ID: 1103326460

View in Genome Browser
Species Human (GRCh38)
Location 12:120124610-120124632
Sequence GATTTGACAGTTTTGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103326460_1103326469 25 Left 1103326460 12:120124610-120124632 CCTGCACCCAAAACTGTCAAATC 0: 1
1: 0
2: 0
3: 11
4: 192
Right 1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103326460 Original CRISPR GATTTGACAGTTTTGGGTGC AGG (reversed) Intergenic
901049880 1:6420705-6420727 GGCAGGACAGTTTTGGGTGCGGG + Intronic
902206834 1:14874637-14874659 GTTTTGACAGCTTTTGGTTCTGG - Intronic
903999986 1:27333478-27333500 GACTGGACAGTCCTGGGTGCGGG + Intronic
904603525 1:31686340-31686362 GCTTTTACAGTTTTGGGTTTGGG - Intronic
906362712 1:45177461-45177483 GATTTCACAGTTTGGGTTGTAGG - Intronic
907710175 1:56873451-56873473 GATTAGACAGACTTGGGTTCAGG - Intronic
909975508 1:82042063-82042085 GATTTGAGAGGTTTGGGGGCTGG - Intergenic
911344698 1:96682284-96682306 GATATGACTTTTTTGGGGGCTGG + Intergenic
911748873 1:101472581-101472603 GATTTGCCAGTGAAGGGTGCTGG + Intergenic
911871746 1:103108187-103108209 GAGTTCACAGTTGTGAGTGCGGG - Exonic
913499962 1:119462971-119462993 GATTTGGCTTTATTGGGTGCTGG - Intergenic
915152380 1:153844506-153844528 AATTTTATATTTTTGGGTGCTGG - Intronic
915578496 1:156797906-156797928 TTTTTGACTGTTTAGGGTGCTGG - Intronic
1064905716 10:20343435-20343457 AATTTTGTAGTTTTGGGTGCCGG - Intergenic
1067238716 10:44472738-44472760 GATTCTACAGGTTTGGGGGCGGG - Intergenic
1068997034 10:63219036-63219058 GATTTGATAGTTGTTGGGGCTGG + Intronic
1069698019 10:70401666-70401688 AATTTGAAAGTTTTGGGGACAGG - Intergenic
1075257263 10:120935061-120935083 GATTTGACAAATTGGGGTCCTGG + Intergenic
1075633444 10:124015131-124015153 GAAGTGACAGTTTCTGGTGCAGG + Intronic
1076270957 10:129151663-129151685 CATCTTACAGTTTTGGGGGCTGG - Intergenic
1078379395 11:10826380-10826402 GTTTTGGCAGTTTTGGAGGCTGG - Intronic
1079725171 11:23871551-23871573 GAGTTGGCACTTTTGGGTGAAGG - Intergenic
1080895347 11:36444621-36444643 GATTTGGCAGTTGTTGGAGCAGG + Intronic
1080998290 11:37633570-37633592 AATGTGACAGTGTTGGGAGCTGG + Intergenic
1084656179 11:70520372-70520394 ACCTTGACAGTTTTGGCTGCTGG + Intronic
1087647029 11:100819995-100820017 CATTTGATAATTTTTGGTGCAGG + Intronic
1090618318 11:128537586-128537608 ACTTTGAATGTTTTGGGTGCAGG - Intronic
1094575592 12:31682345-31682367 GCTTTGACAGGTTTGTATGCCGG + Intronic
1096149810 12:49301831-49301853 GAATTTACAGTTTGGGGTGGGGG + Intergenic
1097740165 12:63232613-63232635 GATTTGACAGTTTGGGAAGTCGG + Intergenic
1101288408 12:103340572-103340594 AATTTTACCCTTTTGGGTGCTGG - Intronic
1101887478 12:108678480-108678502 AAATTGAGAGTTTTGGGTGGAGG - Intronic
1103326460 12:120124610-120124632 GATTTGACAGTTTTGGGTGCAGG - Intergenic
1103888744 12:124222678-124222700 GACTTTAGAGCTTTGGGTGCTGG - Intronic
1104529522 12:129555967-129555989 AATTTGACATTCTTGGGTGATGG + Intronic
1106376000 13:29188839-29188861 GCTTTGGCAGGTTTGCGTGCAGG - Intronic
1106708040 13:32302298-32302320 GATTTGTGAGATTTTGGTGCAGG + Intergenic
1107893913 13:44939496-44939518 GCTTTGCCTGTTTTGGGTACAGG - Exonic
1108358500 13:49648853-49648875 GATTAGACAGTTATGGGTTTGGG - Intergenic
1108884922 13:55168000-55168022 GTTTTGAGAGATTTGGGTGTTGG - Intergenic
1110857144 13:80309632-80309654 CATTTGACAGTTATGTGTCCTGG - Intergenic
1111368024 13:87276018-87276040 TTTCTCACAGTTTTGGGTGCTGG + Intergenic
1116015066 14:39396009-39396031 GATTTGAAAGGGTTGGGAGCTGG + Intergenic
1116391276 14:44393055-44393077 GATTTGACATTTCTGGGTTAGGG - Intergenic
1119437347 14:74605951-74605973 AATATTAAAGTTTTGGGTGCAGG + Intronic
1120962723 14:90140063-90140085 GATTTGAGATTTTGGGATGCAGG + Intronic
1122777272 14:104125890-104125912 AATTTTACATTGTTGGGTGCTGG + Intergenic
1123631496 15:22263197-22263219 GTTTTTAAAGTTTTTGGTGCAGG + Intergenic
1126003872 15:44238001-44238023 GATTTGACAGTTTTGTATGGGGG - Intergenic
1127192840 15:56550052-56550074 GATTTGTCAGTGTTGGGGGAAGG - Intergenic
1128241576 15:66104980-66105002 GATGGGACAGTTTTGGTTGGAGG - Intronic
1128267846 15:66282194-66282216 GCTTTGACAATTCTGGGGGCCGG - Intergenic
1128807556 15:70542454-70542476 GATTTTACTGTGTTGGGTGTTGG - Intergenic
1128842928 15:70864701-70864723 GATTTGCCAGTTTAGTGTACGGG + Intronic
1129228985 15:74186106-74186128 GATTTAACTGGTTTGGGTGCAGG - Intronic
1130525233 15:84700155-84700177 AATTTTACCTTTTTGGGTGCTGG - Intronic
1131467770 15:92669225-92669247 GAATTTAGAGTTTGGGGTGCTGG - Intronic
1131467779 15:92669280-92669302 GAATTTAGAGTTTGGGGTGCTGG - Intronic
1131467788 15:92669335-92669357 GAATTTAGAGTTTGGGGTGCTGG - Intronic
1131880064 15:96852793-96852815 GAGTTGAAAGTTGTGGCTGCAGG + Intergenic
1131954181 15:97714036-97714058 GATTGGACAGTTTTGTCTCCAGG + Intergenic
1132348117 15:101120872-101120894 GATTTGAGACTGTTGGGTGCTGG - Intergenic
1138336605 16:56258483-56258505 CATTTGACAGTTATGGGTAGTGG + Intronic
1139024532 16:62797994-62798016 GATTTTACAGTGGTGAGTGCTGG + Intergenic
1139682180 16:68573580-68573602 GATTTGACAGTGTTGGGGAGTGG + Intronic
1141204135 16:81920219-81920241 CATTGGAGAGTTCTGGGTGCAGG + Intronic
1141971506 16:87487263-87487285 GTTTTTAAAGTTTTTGGTGCAGG - Intronic
1144942939 17:18953801-18953823 GATTTTAGAGTTTTGGGTTGGGG + Intronic
1150821717 17:68440134-68440156 TATTTGACAGTTTTGCCTCCAGG + Intronic
1151127641 17:71862171-71862193 TTTTTCACAGTTTTGGATGCTGG - Intergenic
1155777026 18:29777883-29777905 AATTTTACATTGTTGGGTGCTGG + Intergenic
1156258637 18:35423742-35423764 AATTTTACATTGTTGGGTGCTGG + Intergenic
1158391789 18:57050634-57050656 GATTTGACTGCTGTGGGAGCTGG - Intergenic
1161419344 19:4167721-4167743 CATTTTACAGTATTGGGAGCTGG + Intronic
1162324168 19:9989074-9989096 GATTTACCAGCTTTGGGTTCAGG - Intronic
1165402549 19:35611088-35611110 AATTTTACAGTGTTGGATGCTGG + Intergenic
1165714726 19:38036951-38036973 CGTGTGACAGTTCTGGGTGCAGG - Intronic
924980044 2:211076-211098 CATTTGACAGATTTGGGTCAGGG + Intergenic
926930589 2:18035771-18035793 AATTTGACCTTGTTGGGTGCTGG + Intronic
927855811 2:26527405-26527427 GGCTTGACAGTTTGGGGTGGTGG - Intronic
928359868 2:30654510-30654532 GATTTGGCAGATTTGGCTCCAGG + Intergenic
929525599 2:42700046-42700068 GATTTAACAGTGTTGGATGCTGG + Intronic
931608645 2:64076690-64076712 GATTTGCCAGTCCTGGGTGGCGG + Intergenic
931850712 2:66248126-66248148 GATTTGCCAGTCCTGGGTGGGGG - Intergenic
932405997 2:71513015-71513037 GATCTGACAGAGTTAGGTGCAGG + Intronic
932855892 2:75233683-75233705 CATTTGAAAGTTTTCGGTTCTGG + Intergenic
933013386 2:77092578-77092600 GATTTGCCAGTCCTGGGTGGGGG - Intronic
933969912 2:87461989-87462011 GATTTGACTATTTTTGGAGCCGG + Intergenic
934843120 2:97644086-97644108 GAGTTGACAGTGGTGGGAGCTGG + Intergenic
935352384 2:102163788-102163810 GATTTTACCATGTTGGGTGCTGG + Intronic
936323869 2:111488507-111488529 GATTTGACTATTTTTGGAGCCGG - Intergenic
936389929 2:112062619-112062641 AATTTCACATTTTTGAGTGCTGG + Intronic
936952240 2:117989408-117989430 GCTTTGACAGGTTTGCTTGCAGG - Intronic
937202217 2:120211001-120211023 GTTTTGACTATTTTTGGTGCAGG - Intergenic
938060047 2:128246702-128246724 AATGTGACAGTTTTGGGAGCTGG - Intronic
938375267 2:130800996-130801018 CAATAGACAGTTTTGGCTGCTGG + Intergenic
940008344 2:149030294-149030316 GTTTTCACAGTTTTGGAGGCTGG + Intergenic
940137636 2:150457003-150457025 GATTTAACAGTTTTGAGAACTGG - Intergenic
942663043 2:178286683-178286705 GATCTGACTGTTTTGGTTCCAGG + Intronic
942666245 2:178321967-178321989 TATTTTACAGTTGTGGGTCCTGG + Intronic
943633811 2:190283019-190283041 GATTTCAGAGTTTTGGATTCAGG - Intronic
945731047 2:213535149-213535171 GATTTTACATTGTTGGGTTCTGG - Intronic
945874743 2:215266859-215266881 GATTTGAGAGTTTGGGGCTCGGG - Intergenic
947640623 2:231706064-231706086 GACTTGACAGTTCTGGATTCAGG - Intergenic
1170169196 20:13392703-13392725 GATTTGGCAGTATCGGGCGCTGG + Intronic
1170223440 20:13965091-13965113 GAGTGGACAGCTGTGGGTGCAGG + Intronic
1175650603 20:60718600-60718622 GTTTTCACAGTTTTGGAGGCTGG - Intergenic
1177522888 21:22252993-22253015 GGTTTGACAATTTTGGCTGCTGG + Intergenic
1178524293 21:33313034-33313056 AATTTTACATTGTTGGGTGCTGG - Intergenic
1183379309 22:37483013-37483035 GATTTGACAGTTTGGAGCTCAGG - Intronic
1183686367 22:39363426-39363448 GACTTGACAGTTTTGGGAGGAGG + Intronic
1184964484 22:47960344-47960366 GATTTTAAATTGTTGGGTGCTGG + Intergenic
949193233 3:1274996-1275018 GATGAGAAAGTTTTTGGTGCTGG - Intronic
949453945 3:4218339-4218361 GATTTGACAAATTTAGGTGGTGG + Intronic
951952282 3:28213510-28213532 CACTTGTCAGTTTTGGGTCCAGG - Intergenic
952666295 3:35908521-35908543 GCTTTGACAGGTTTGCATGCAGG - Intergenic
956770556 3:72522500-72522522 GCTTAAACAGCTTTGGGTGCTGG + Intergenic
957779633 3:84802019-84802041 CTTTTGACAGTTTTGCATGCAGG - Intergenic
957811762 3:85230937-85230959 TTTCTCACAGTTTTGGGTGCTGG + Intronic
959700107 3:109290743-109290765 GATTTGACATTTTTAGGTCTTGG - Intergenic
960241130 3:115343297-115343319 TATCTCACAGTTCTGGGTGCTGG - Intergenic
963986885 3:151606566-151606588 CATTTCAAAGTTTTGGGAGCAGG - Intergenic
966782718 3:183598269-183598291 GATTTTACATTGTTAGGTGCTGG + Intergenic
967662825 3:192134004-192134026 AGTGTGACAGTTTTGGTTGCAGG + Intergenic
967862537 3:194162820-194162842 GATTTGAAATTTTTGGATTCAGG + Intergenic
968119780 3:196117843-196117865 GCTTTGTCTGTCTTGGGTGCTGG - Intergenic
968993672 4:3931573-3931595 AATTTGCCAGTCCTGGGTGCGGG - Intergenic
970375005 4:15448130-15448152 TATTTTACAGTTTTGGAGGCTGG - Intergenic
971017144 4:22499983-22500005 GATTTTAGATTTTTGGGTTCGGG - Intronic
972216020 4:36897573-36897595 TATTTGACAGTTTTGAGTTTTGG + Intergenic
973235099 4:47892786-47892808 AACTTTACATTTTTGGGTGCTGG - Intronic
974475847 4:62378832-62378854 GATTTGACAGATTTTGGGGGTGG + Intergenic
975542588 4:75530223-75530245 TATCTGACAGTTTTGAGTGAGGG - Intronic
979015174 4:115423131-115423153 TATTTGACATTTTTGGGTATAGG + Intergenic
981844875 4:149155764-149155786 GATTTTATTTTTTTGGGTGCAGG + Intergenic
982073976 4:151720230-151720252 GCTTTGACATTCTTTGGTGCTGG - Intronic
982415245 4:155123722-155123744 GATTTGTCAGTTTTGACTACTGG - Intergenic
984660212 4:182365355-182365377 GATGAGACAGGTTTGGTTGCAGG + Intronic
985389561 4:189480879-189480901 AATTTGCCAGTTCTGGGTGGGGG + Intergenic
987120340 5:14761231-14761253 CATTTCACAGTTATGGATGCTGG - Intronic
987394833 5:17413228-17413250 GATTTGAGAGTTTGGGGTGGGGG - Intergenic
990680571 5:58239372-58239394 GTTGTGACAGTTGTGGGTGGGGG - Intergenic
995539355 5:113169376-113169398 GCTTTGACACATTTGGGTGCAGG - Intronic
996412332 5:123171861-123171883 TATTTGACAGTTTTGATAGCTGG + Intronic
997800564 5:136856847-136856869 ACTTTGACAGTTTTGAGTACTGG + Intergenic
998699118 5:144677408-144677430 GATTTGACAGTTGTTGAAGCTGG + Intergenic
1001058117 5:168465866-168465888 GCTTTGACAGGTTTGCATGCAGG + Intronic
1001598811 5:172915681-172915703 CATTTGACAGGTTAGGATGCTGG + Intronic
1003679748 6:8240887-8240909 CATGTGAAAGTTTTGCGTGCAGG - Intergenic
1005160418 6:22854662-22854684 GATTTGGGATTTTAGGGTGCTGG - Intergenic
1008095922 6:47339140-47339162 GATTTCAGAGTTTATGGTGCTGG + Intergenic
1008881157 6:56381843-56381865 GATTTGACAAGTTGAGGTGCTGG - Intronic
1008897608 6:56575623-56575645 AATGTGATAGTGTTGGGTGCTGG + Intronic
1009576977 6:65477066-65477088 GATATGACAGTTTTAGAAGCTGG - Intronic
1009622166 6:66091722-66091744 GCTTTGCCTGTTTTGGGTACAGG - Intergenic
1013774643 6:113666134-113666156 AATTTGACACTTTTGGGGTCTGG + Intergenic
1020602456 7:10292965-10292987 CATTTGAGAGTTTTGAGTACTGG - Intergenic
1021379745 7:19953148-19953170 AATCTGACAGTTTTGTGTGTTGG + Intergenic
1021548420 7:21842598-21842620 GATTTGCCAATTTTGTGTGAAGG - Exonic
1022244860 7:28549411-28549433 AATTTGACAGATTTGAGTGTTGG - Intronic
1025144186 7:56490695-56490717 GTTTTGTCTGTTTTAGGTGCTGG - Intergenic
1025259792 7:57411173-57411195 GGTTTGTCTGTTTTAGGTGCTGG - Intergenic
1026639033 7:72108369-72108391 GATTTGATATCTTTGGGGGCTGG + Intronic
1028228431 7:88276713-88276735 AATTTCATAGTTTTGGGAGCAGG + Exonic
1028624349 7:92861830-92861852 GATTTTAGAGTTTTGGGAGGAGG + Intergenic
1031664821 7:124470999-124471021 GATTTGATTTTGTTGGGTGCAGG + Intergenic
1032683563 7:134209440-134209462 GATGTGGCAGTTCTGGGTGAGGG - Intronic
1034145371 7:148866470-148866492 TTTTTCACAGTTTTGGGGGCTGG - Intronic
1034248699 7:149670877-149670899 CATTTTCCAGTCTTGGGTGCAGG - Intergenic
1035197258 7:157231953-157231975 TATTTGACAGTTCTGGAGGCTGG + Intronic
1035941106 8:3902276-3902298 GATTTGACAGTAATGGGTGAGGG - Intronic
1036548307 8:9793443-9793465 GTTTTGACAATTATGTGTGCAGG - Intergenic
1036700419 8:11009627-11009649 AGCTTGACAGTTTTGAGTGCTGG - Intronic
1040067597 8:43160600-43160622 GATTTTACAGTTTAGGGTTTAGG - Intronic
1040588783 8:48769920-48769942 GTTTTGACAGTTTTGGAGCCTGG + Intergenic
1041024331 8:53668654-53668676 GATCTCACAGTTCTGGGGGCTGG + Intergenic
1041870631 8:62630794-62630816 GAGTTGAAGGTTTTGGGTGGAGG - Intronic
1043036979 8:75210734-75210756 GGTTCTACAGTTCTGGGTGCTGG + Intergenic
1043630825 8:82330284-82330306 GATTTTACAGTGATGGGTGGAGG + Intergenic
1046969240 8:120203081-120203103 GCTTTGATAGTTTAGGATGCTGG + Intronic
1048632020 8:136254093-136254115 TATTTGTCAGTTTAGAGTGCTGG - Intergenic
1050002598 9:1094198-1094220 GATTTGACTGCTCTAGGTGCAGG + Intergenic
1050611613 9:7359840-7359862 GGTCTGACAGTTGTGGGTTCAGG + Intergenic
1055183037 9:73413178-73413200 GCTTACAGAGTTTTGGGTGCTGG - Intergenic
1055321714 9:75088702-75088724 GGTTTGACTGGTTTGGGTGGCGG - Exonic
1056263120 9:84868751-84868773 TATTTGACAGTTCTGTGTACAGG - Intronic
1057426042 9:94950600-94950622 GGTTTGACAGCTTTGAGAGCAGG - Intronic
1058819397 9:108715146-108715168 AATCTGACAGTTTTGTGTGTTGG - Intergenic
1059146854 9:111907553-111907575 AATTTCACCGTGTTGGGTGCTGG + Intronic
1059247920 9:112864197-112864219 GAGATGCCAGTTTTGTGTGCAGG + Intronic
1061031640 9:128088078-128088100 GATTTTACCCTCTTGGGTGCTGG + Intronic
1061187655 9:129064048-129064070 GATATGACATTTCTGGGTCCTGG + Intronic
1061516720 9:131094405-131094427 GATTTTACAGTTTTCTGTGGAGG - Intronic
1061730222 9:132608244-132608266 GTTTTGACAGGTTTGCGTGTAGG + Intronic
1186748076 X:12591063-12591085 TATTTGACTGTTTTGGGGGTCGG - Intronic
1187008877 X:15259680-15259702 GATTTGGGAGTTTTGGGTTAAGG - Intronic
1187969944 X:24649011-24649033 AGTTTGACAGTTTTAGATGCTGG + Intronic
1189524737 X:41808173-41808195 GTTGTAACAGTATTGGGTGCTGG - Intronic
1190545306 X:51519540-51519562 GATTTCACTGTTTTGGGTTGTGG - Intergenic
1190644218 X:52509924-52509946 GTTTTGCCTGTTTTAGGTGCTGG - Intergenic
1193128472 X:77895032-77895054 GTTTTGACACTTTTGAGTGTGGG - Intronic
1196402967 X:115335007-115335029 GAATTGATAGGTTTGGGTTCTGG + Intergenic
1196830960 X:119775115-119775137 GAGTTCACAGGTTTGGTTGCAGG + Intergenic
1199811193 X:151351267-151351289 GGTTTGACAGTGGTGGGGGCGGG + Intergenic