TTAGGATGTGGCAGGTGAGTAGG + Intergenic
1053078322 9:35153748-35153770 TTGGAGTTTGGGAGATTAGCTGG + Intergenic
1053382923 9:37663551-37663573 ATGGAGTGTGGCAGTGGAGAGGG - Intronic
1055755795 9:79555960-79555982 TAGGAGTGTGCTAGGTGAACAGG - Intergenic
1056248538 9:84723640-84723662 CTGTAGTGTGGCAGGTGATCCGG + Exonic
1056287585 9:85107349-85107371 TTGGAGTGTAGCAGGAGGGCTGG + Intergenic
1056992681 9:91425085-91425107 ACGGAGTGTGGCAGGTGGGCAGG + Intergenic
1057038962 9:91833665-91833687 TTGGAGGCTGGCAGGAGTGCAGG - Intronic
1057596751 9:96421081-96421103 TGGGAGTGTAGCAGTTGAGGAGG - Intergenic
1057604373 9:96488690-96488712 ACGGTGTGAGGCAGGTGAGCCGG - Intronic
1060084497 9:120684518-120684540 GTGAAGTGTGGCAGGAGAGTGGG - Intronic
1060256555 9:122035891-122035913 TTAGAGGGCGTCAGGTGAGCAGG - Intronic
1060590100 9:124811048-124811070 TTGGAATGTGGCCGGACAGCGGG - Exonic
1061799865 9:133107860-133107882 TTGGTGTGTAGCAGCAGAGCTGG + Intronic
1062043428 9:134414542-134414564 TTGGGCTGTGGCAGGCTAGCAGG + Intronic
1062296133 9:135828162-135828184 TGGGAGAGAGGCGGGTGAGCAGG - Intronic
1186272866 X:7908541-7908563 TTAGAATGTGGGAGGTGATCAGG + Intronic
1187817716 X:23250929-23250951 TTGCAGTGTGGCTTTTGAGCAGG - Intergenic
1188734802 X:33699928-33699950 TTGAAGTGTGGCAGGGAAGAAGG - Intergenic
1193654453 X:84182830-84182852 CTGGAATGTGGAAGGAGAGCAGG - Intronic
1197970145 X:132106875-132106897 GTGGAGTGTGGCAGGAGGGAGGG + Intronic
1198691303 X:139287737-139287759 TAGGGGTGGGGCGGGTGAGCTGG + Intergenic
1199332727 X:146581421-146581443 CTGGAGTGTGGCAAGTTCGCTGG - Intergenic
1199852957 X:151738379-151738401 TGGGAGAGTGGCAAGTGAACAGG - Intergenic
1200227591 X:154427584-154427606 TAGGATAGTGGCAGTTGAGCTGG - Intergenic
1200645379 Y:5776552-5776574 TTTGGGTGTGGGAGGTGACCAGG + Intergenic
1200860438 Y:7986237-7986259 TGGGAGTGTGGTAAGTGATCAGG - Intergenic
1200905888 Y:8481795-8481817 TAGGAGTGTGGTAAGTGATCAGG + Intergenic