ID: 1103325599

View in Genome Browser
Species Human (GRCh38)
Location 12:120117684-120117706
Sequence GTTTCAGGTCAGTTTAGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103325599_1103325609 25 Left 1103325599 12:120117684-120117706 CCCTACCTAAACTGACCTGAAAC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1103325609 12:120117732-120117754 TCCTCACTGCAGAACTGCAGAGG 0: 1
1: 0
2: 4
3: 35
4: 257
1103325599_1103325611 26 Left 1103325599 12:120117684-120117706 CCCTACCTAAACTGACCTGAAAC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1103325611 12:120117733-120117755 CCTCACTGCAGAACTGCAGAGGG 0: 1
1: 0
2: 5
3: 25
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103325599 Original CRISPR GTTTCAGGTCAGTTTAGGTA GGG (reversed) Intergenic
902714767 1:18265117-18265139 ATTTCAAGTCAGTTCAGGTCAGG - Intronic
903038159 1:20508117-20508139 GTTTCCGGTCAGGTTAGGCCGGG - Exonic
904798264 1:33073840-33073862 GCTTCAGGTCTGTTTAGGTTAGG + Intronic
906827679 1:48999079-48999101 GTTCCTTGTCAGTTCAGGTATGG + Intronic
920720029 1:208378717-208378739 GTTTCTGGTCAGTTGGGCTAGGG + Intergenic
1065065976 10:21965349-21965371 GTTTCAGGAAAGCTGAGGTAAGG - Intronic
1065071518 10:22029420-22029442 GTTTCAGCTCAATTCAGATAAGG + Intergenic
1066672535 10:37855738-37855760 GATTCAGGTGAGTTTAGGTGAGG + Intronic
1069608830 10:69758653-69758675 GCTTCATGTCAGTTTAGCTCAGG - Intergenic
1071686251 10:87760803-87760825 ATTTCAGGTCAGTTTGTATAGGG + Intronic
1073799292 10:107023944-107023966 GGTTCAGGTCATTTGAGGTCAGG + Intronic
1077597127 11:3543401-3543423 GTTTCAGGTCAGTAGAGTCAGGG + Intergenic
1077658174 11:4042314-4042336 GTATTAGGTCAGATTAGGGAAGG - Intronic
1080077090 11:28162359-28162381 GTTTCAGAGCAGTTTAGAAAAGG + Intronic
1082804683 11:57440212-57440234 GTTTCAGGTCACTTTAGTAAAGG - Intergenic
1083032739 11:59608791-59608813 GTTTCTGGACAGAGTAGGTAGGG - Intronic
1088252600 11:107874111-107874133 GTATCAGGTCAGGTCAGGTATGG - Intronic
1091351494 11:134901158-134901180 GTTGCCGGACAGTCTAGGTACGG + Intergenic
1093249101 12:16778371-16778393 GTGTCAGGTCACTTAAGGTTTGG + Intergenic
1095620510 12:44248369-44248391 GTTTATGTTCAGTTTAGATAAGG + Intronic
1100631353 12:96392683-96392705 ATTCGAGTTCAGTTTAGGTAAGG + Intronic
1101396098 12:104349096-104349118 TTTTAAGGTCTGTTTAGGAAGGG + Exonic
1103325599 12:120117684-120117706 GTTTCAGGTCAGTTTAGGTAGGG - Intergenic
1105258760 13:18763158-18763180 ATTACATGTGAGTTTAGGTAGGG + Intergenic
1105261430 13:18782461-18782483 ATTACATGTGAGTTTAGGTAGGG + Intergenic
1105263777 13:18799039-18799061 ATTACATGTGAGTTTAGGTAGGG + Intergenic
1106949202 13:34864005-34864027 GTCTCAGGCCATTTTAGGAATGG - Intergenic
1108291014 13:48961149-48961171 GTTTTAAGTAAGTTTAGGGATGG + Intergenic
1111894387 13:94122550-94122572 GTTACAGGGCAGTTTTGGCATGG + Intronic
1114179078 14:20349958-20349980 AAGTCAGGTCAGGTTAGGTATGG + Intronic
1116786135 14:49290737-49290759 GTTTCAGTTGAGCTTAGGTGAGG - Intergenic
1117092238 14:52262748-52262770 GTTTCCAGTCAGGTTAGTTAAGG + Intergenic
1117956519 14:61127657-61127679 GAGTCAGATCAGCTTAGGTAAGG + Intergenic
1119930662 14:78542998-78543020 GCTTGAGGTCACTTTAGGTGGGG + Intronic
1202834665 14_GL000009v2_random:68978-69000 ATTACATGTGAGTTTAGGTAGGG - Intergenic
1124907099 15:33880187-33880209 TTTTCAGGTCTTTTTGGGTAGGG - Intronic
1126591973 15:50349119-50349141 GCTTCATATCAGTTTGGGTAAGG - Intronic
1130397308 15:83513927-83513949 GTTTCAATTCACTTTAGGTTAGG + Intronic
1134819497 16:17235130-17235152 GTTCCAGTTCAGTTTGGGAATGG + Intronic
1139568675 16:67796679-67796701 GTTTCAGGGGAGTTTAGTTTAGG - Intronic
1140880284 16:79192002-79192024 ATTCCTGGTCAGTTTATGTAAGG - Intronic
1142544603 17:691288-691310 GTTTCAGTTCAGTCTAAGAAAGG + Intronic
1154424593 18:14262348-14262370 ATTACATGTGAGTTTAGGTAGGG - Intergenic
1154427272 18:14281698-14281720 ATTACATGTGAGTTTAGGTAGGG - Intergenic
1154429997 18:14301233-14301255 ATTACATGTGAGTTTAGGTAGGG - Intergenic
1154432288 18:14317573-14317595 ATTACATGTGAGTTTAGGTAGGG - Intergenic
1156352959 18:36316591-36316613 GTTTCCGATCAGTTTATTTAGGG + Intronic
1159396962 18:67871835-67871857 GTCTCAGCTGAATTTAGGTAAGG - Intergenic
1162553036 19:11368728-11368750 ATCTCAGGTCAGTTCAGGTTAGG - Intergenic
1163332203 19:16646989-16647011 GTTTCAGGAGCGTTTATGTAAGG - Exonic
1164037970 19:21470380-21470402 TTGTCAGGTCAGTCGAGGTAAGG + Intronic
1202638035 1_KI270706v1_random:58715-58737 ATTACATGTGAGTTTAGGTAGGG + Intergenic
927625159 2:24708430-24708452 GTTTCAGGTCATGTTACATAAGG - Intronic
927707399 2:25304909-25304931 CTTTCAGCTCAGTCTAGGCAGGG - Intronic
929099495 2:38296781-38296803 TTTTCAGTATAGTTTAGGTAAGG - Intronic
930667971 2:54118112-54118134 GTCTCAGGTCAGTTTTAGGAAGG + Intronic
931859131 2:66335299-66335321 CTTTCAGGTCAGTTACGATAGGG - Intergenic
932863677 2:75319821-75319843 TTTTCAGGACATTTTATGTATGG - Intergenic
935879643 2:107551191-107551213 TTTTTAAGTCAGTTTAAGTAAGG - Intergenic
945714433 2:213339983-213340005 GTATAAGGTCATATTAGGTATGG - Intronic
947463490 2:230322680-230322702 GATTCTGGTCAGTTTTGGTCAGG - Intergenic
1169482019 20:5991442-5991464 GTTTCAGATCAGTTTACATCTGG + Intronic
1171185345 20:23120650-23120672 GTCTCAGGTCAGCTTTGGGATGG + Intergenic
1171884605 20:30642776-30642798 ATTACATGTGAGTTTAGGTAGGG + Intergenic
1176844752 21:13868178-13868200 ATTACATGTGAGTTTAGGTAGGG + Intergenic
1176847492 21:13887742-13887764 ATTACATGTGAGTTTAGGTAGGG + Intergenic
1178542001 21:33459976-33459998 GCTCCATGTCAGTTTAGGTCAGG + Intronic
1180363934 22:11923164-11923186 ATTACATGTGAGTTTAGGTAGGG - Intergenic
950429948 3:12944949-12944971 GTTTCAGGCCAGGTTAGAAAGGG - Intronic
951795483 3:26533844-26533866 GTTTGAGCTCAGTTTGGGGAGGG - Intergenic
953154186 3:40353959-40353981 GTTTCCTGACAGATTAGGTATGG - Intergenic
955521661 3:59781164-59781186 GTTACAGGTCATTCTAGGTCAGG - Intronic
955944222 3:64176657-64176679 GTTTCAAGTCAGTTCATTTAAGG + Intronic
957273219 3:78057775-78057797 GTTTCAGGAAATTTTAGGTGAGG + Intergenic
964635178 3:158850574-158850596 GTTTCAGGACAGTATAAGTTTGG + Intergenic
964880200 3:161415126-161415148 GTTTCAGGGAAGTTTAAGTAAGG + Intergenic
965364084 3:167777089-167777111 CTGTCAGGTCAGTTTAAGTAGGG + Intronic
967803665 3:193693143-193693165 GGTTCAGGTCAGTTCAGAAAAGG + Intronic
969324426 4:6432718-6432740 GTTTCACATCAATTTAGGTTGGG + Intronic
973368255 4:49225062-49225084 ATTACATGTGAGTTTAGGTAGGG + Intergenic
973392790 4:49570363-49570385 ATTACATGTGAGTTTAGGTAGGG - Intergenic
973572769 4:52257378-52257400 ATTTCAGTTCAGTTTAGGGGAGG + Intergenic
977786658 4:101042948-101042970 TTCACAGGTCAGTTGAGGTAGGG - Intronic
978079865 4:104579014-104579036 GTTTCAGTTTAGTTTTGGTTTGG - Intergenic
980240371 4:130165796-130165818 GTTTCACCAAAGTTTAGGTAAGG - Intergenic
980791660 4:137628684-137628706 CTTTCATGACAGTTCAGGTAAGG - Intergenic
983274609 4:165602287-165602309 TTGCTAGGTCAGTTTAGGTAGGG + Intergenic
983429748 4:167633495-167633517 GTTACATATCAGTTTAGGGAGGG - Intergenic
983839088 4:172433592-172433614 GTTTCAGGCCAGGTGAGGCATGG - Intronic
983929457 4:173436998-173437020 GTTTCTGGTTATTTTGGGTATGG - Intergenic
1202765358 4_GL000008v2_random:144572-144594 ATTACATGTGAGTTTAGGTAGGG + Intergenic
987596796 5:20011719-20011741 GTTTCAGTTCTGTTTATGTGAGG + Intronic
989250145 5:39304147-39304169 GTTACAGGTCATTTTGGTTAAGG + Intronic
990443893 5:55874984-55875006 GTTTGATGTTAGTTTAGCTATGG + Intronic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
994063531 5:95508594-95508616 ATTTCAGGTGAGTTTAAGAATGG - Intronic
995741752 5:115363356-115363378 GTTTCCAGTGAGTTCAGGTAAGG + Intergenic
996744839 5:126838593-126838615 TTTTCACCTCTGTTTAGGTATGG + Intergenic
999827466 5:155287889-155287911 GTTTGAGGTCAATGTAGGTTTGG - Intergenic
1005356281 6:24986626-24986648 GTTTCAGGTGAGGTCAGGAAAGG - Intronic
1009855157 6:69253384-69253406 TCTTCAGGTTAATTTAGGTAGGG + Intronic
1014989504 6:128056398-128056420 ATTTCAGGTATGTTCAGGTATGG - Intronic
1015831060 6:137369404-137369426 GTTTCAGCTAAGTTTTGGCAGGG + Intergenic
1017038455 6:150288169-150288191 GTATCAGGTCAGATCAGGTCTGG + Intergenic
1018462090 6:164008021-164008043 GTGTCAGGGTATTTTAGGTAAGG - Intergenic
1021075762 7:16302620-16302642 ATTTCAGCTGAGTTTAGGCATGG - Intronic
1022196395 7:28071412-28071434 TTTTCAGGGCAGTTGAGGCAGGG - Intronic
1023537184 7:41225841-41225863 GTTTCTGGTCACTTGAGGTCAGG - Intergenic
1023542306 7:41278862-41278884 GTCTCACGTCAGTTCAGGTAAGG + Intergenic
1023744854 7:43313814-43313836 GTTACAGGCCAGTCTAGGGAGGG - Intronic
1030502462 7:110376825-110376847 GTTAGAGGTCAGATTATGTAGGG + Intergenic
1032986452 7:137343230-137343252 GTTTCAGGTTAGGTTAGTTCGGG - Intronic
1033304247 7:140212801-140212823 GCTCCAGGTCAGTTTAGCAATGG + Intergenic
1033415096 7:141155042-141155064 TTTTCAGCTCAGGTTAGGAAAGG + Intronic
1039587813 8:38721189-38721211 ACTTCAGGTCAGTTGAGGTCAGG + Intergenic
1039809776 8:41036331-41036353 GTTTCACGTCAGTAGAGGCAAGG + Intergenic
1045078505 8:98598083-98598105 GTTTGAGGTCAGTCTATATAGGG - Intronic
1045970238 8:108071875-108071897 TTTTAATGTCTGTTTAGGTATGG + Intronic
1046207747 8:111024113-111024135 CTTTGAGGTCAGTTTAGAGATGG - Intergenic
1061426020 9:130498959-130498981 GTTTCAGGATGGATTAGGTAAGG + Intronic
1203546106 Un_KI270743v1:129461-129483 ATTACATGTGAGTTTAGGTAGGG + Intergenic
1186821824 X:13296603-13296625 GTTTCATCACAGTTTAGATATGG - Intergenic
1190617431 X:52250397-52250419 GTTCCAGGTCACTGGAGGTAGGG + Intergenic
1199263121 X:145798608-145798630 GATTCAGGTGAGTTTAGAGATGG + Intergenic
1199908091 X:152256025-152256047 GTTTCAGTTGAGTTCTGGTAAGG + Intronic