ID: 1103326459

View in Genome Browser
Species Human (GRCh38)
Location 12:120124609-120124631
Sequence ATTTGACAGTTTTGGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103326459_1103326469 26 Left 1103326459 12:120124609-120124631 CCCTGCACCCAAAACTGTCAAAT 0: 1
1: 0
2: 2
3: 21
4: 214
Right 1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103326459 Original CRISPR ATTTGACAGTTTTGGGTGCA GGG (reversed) Intergenic
903678496 1:25081806-25081828 ACCTGACAGTTTTGGAAGCAGGG + Intergenic
904655444 1:32042329-32042351 ATTTTTCAGTTTTGAGTGGAAGG - Intronic
906855151 1:49296392-49296414 ATTTGAGAGTTTGGGGTAGAGGG - Intronic
907710174 1:56873450-56873472 ATTAGACAGACTTGGGTTCAGGG - Intronic
909207763 1:72781173-72781195 ATTTGATAGTTTTATGAGCAGGG - Intergenic
910417877 1:87020613-87020635 ATCTGACAGTTTTGGAGGCTAGG + Intronic
914699246 1:150116216-150116238 GTTTGACATTTTAGGATGCATGG - Intronic
915672393 1:157500948-157500970 ATTTGACATGTTTAGGTACATGG + Intergenic
916331896 1:163626728-163626750 ACTTGACACTTTGGGCTGCAAGG + Intergenic
916826980 1:168451798-168451820 ATTTCACATTTTTGGGTGGGAGG + Intergenic
917077082 1:171216879-171216901 ATTTGACATGTTTAGGTACATGG - Intergenic
918672833 1:187241467-187241489 ATTTGACAGTTTTTAGTTTATGG - Intergenic
918704489 1:187643093-187643115 ATTTGACATGTTTAGGTACATGG + Intergenic
919322140 1:196057047-196057069 ATTTGACAGGTTTGCATGCATGG + Intergenic
921069506 1:211647475-211647497 ATTTGACAGTGTTGAGTTCTCGG + Intergenic
922071183 1:222195067-222195089 ATGTGAAAGTTTTGGATGAATGG - Intergenic
922906364 1:229176403-229176425 TTTTGACATTTTAGGGTCCAGGG - Intergenic
923412972 1:233728280-233728302 ATTTGACATGTTTAGGTACATGG - Intergenic
923607466 1:235457386-235457408 GTTTGAAAGTTTTGGCTCCATGG + Intronic
923914173 1:238484096-238484118 ATTTGACATGTTTAGGTACATGG - Intergenic
1064143193 10:12807234-12807256 TGTTGGCAGTTCTGGGTGCATGG + Intronic
1064286940 10:13999727-13999749 AATTAACACCTTTGGGTGCATGG - Intronic
1064811690 10:19207249-19207271 ATTTGACAGTCTTTGGAGGAAGG - Intronic
1067891695 10:50142929-50142951 ATTTGAGAGTGTTGGTTACAGGG + Intergenic
1069197616 10:65572098-65572120 ATTTGACATGTTTAGGTACATGG + Intergenic
1070083352 10:73210362-73210384 GTTTGACAGTGTATGGTGCAAGG + Exonic
1070097953 10:73356646-73356668 ATTTGACACTTTTAGGTGACTGG - Intronic
1071977947 10:90974120-90974142 ATTTGGCAGTTTTCAGTGCCTGG - Intergenic
1072256037 10:93621160-93621182 ATTGGAGAGCTTGGGGTGCAGGG - Intronic
1072622160 10:97087272-97087294 TTGTGACAGTGTTGGGTGGAAGG + Intronic
1073574412 10:104610122-104610144 ATTTGACATGTTTAGGTACATGG + Intergenic
1074391887 10:113064906-113064928 AATTGACAAGTTTAGGTGCAAGG - Intronic
1076689161 10:132212126-132212148 ATTTGACTGTTCTGGGTCCCTGG - Intronic
1078895821 11:15596242-15596264 ATTGTCCAGTTTTGGGTGGAAGG + Intergenic
1082656117 11:55858863-55858885 ATTTGACATGTTTAGGTACATGG + Intergenic
1083427038 11:62593584-62593606 CTTGGACAGTTTTGGGGGGAGGG - Exonic
1084519175 11:69652949-69652971 ATTGGACAGGCATGGGTGCAAGG + Exonic
1084955330 11:72688348-72688370 ATTTGACAGAGATAGGTGCAGGG - Intronic
1086342838 11:85864858-85864880 CTTAGAAAGTTTTGGGTGGAGGG + Intronic
1087486026 11:98760607-98760629 ATTTGACATGTTTAGGTACATGG + Intergenic
1089393641 11:118118949-118118971 CTTTGACCATTTTGAGTGCAGGG - Exonic
1089533664 11:119148344-119148366 ATTTGAAGGCTTTGGGGGCAAGG + Intergenic
1090689451 11:129162851-129162873 ATTTGATAATTTGGGATGCATGG - Intronic
1090754811 11:129780684-129780706 ATTTGACATGTTTAGGTACATGG - Intergenic
1091504418 12:1052455-1052477 ATTTCACACTTTTGAGTACAAGG + Intronic
1092585961 12:9901566-9901588 ATTTGACATGTTTAGGTACATGG - Intronic
1098314648 12:69180636-69180658 ATGGGACAGTTTTGGATGGATGG - Intergenic
1098436210 12:70470321-70470343 ATTTGACATGTTTAGGTACATGG + Intergenic
1098554709 12:71805048-71805070 ATGTGACAGTGATGAGTGCATGG + Intergenic
1098805765 12:75018688-75018710 ATTTGACATGTTTAGGTACATGG - Intergenic
1099535194 12:83834675-83834697 ATTTGACATGTTTGGGTACATGG - Intergenic
1101690557 12:107076201-107076223 ATTTGATAGTTTTTGATGTAAGG - Intronic
1103258916 12:119567989-119568011 ATTTGACAGTTTAGACTACATGG + Intergenic
1103326459 12:120124609-120124631 ATTTGACAGTTTTGGGTGCAGGG - Intergenic
1104529523 12:129555968-129555990 ATTTGACATTCTTGGGTGATGGG + Intronic
1106375999 13:29188838-29188860 CTTTGGCAGGTTTGCGTGCAGGG - Intronic
1108203933 13:48069347-48069369 ATTTGACATGTTTAGGTACATGG + Intronic
1108489026 13:50960961-50960983 ACTTGACATTTTTGAGTACAGGG + Intronic
1109203785 13:59459502-59459524 GTTTGAGAACTTTGGGTGCAAGG + Intergenic
1109389026 13:61669480-61669502 ATTTGACATGTTTAGGTGCATGG - Intergenic
1109389095 13:61670288-61670310 ATTTGACATGTTTAGGTGCCTGG - Intergenic
1110181561 13:72623989-72624011 AGTTGACAGTTTTAGGTGCAAGG - Intergenic
1110857143 13:80309631-80309653 ATTTGACAGTTATGTGTCCTGGG - Intergenic
1112274563 13:98004481-98004503 ACTTTACAGGTTTGGGTGGATGG + Intronic
1112900695 13:104353701-104353723 ATTAGACATTTTGGGGTGAAAGG + Intergenic
1113344395 13:109460771-109460793 ATTTTACAGTTTTAAGTGTAGGG + Intergenic
1114919603 14:27310346-27310368 ATTTGACATGTTTGGGTACATGG + Intergenic
1115915966 14:38314535-38314557 TAATGACAGTTTTGGCTGCAAGG + Intergenic
1116576690 14:46584231-46584253 ATTTGACATTTTTAGGTACATGG - Intergenic
1116898836 14:50342632-50342654 ATCTGACAGTTTTAGGTGAAAGG + Intronic
1118245164 14:64103318-64103340 TTTTGGGAGTTTTGGGTGGAGGG + Intronic
1121324661 14:93012955-93012977 ACCTGACAGGTGTGGGTGCAGGG - Intronic
1123631497 15:22263198-22263220 TTTTTAAAGTTTTTGGTGCAGGG + Intergenic
1125350010 15:38756432-38756454 ATGTGGCAGTTGTGGATGCACGG + Intergenic
1126003871 15:44238000-44238022 ATTTGACAGTTTTGTATGGGGGG - Intergenic
1126559460 15:50027213-50027235 ATTTGACAGCAGTAGGTGCAAGG - Intronic
1128241575 15:66104979-66105001 ATGGGACAGTTTTGGTTGGAGGG - Intronic
1128676433 15:69612451-69612473 ATCTTACAGTCTTGGGTTCATGG + Intergenic
1128738614 15:70067819-70067841 CTTTGTCAGTTCTGGGTGAAAGG + Intronic
1129260112 15:74361199-74361221 ATTTGACATGTTTAGGTACATGG + Intronic
1129650284 15:77481779-77481801 CTTTGACAGTTTTGGGGGTGTGG - Intronic
1130997356 15:88911388-88911410 AAATGACAGATTTGGGTGTAGGG - Intronic
1133483475 16:6195035-6195057 ATCTGAAAGATTTGGGGGCAAGG - Intronic
1135077420 16:19405826-19405848 ATTTGACATGTTTAGGTACATGG - Intergenic
1136654034 16:31698960-31698982 ATGTGACAGTTTGGGGTCTAGGG + Intergenic
1137879973 16:52035801-52035823 ATATGAAAGATTTGAGTGCAGGG - Intronic
1137915438 16:52424812-52424834 ATCTGACAGTGTTGGGTGTTTGG + Intergenic
1138855106 16:60681343-60681365 TTCTGACATTTTTGGCTGCATGG - Intergenic
1139343266 16:66285303-66285325 GTTTGATAGTTTTGGGTCCCAGG - Intergenic
1139701840 16:68712614-68712636 ATTTGACAGATATGGGAGAACGG + Intronic
1146624858 17:34427513-34427535 ATTTCATAGATTTGGGGGCAGGG - Intergenic
1149338371 17:55661070-55661092 ATTTGAAAGTTGTGGCTGCATGG + Intergenic
1149856883 17:60090423-60090445 AAGTAACAGTTTTGGGTGGATGG - Intergenic
1150746356 17:67820058-67820080 ATTTGACAGTACTGGATGCTTGG + Intergenic
1151127640 17:71862170-71862192 TTTTCACAGTTTTGGATGCTGGG - Intergenic
1153347375 18:4042162-4042184 ATTGGACAGTTTTGGGTTAATGG + Intronic
1153766993 18:8384347-8384369 ACTTGAGAGGTTTAGGTGCAAGG + Intronic
1154139573 18:11811160-11811182 CTTTGGCGGCTTTGGGTGCAAGG - Intronic
1155784769 18:29882596-29882618 ATTTGACATTTTTATGTACATGG - Intergenic
1155803512 18:30138346-30138368 ATTTGCCACATTTGGGTACATGG - Intergenic
1156078948 18:33312397-33312419 ATCTGACAGTTTTGAATGGATGG + Intronic
1156161114 18:34359214-34359236 CTTTGACAGGTTTGAATGCAGGG - Intergenic
1156644004 18:39137621-39137643 ATTTGTCATTTTTGTGGGCATGG - Intergenic
1158016228 18:52787596-52787618 ATTTGACATGTTTAGTTGCATGG - Intronic
1159170801 18:64763826-64763848 ATTTGACAGTTGTAGGTGGGAGG + Intergenic
1159822182 18:73159441-73159463 ATTTGACAATTTTGGGGGCATGG + Exonic
1161419345 19:4167722-4167744 ATTTTACAGTATTGGGAGCTGGG + Intronic
1161444718 19:4311733-4311755 GTTGGACAATTTTGGGGGCATGG - Intronic
925604808 2:5648199-5648221 CTGTTACAGTTTTGGGGGCAGGG - Intergenic
926930590 2:18035772-18035794 ATTTGACCTTGTTGGGTGCTGGG + Intronic
927248418 2:20976889-20976911 ATTTGACATTTGTGCGTGCCAGG + Intergenic
927991398 2:27449943-27449965 ATTTCACAGAGATGGGTGCAAGG - Intronic
928359869 2:30654511-30654533 ATTTGGCAGATTTGGCTCCAGGG + Intergenic
930744211 2:54864145-54864167 ATTTTAAAGTTTTAGGTGCTAGG - Intronic
935569121 2:104640783-104640805 ATTTTAGAGTTATGGGAGCAAGG - Intergenic
936790760 2:116148827-116148849 ATTTGAGAGTTTTTGGTCCGTGG + Intergenic
936952239 2:117989407-117989429 CTTTGACAGGTTTGCTTGCAGGG - Intronic
937202216 2:120211000-120211022 TTTTGACTATTTTTGGTGCAGGG - Intergenic
938060046 2:128246701-128246723 ATGTGACAGTTTTGGGAGCTGGG - Intronic
939060220 2:137412763-137412785 ATTTGAAAGATCTGGGTGTATGG + Intronic
939642657 2:144659827-144659849 ATTTGGGGGTTTTGGGTGCCAGG + Intergenic
941045237 2:160667612-160667634 ATATGATAGTGTTGGGTGGAGGG + Intergenic
941249566 2:163145597-163145619 ATTTGACATGTTTAGGTACATGG + Intergenic
942663044 2:178286684-178286706 ATCTGACTGTTTTGGTTCCAGGG + Intronic
942839133 2:180338379-180338401 ATTTGACATGTTTAGGTACATGG + Intergenic
943419849 2:187656512-187656534 ATTTGACATATTTAGGTACATGG + Intergenic
944469888 2:200041692-200041714 ATTTGTAACTTTGGGGTGCAGGG - Intergenic
948090325 2:235288350-235288372 ATTTGACACTGTTGGATGAAGGG - Intergenic
1170100904 20:12698424-12698446 AAGTGACAGTGTTGGGTGAATGG + Intergenic
1170723709 20:18906688-18906710 ATTTTACAGTTTTGTGGTCATGG - Intergenic
1172275168 20:33675297-33675319 ATTTAACAGTTCTGGGGACACGG - Intergenic
1174493907 20:50925204-50925226 AAGTGACAGTTTTGATTGCAGGG - Intronic
1175197388 20:57253686-57253708 ATTTCTCTGTTATGGGTGCATGG - Intronic
1177414721 21:20779022-20779044 ATTTGACACGTTTAGGTACATGG - Intergenic
1178619800 21:34164040-34164062 ATTTGACATGTTTAGGTACATGG - Intergenic
1181332310 22:22102745-22102767 TTTTGACAGTATTGGGCACATGG - Intergenic
1182392653 22:30012074-30012096 ATTTGACATTTTTCAGTCCATGG - Intronic
1183379308 22:37483012-37483034 ATTTGACAGTTTGGAGCTCAGGG - Intronic
1183481070 22:38065858-38065880 ATTTGAAAGTCTCGGGGGCAAGG + Intronic
950509496 3:13417291-13417313 ATTGGACAGTTTTCGGGCCAGGG - Intronic
954598018 3:51843874-51843896 ATTTGACATGTTTAGGTACATGG - Intergenic
955237184 3:57149915-57149937 AATTGACAGTTTTTGGTGTATGG + Intronic
955613068 3:60778048-60778070 ATTTGACATGTTTAGGTACATGG + Intronic
957288570 3:78248266-78248288 ATTTGACATGTTTAGGTACATGG + Intergenic
957516902 3:81266891-81266913 ATAATACAGTTTAGGGTGCAAGG - Intergenic
957779632 3:84802018-84802040 TTTTGACAGTTTTGCATGCAGGG - Intergenic
960241129 3:115343296-115343318 ATCTCACAGTTCTGGGTGCTGGG - Intergenic
960370231 3:116827421-116827443 CTTTGACAGTTTTGAGGGCTAGG - Intronic
963986884 3:151606565-151606587 ATTTCAAAGTTTTGGGAGCAGGG - Intergenic
965130826 3:164697910-164697932 ATTTGAAACTTCTAGGTGCAAGG - Intergenic
969126474 4:4951932-4951954 ATGTGGCAGGGTTGGGTGCAGGG - Intergenic
972216021 4:36897574-36897596 ATTTGACAGTTTTGAGTTTTGGG + Intergenic
974189872 4:58490872-58490894 ATTTGACATGTTTAGGTACATGG - Intergenic
977619629 4:99121423-99121445 CTTTGAAAGTTTTGGCTGAAAGG - Intergenic
978525800 4:109663920-109663942 AGGTGACAGTTTTGGGGGTAGGG - Intronic
979015175 4:115423132-115423154 ATTTGACATTTTTGGGTATAGGG + Intergenic
980508088 4:133748781-133748803 ATTTGCCTGTTTGGGGTCCAGGG - Intergenic
981324514 4:143430441-143430463 ATTTGACATGTTTAGGTACATGG - Intronic
981326946 4:143460456-143460478 ACTGGACAGGTTTGGGTTCATGG - Exonic
981844876 4:149155765-149155787 ATTTTATTTTTTTGGGTGCAGGG + Intergenic
982098242 4:151943070-151943092 ATTTAGCAGTTTTGGAGGCAAGG + Intergenic
983241903 4:165243463-165243485 ATCTGACAGTTTTGAATGGATGG + Intronic
983357050 4:166675971-166675993 ATTTGGCATTCTTGGGAGCATGG + Intergenic
984424656 4:179567551-179567573 GTGCTACAGTTTTGGGTGCATGG + Intergenic
986327904 5:6692143-6692165 ACTTGACAGATTTTGGTTCAAGG + Intergenic
987890196 5:23866256-23866278 ATTTGACATATTTAGGTACATGG + Intergenic
988117645 5:26918408-26918430 ATTTTACAGTTTAGTGGGCATGG - Intronic
993315511 5:86400701-86400723 ATTTGAGAGCTTTGTGTGCATGG - Intergenic
994712162 5:103279245-103279267 ATTTTACACCTCTGGGTGCAGGG + Intergenic
995215076 5:109585824-109585846 ATTTGAGAGCTTTGGATGGAAGG + Intergenic
996412333 5:123171862-123171884 ATTTGACAGTTTTGATAGCTGGG + Intronic
997301678 5:132810782-132810804 ATTGGATATCTTTGGGTGCAAGG - Intergenic
1001058118 5:168465867-168465889 CTTTGACAGGTTTGCATGCAGGG + Intronic
1001598812 5:172915682-172915704 ATTTGACAGGTTAGGATGCTGGG + Intronic
1004681637 6:17901123-17901145 ATTCTACACTTTTGAGTGCAGGG + Intronic
1005639254 6:27779371-27779393 ATTTGACACGTTTAGGTACATGG + Intergenic
1006045285 6:31290398-31290420 ACTTGACAGTTTCTGGTGCCTGG - Intronic
1007193680 6:40040911-40040933 GTTGGACAGTTTGGGATGCAAGG + Intergenic
1008101788 6:47399536-47399558 ATCTGACACTTATGGGTCCAGGG - Intergenic
1008718008 6:54312774-54312796 ATCTGACAATTCTGCGTGCAAGG + Intronic
1008897609 6:56575624-56575646 ATGTGATAGTGTTGGGTGCTGGG + Intronic
1012583495 6:100896030-100896052 ATTTGACATGTTTAGCTGCATGG + Intergenic
1012594759 6:101026293-101026315 ATTTGACATATTTAGGTACATGG + Intergenic
1012875979 6:104726337-104726359 ATCTGACAATATTGGGTGCATGG - Intergenic
1012974349 6:105763965-105763987 GTTAGACAGTGTTGGTTGCATGG + Intergenic
1015284201 6:131466471-131466493 ATTTCACAGTTTTGTGGGCCAGG - Intergenic
1015492428 6:133841099-133841121 TTTTTAAAGTTTTGGGTTCATGG - Intergenic
1017519667 6:155190708-155190730 ATTTGAGAGTTTGGGATGCCAGG + Intronic
1017934702 6:158995145-158995167 AATTGAGAGTTTTGGGTATATGG - Intronic
1018088705 6:160327192-160327214 ATGTGAAAGTTCTGGGTGCCAGG - Intergenic
1018801925 6:167229609-167229631 ATCTGACAGTTTTGAGTTCTTGG + Intergenic
1019204416 6:170347632-170347654 ATTAGACAGGTATGGGTGCCTGG - Intronic
1020676996 7:11194797-11194819 ATTTGACATGTTTAGGTACATGG + Intergenic
1021379746 7:19953149-19953171 ATCTGACAGTTTTGTGTGTTGGG + Intergenic
1022975581 7:35552939-35552961 ATTTCACAGTCTTGGGAGAAAGG + Intergenic
1023053969 7:36277109-36277131 CTTTGAAAGTTTTGGGAGAAAGG + Intronic
1024328738 7:48135199-48135221 ATTTGACATGTTTAGGTACATGG - Intergenic
1024437742 7:49378962-49378984 ATTTGACATGTTTAGGTACATGG + Intergenic
1024491286 7:49988401-49988423 ATTTGACATGTTTAGGTACATGG + Intronic
1026072087 7:67130827-67130849 ATTTGGCACTTCTGGGTGAAGGG + Intronic
1027302583 7:76856339-76856361 TTTTGACACTTTGGTGTGCAGGG - Intergenic
1028228432 7:88276714-88276736 ATTTCATAGTTTTGGGAGCAGGG + Exonic
1028624350 7:92861831-92861853 ATTTTAGAGTTTTGGGAGGAGGG + Intergenic
1028839610 7:95414207-95414229 ATTTTACAGTTATGGGTTGAGGG - Intronic
1030736849 7:113059241-113059263 ATTTGAAAGATTTGGGGGTAAGG + Intergenic
1030989945 7:116287893-116287915 ATTGGCCAGTTTGGGGTACATGG + Intronic
1032571066 7:132997871-132997893 AAATGACAGTATTGGATGCAGGG - Intronic
1033987319 7:147242366-147242388 ATTACAGAGTTCTGGGTGCATGG - Intronic
1034145370 7:148866469-148866491 TTTTCACAGTTTTGGGGGCTGGG - Intronic
1037268275 8:17093444-17093466 ATTTTCCAGTTTGGGGTACAGGG + Intronic
1039367391 8:36944599-36944621 ATTTTACACTTTTAAGTGCAGGG - Intergenic
1040064689 8:43135991-43136013 ATTTGACATGTTTAGGTACATGG + Intergenic
1040067596 8:43160599-43160621 ATTTTACAGTTTAGGGTTTAGGG - Intronic
1040990550 8:53345152-53345174 ATTTGACATGTTTAGGTACATGG + Intergenic
1042979603 8:74510441-74510463 ATTTCCCAGTTTTAGGTGCATGG + Intergenic
1043574333 8:81640415-81640437 CTTTGACACTGTTGGGTGCTAGG - Intergenic
1044310070 8:90683337-90683359 ATTTGACATTTTTAGGTACATGG + Intronic
1044398782 8:91745103-91745125 ATATGTCAGTTTTGGTTGAATGG - Intergenic
1046068181 8:109220411-109220433 ATTTGACATGTTTAGGTACACGG + Intergenic
1046149729 8:110207918-110207940 ATTTGGCTGGTTTGGATGCAGGG - Intergenic
1046804155 8:118462054-118462076 TTTTGTCAGTTTTGGGTACATGG + Intronic
1048885202 8:138903979-138904001 TTTTGACAAATCTGGGTGCAGGG - Intronic
1049076059 8:140396886-140396908 ATCTGACAGTTTTGTGGGAAAGG - Intronic
1050466509 9:5930840-5930862 ATTTAATAGTTTTGTGTTCATGG - Intronic
1050611614 9:7359841-7359863 GTCTGACAGTTGTGGGTTCAGGG + Intergenic
1056263119 9:84868750-84868772 ATTTGACAGTTCTGTGTACAGGG - Intronic
1058230125 9:102415336-102415358 TTTTTACAGTTTTGGGGGCTTGG + Intergenic
1058819396 9:108715145-108715167 ATCTGACAGTTTTGTGTGTTGGG - Intergenic
1059247921 9:112864198-112864220 AGATGCCAGTTTTGTGTGCAGGG + Intronic
1061079292 9:128360617-128360639 ACTTGGCAGTTTTGGATGGAGGG - Exonic
1061338554 9:129960460-129960482 TTTTGAGTGTTTTGTGTGCATGG + Intronic
1186476965 X:9865141-9865163 CTTTGACTGTCTTGGGTGCTAGG - Intronic
1189616721 X:42791715-42791737 ATTTGACATGTTTAGGTACATGG - Intergenic
1190524835 X:51318360-51318382 ATTAGACAGTTCTGGTTCCAAGG + Intergenic
1190545394 X:51520549-51520571 ATTAGACAGTTCTGGTTCCAAGG - Intergenic
1196520539 X:116666227-116666249 ATTTGACATATTTAGGTGCATGG - Intergenic
1196968130 X:121080244-121080266 ATTTGACATGTTTAGGTACATGG - Intergenic
1197868273 X:131041420-131041442 ATCTGACAGTTTTGGCACCATGG - Intergenic