ID: 1103326464

View in Genome Browser
Species Human (GRCh38)
Location 12:120124641-120124663
Sequence GAGGACTTGGGAGAGTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 446}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103326464_1103326473 16 Left 1103326464 12:120124641-120124663 CCCTGCCACTCTCCCAAGTCCTC 0: 1
1: 0
2: 3
3: 39
4: 446
Right 1103326473 12:120124680-120124702 GACAAAGAGAATGTACCTGAAGG 0: 1
1: 0
2: 3
3: 12
4: 255
1103326464_1103326474 21 Left 1103326464 12:120124641-120124663 CCCTGCCACTCTCCCAAGTCCTC 0: 1
1: 0
2: 3
3: 39
4: 446
Right 1103326474 12:120124685-120124707 AGAGAATGTACCTGAAGGTCTGG 0: 1
1: 0
2: 2
3: 31
4: 519
1103326464_1103326469 -6 Left 1103326464 12:120124641-120124663 CCCTGCCACTCTCCCAAGTCCTC 0: 1
1: 0
2: 3
3: 39
4: 446
Right 1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103326464 Original CRISPR GAGGACTTGGGAGAGTGGCA GGG (reversed) Intergenic
902263949 1:15247635-15247657 CAGGACTTCCCAGAGTGGCATGG - Intronic
902288009 1:15419127-15419149 CAGAACTGGGGAGAGGGGCAGGG + Intronic
902632149 1:17711329-17711351 GAGGACCTGAGAGAGAGGCCTGG + Intergenic
903268912 1:22175573-22175595 GAGGAGTGGGGAGAGCGGCTTGG + Intergenic
903281979 1:22255306-22255328 CAGGTCTGGGGAGAGGGGCAGGG - Intergenic
904521485 1:31099474-31099496 GAGGCCTCTGGAGAGTGGCAAGG + Intergenic
905492259 1:38353775-38353797 GAGGCCCTGGGAGGGAGGCATGG + Intergenic
905652893 1:39668382-39668404 CAGGACTTGGCAGTCTGGCAGGG - Intronic
906274516 1:44506235-44506257 AAGGACTTGGGAGGGTGGCAGGG + Intronic
906650551 1:47509397-47509419 GAGGAGCTGGGAGAGGGGCAGGG + Intergenic
909059368 1:70862515-70862537 GAGGACAGGGGAGAGTCTCATGG + Intronic
909651071 1:77976918-77976940 GGGGACTTGAGGGAATGGCAAGG - Intronic
911197278 1:95007365-95007387 GATGACTTGGGACATGGGCAGGG - Intronic
912360936 1:109094365-109094387 GAGGACTTCGGTGAAGGGCAGGG + Intronic
914705006 1:150163087-150163109 GAGGGGTTGGGAGAGCGGCTGGG - Intronic
914761489 1:150602376-150602398 CAGGACTTGGAATAATGGCAAGG + Intronic
914812271 1:151037665-151037687 GAGGACGTGTGAGGGTGGCTGGG + Intronic
915284654 1:154845106-154845128 GGGGAAATGGAAGAGTGGCAAGG - Intronic
915939897 1:160112401-160112423 GAGGAGGAGGGAGAGTGGGAGGG - Intergenic
917352852 1:174096096-174096118 GAGGGCTTGGGAGTGTGATATGG + Intergenic
918319110 1:183348011-183348033 GAGGGGTTGGGGGAGTGGTATGG - Intronic
918695302 1:187539306-187539328 GAGAAATTGGGAGAGTGTGAGGG + Intergenic
919352840 1:196481296-196481318 GAAGACTTGGAAGAGTGAGAAGG + Intronic
919773670 1:201179312-201179334 GAGGAGATGGGAGAGTCACATGG - Intergenic
920021764 1:202961786-202961808 GAACACCTGGGAGAGTTGCATGG + Intergenic
920233839 1:204489417-204489439 CAGCACTTGGGAGACTGACATGG - Intronic
920298790 1:204975929-204975951 TAGGACTTAGGACACTGGCAGGG + Intronic
920967023 1:210709367-210709389 CAGGAGGTGGGAGAGAGGCATGG + Intronic
922062487 1:222105682-222105704 GTGGGTTTGGGAGAGTGGAAGGG - Intergenic
922709453 1:227816004-227816026 GGGGACGTGGGGGAGGGGCAGGG - Intronic
922911619 1:229222726-229222748 CAGGAGTTGGGAGAGTAGCCTGG - Intergenic
923215008 1:231840617-231840639 TAGGAATTGGGAGAGGGGCTGGG + Intronic
923288324 1:232519073-232519095 AAGGATTTGGGAAAATGGCATGG - Intronic
923473235 1:234310631-234310653 AAGGACATGGGTGGGTGGCAGGG - Intronic
1062898046 10:1119877-1119899 GAGGGGTTTGGAGAGTAGCATGG + Intronic
1064303816 10:14147397-14147419 GTGGACTGGGGAGAGGGGAATGG + Intronic
1065381588 10:25096401-25096423 GAGGACAGGGAAGAGTGGGAAGG - Intergenic
1065461076 10:25965425-25965447 GAGGAGAAGGAAGAGTGGCAAGG - Intronic
1065523956 10:26598772-26598794 GAGGAGTTGGGGGAGAGGAAAGG + Intergenic
1065596498 10:27318545-27318567 GAGGAGTTGGGGGAGAGGAAGGG - Intergenic
1066470159 10:35690102-35690124 CAGGACATGAGAGAGGGGCAGGG + Intergenic
1067109915 10:43392996-43393018 GAGGGCTTGGGAGAAGGTCAAGG - Intronic
1067834760 10:49631795-49631817 GAGGAGTTGGGAGAGGAGGATGG + Intronic
1068429646 10:56914110-56914132 GGGGACTTGGGAGAATGGATGGG - Intergenic
1068506327 10:57904519-57904541 GAGGCCTGGGGAGTGGGGCAAGG - Intergenic
1068563575 10:58545723-58545745 CAGTACTTGGAAGAGTGGAAGGG + Intronic
1068728324 10:60327576-60327598 GAGGATATGGGAGAGTGCTATGG + Intronic
1068763996 10:60742885-60742907 GAGGACTTGGGGGAAGAGCAGGG - Intergenic
1068973138 10:62980129-62980151 GAGGACTGGGGAGGGTGGGGAGG - Intergenic
1069303440 10:66937784-66937806 GAGGACTTGGGAGGGAGGAAGGG - Intronic
1070522672 10:77268051-77268073 GGGCACTTGTGAGAGTGGAAAGG - Intronic
1070558859 10:77550660-77550682 CAAGGCTTGGGGGAGTGGCAAGG + Intronic
1070572436 10:77650285-77650307 GAGGCCCTGGGAGGCTGGCAGGG + Intergenic
1070915770 10:80153660-80153682 GAGTTCTTGGGAGAGCAGCAGGG + Exonic
1072247905 10:93559467-93559489 GAGGAGTAGGGGGACTGGCAAGG - Intergenic
1074197651 10:111203356-111203378 GGGCACTTGGGAGAGTTGGATGG + Intergenic
1074410287 10:113222323-113222345 GGTGACTCGGGAGAGAGGCAGGG - Intergenic
1075305777 10:121365909-121365931 GAGGACTGGGGAGCATGGCGCGG + Intergenic
1075705388 10:124497329-124497351 GAGCAGCTGGGAGAGCGGCAGGG - Intronic
1075715343 10:124552080-124552102 GAGGGGCTGGGAGAATGGCAGGG + Intronic
1075729000 10:124625350-124625372 GGGAACTCAGGAGAGTGGCAGGG + Intronic
1075743873 10:124712912-124712934 GAGGACTTGGGAGGTGGGCAGGG - Intronic
1075838338 10:125475267-125475289 GAGGACTTTGGATATTGGCAAGG - Intergenic
1076776886 10:132702909-132702931 GTGGGCTTGGGGGAGTGGCAGGG + Intronic
1077221638 11:1420617-1420639 TAGGACTTGGGGGAGTCACAGGG - Intronic
1077378151 11:2215281-2215303 GAGGACTGGGGTGTGTGGCCTGG - Intergenic
1077549270 11:3192831-3192853 GAGGACTTGGGGGGGTGACATGG + Intergenic
1078025913 11:7695487-7695509 TAGGAATTAGGTGAGTGGCAGGG - Intronic
1078086670 11:8237638-8237660 GAGGATGAGGGAGAGAGGCAGGG + Intronic
1079584233 11:22105915-22105937 CAGGACTTGGCACAGTGTCATGG - Intergenic
1080136663 11:28862991-28863013 AAGGATTTAGGAGAATGGCAAGG - Intergenic
1080297252 11:30744524-30744546 CAGGAATTAGGAGAGAGGCATGG - Intergenic
1080952070 11:37045545-37045567 GAGAACATGGGAAAGTGACAAGG - Intergenic
1082682741 11:56197515-56197537 GTGGAGTGGGGACAGTGGCAGGG - Intergenic
1083054550 11:59807197-59807219 GAGGAATGGGGAGAGTGGGCAGG + Intronic
1083628784 11:64085410-64085432 GAGGGCGGGGGAGACTGGCAGGG + Intronic
1083764216 11:64834350-64834372 GACGGCTGGGGAGAATGGCAAGG + Exonic
1085070369 11:73538572-73538594 GAGGTTTTGTGAGAGTGGGAAGG - Intronic
1085854548 11:80161542-80161564 GAGGTCCTGGGAGGGTGGTATGG - Intergenic
1086162151 11:83733923-83733945 GGAGACTTGGGAGGGTGGGAGGG - Intronic
1087605054 11:100366919-100366941 CAGGGCTTGGGAGAGAGGGACGG - Intergenic
1089558853 11:119333318-119333340 GAGGCCTTGGGATCGTGGTAGGG - Intergenic
1089600327 11:119610353-119610375 GAGGAGCTGGGGGAGTGGTAAGG + Intergenic
1089830877 11:121326913-121326935 GAGGATTTGGCATAGTGGCCTGG - Intergenic
1089960291 11:122611274-122611296 GAGGACCAGGGAGAGCGGGATGG + Intergenic
1090051649 11:123385363-123385385 GAGGAGTGAGGAGAATGGCATGG - Intergenic
1090236246 11:125149823-125149845 CAGGACTTGGGAGCGTGGAGAGG - Intergenic
1090411272 11:126511619-126511641 GAGGTCCTGGAAGATTGGCAGGG - Intronic
1091157901 11:133390660-133390682 GAGGTCTTGGTACAGTGGGAAGG + Intronic
1091240182 11:134046878-134046900 GAGGTCTGCGGAGAGTTGCAGGG - Intergenic
1091780736 12:3213180-3213202 GAGGACATGGGACTGTGGCTGGG + Intronic
1092246287 12:6866212-6866234 GAGGCCGTGGGAGAATGGCTGGG + Exonic
1096240405 12:49956762-49956784 GAGGACTGGGGAGAGTGAGATGG - Exonic
1096906490 12:54941435-54941457 GAGGAATTGGGAGAAAGGCTTGG + Intergenic
1097266098 12:57745657-57745679 GAGGACTTGGGAGCGGGGCAGGG - Intronic
1102006383 12:109591564-109591586 GAGTAATTGGGAGAGTGCAAGGG + Intronic
1102505917 12:113384545-113384567 GTGGACGTGGGTGGGTGGCAGGG + Intronic
1102525799 12:113511715-113511737 CAGGATTTGAGAGGGTGGCAGGG + Intergenic
1103326464 12:120124641-120124663 GAGGACTTGGGAGAGTGGCAGGG - Intergenic
1104328937 12:127826196-127826218 GAGGACTTAGGAGAGCGGGCTGG - Intergenic
1104574320 12:129952919-129952941 CAGGAGCTGGGAGAGAGGCATGG + Intergenic
1104976481 12:132554212-132554234 GAGGACTCTGGGCAGTGGCAGGG + Intronic
1105008048 12:132735405-132735427 GAGGCTTTGAGAGAGTGGGAAGG - Exonic
1105417179 13:20223534-20223556 GAGGCCTTGGGAAAGTGACACGG + Intronic
1106550893 13:30769795-30769817 GAGGAGTTGGGAGAGGGGGCAGG - Intergenic
1106587219 13:31068033-31068055 AAGGAGTGGGGAGGGTGGCAGGG + Intergenic
1108017704 13:46093751-46093773 GAAGCCTTGGGTAAGTGGCAGGG + Intronic
1108088036 13:46816595-46816617 GTGGACTAGCAAGAGTGGCATGG - Intergenic
1108548573 13:51520835-51520857 CAGAACCTGGGAGAGAGGCATGG - Intergenic
1110412538 13:75220154-75220176 GGGGAGTGGGGAGGGTGGCACGG + Intergenic
1110916741 13:81030595-81030617 AAGGAGATGGGAGAGTGGGAAGG - Intergenic
1111720035 13:91931725-91931747 GAGAACTTGGGAATGAGGCAGGG + Intronic
1112370176 13:98787172-98787194 GAGCCCTTGAGAGAGTGGTATGG - Intergenic
1113458092 13:110463189-110463211 GGGAACCTGGGAGAGAGGCAGGG - Intronic
1113906977 13:113823864-113823886 GAGGACATCGGAGGGAGGCAGGG - Intronic
1114399496 14:22396287-22396309 GATGAAGTAGGAGAGTGGCAGGG + Intergenic
1114652929 14:24297898-24297920 GATGACATAGGAGAGTGGCTAGG - Intronic
1116051602 14:39810447-39810469 GAGGACTAGAGAGAGAGGGATGG + Intergenic
1116399162 14:44484065-44484087 GGGGACTTGGGGGAGTGGTGGGG - Intergenic
1117084569 14:52186085-52186107 GAGGAGTTGGACGAGTTGCATGG + Intergenic
1117992239 14:61445422-61445444 GAGGACTTAGGAAATTGCCATGG + Intronic
1118006491 14:61568475-61568497 GAGGAATTGGGGTAGGGGCAGGG + Intronic
1118007563 14:61577288-61577310 GGGGCCTTGGGAGGGTTGCATGG - Intronic
1118081915 14:62371047-62371069 GAGGACCTGGGAGAGGAGCTTGG + Intergenic
1119381905 14:74234569-74234591 GAGGGCCTGGGGGAGTGGGAGGG - Intergenic
1119395560 14:74323717-74323739 GAGGACTAGGGAGTATTGCATGG - Intronic
1120520020 14:85516264-85516286 TAGGAACTGGTAGAGTGGCAGGG + Intergenic
1121155009 14:91674976-91674998 CAGCAGTTGGGAGAGTGGCCAGG - Intronic
1121884634 14:97532308-97532330 GAGGATTTGGGAGAATGGACAGG + Intergenic
1122368443 14:101213249-101213271 CAGGGCTGGGGAGTGTGGCATGG + Intergenic
1122755198 14:103973319-103973341 GAGGACCTGGGTGTGGGGCACGG + Intronic
1122976900 14:105174507-105174529 GAGGCCTTGGGGGTGGGGCATGG - Intronic
1202860923 14_GL000225v1_random:80367-80389 GAGGAAGTGGGAGAGGGGGAAGG + Intergenic
1123997615 15:25729770-25729792 GGGGGCCTGGGAGTGTGGCATGG - Intronic
1124292157 15:28463152-28463174 GAGAACTTGGGAATGAGGCAGGG + Intergenic
1124411598 15:29442008-29442030 GAGGAATTGGGAGGGAGGGATGG - Intronic
1124844355 15:33275893-33275915 GAGGAGAGGGAAGAGTGGCAAGG - Intergenic
1127816237 15:62611553-62611575 GAGGACTTCAGAGAGAGGCTGGG - Intronic
1128010922 15:64295183-64295205 TAGGACTAGGGAGAGTGGTTGGG - Intronic
1128442972 15:67730721-67730743 TAGGACTAGGGACAGTGCCAGGG + Intronic
1128994989 15:72289240-72289262 GAAGACCTGGGAGGGTGCCAGGG + Exonic
1129112007 15:73342647-73342669 GGGGACTGGGGAGAGGGACAGGG - Intronic
1130383374 15:83391128-83391150 GAAGAGTTGGGAGGGTGGCTAGG + Intergenic
1130715028 15:86325151-86325173 GAAGACTAGAGAGAGAGGCAAGG + Intronic
1130884087 15:88078873-88078895 GAGCACGGGGGAAAGTGGCAGGG + Intronic
1130959404 15:88649804-88649826 GAGGACTGGGGAGAGTGTGCTGG - Intronic
1130972334 15:88742515-88742537 CAGGTCCTGGGAGAGAGGCAGGG - Intergenic
1130992113 15:88881721-88881743 GAGGTCTTGGGGGAGAGACAGGG + Exonic
1131106334 15:89737303-89737325 GAGAACTTGGAAGAGAGGCTGGG + Intronic
1132745961 16:1436412-1436434 CAGGCCCTGGGAGAGGGGCAGGG - Intronic
1132884765 16:2177821-2177843 GAGAACTTAGGAGAGAAGCACGG + Exonic
1133014030 16:2930673-2930695 GAGGGCTTGGGAGAGCCCCAGGG + Exonic
1133441195 16:5822281-5822303 GGGGAATAGGGAGAGGGGCAAGG + Intergenic
1135070916 16:19350854-19350876 GAGAAATTGGGAGAAAGGCAGGG + Intergenic
1136003733 16:27314389-27314411 GAGGACTTCGGAGAGAGAAAGGG + Intronic
1136170547 16:28486688-28486710 GAGGCCTGGGCAGTGTGGCAAGG - Intronic
1137918912 16:52465421-52465443 GAGGTTCTGGGGGAGTGGCAAGG + Intronic
1139482495 16:67238174-67238196 GAGGTCATGGGAGAGGGGCGGGG + Intronic
1139676288 16:68526245-68526267 GAGGAGATGGGAGAGGGGGATGG - Intergenic
1141250163 16:82348644-82348666 GAGGACTTTGGAGAGTTGGAAGG + Intergenic
1141332340 16:83122931-83122953 GGGGACTTCGGAAAGTGGGAGGG - Intronic
1141626686 16:85265120-85265142 GGTGAGTTGGGAGAGTTGCAAGG + Intergenic
1142416662 16:89946938-89946960 GAGGAGCTGGGAGAGAGGCCAGG + Intergenic
1143180821 17:4982941-4982963 GAGAACATGGGGGAGTGGCAGGG - Intronic
1143332758 17:6149530-6149552 GAGGACCTGGGTGAGTGGTATGG - Intergenic
1143383365 17:6509934-6509956 GAGGTCTTGGAAAAGAGGCAGGG - Intronic
1143679428 17:8465274-8465296 GTGACCTTGGGAGAGTGGGAAGG + Intronic
1143687924 17:8534153-8534175 GAGGACTGGGAAGAGAAGCAGGG - Intronic
1143868524 17:9941334-9941356 GAGGAGCCGGGAGCGTGGCATGG - Intronic
1144587717 17:16498021-16498043 GGTGTCTTGGGAGAGTGGTAGGG - Intergenic
1144993364 17:19249396-19249418 GAGGCCTTGGGAAACTGGCCTGG - Intronic
1144998846 17:19289426-19289448 GAGGACTGGGCAGAGTGAGAGGG + Intronic
1146908104 17:36630748-36630770 GAGGAGTTAGGAGATGGGCAGGG + Intergenic
1147227550 17:38991456-38991478 GTGGAATTGGAAGAGTGGCCTGG + Intergenic
1147331964 17:39704617-39704639 AAGGAGATGGGAGAGTGGGAGGG + Intronic
1148050639 17:44768394-44768416 GAGGTCCTGGGAGAGGAGCAAGG - Intronic
1148155767 17:45424650-45424672 GGGGACTTGGGAGTGGGGGAAGG + Intronic
1149282553 17:55124177-55124199 GGGGACTTGGGAGAATGAGATGG + Intronic
1149669323 17:58391876-58391898 CAGGACTGGGGAGAGGGTCAAGG + Intronic
1150387457 17:64773317-64773339 GGGGACTTGGGAGTGGGGGAAGG + Intergenic
1150477863 17:65488147-65488169 GAGGGAGAGGGAGAGTGGCAAGG + Intergenic
1150630072 17:66874062-66874084 AAGGGCTTGGGAGTGGGGCAAGG + Intronic
1151758347 17:76087340-76087362 AAGGATTTGGGAGGGGGGCAGGG + Intronic
1152464339 17:80457334-80457356 GAGGAGTTGGGAGAGGCTCAAGG + Intergenic
1152670302 17:81600255-81600277 GGGGAGTTGGGAGAGTGGCCGGG - Intronic
1152910551 17:83002948-83002970 GCGGACTGCGGAGAGTGGGAGGG - Intronic
1152910586 17:83003063-83003085 GCGGACTGCGGAGAGTGGGAGGG - Intronic
1152910680 17:83003414-83003436 GCGGACTGCGGAGAGTGGGAGGG - Intronic
1152910809 17:83003945-83003967 GCGGACTGCGGAGAGTGGGAGGG - Intronic
1152910864 17:83004139-83004161 GCGGACTGCGGAGAGTGGGAGGG - Intronic
1152910887 17:83004218-83004240 GCGGACTGCGGAGAGTGGGAGGG - Intronic
1155980116 18:32171134-32171156 GAGGCCTGGGGAGAGTGGGGAGG - Intronic
1156426115 18:37014710-37014732 GAGAACTTGGGACAGTACCAAGG + Intronic
1157284053 18:46365097-46365119 GAGGACATGGCAGAGACGCAGGG - Intronic
1157535658 18:48455638-48455660 GAGTCCTTGGCAGAGTGGGAAGG - Intergenic
1157843526 18:50981100-50981122 GAAGACTTGGAAGAGTAGGAGGG - Intronic
1158431223 18:57389335-57389357 GAGGAGAGGGGAGAGTGGGAAGG + Intergenic
1158599345 18:58843769-58843791 CAGGGTGTGGGAGAGTGGCAGGG - Intergenic
1160065320 18:75568517-75568539 GTGGAGTTGTGTGAGTGGCAGGG + Intergenic
1160200470 18:76791873-76791895 GAGGACTAGAGAGACTGACATGG - Intergenic
1160227167 18:77020178-77020200 GAGCAATTGGGAGAGGGACAGGG + Intronic
1160521235 18:79509363-79509385 GGGGACCTGGGGGAGTGGCTGGG - Intronic
1161871466 19:6873720-6873742 GGGGACTTGGAAGGGTGGAAGGG - Intergenic
1161904900 19:7149446-7149468 GAGAACTTGGGAGAAAGGCAAGG - Intronic
1162327677 19:10008475-10008497 CAGCACAGGGGAGAGTGGCAGGG - Intronic
1162402391 19:10454061-10454083 GAGGCCTGTGCAGAGTGGCATGG + Intronic
1162754146 19:12847272-12847294 GAGGACTGGGGACAGGGGCAGGG - Exonic
1163115908 19:15188579-15188601 GAGGACTGGGGAGAGGAGGAGGG - Intronic
1163727913 19:18932893-18932915 CGGGACTTGGGGGCGTGGCAGGG - Intronic
1164455111 19:28400357-28400379 CAGGCCATGAGAGAGTGGCATGG - Intergenic
1165201855 19:34151108-34151130 CAGAACGTGGGAGAGTGGGAGGG - Intergenic
1165856767 19:38883695-38883717 GAGGACTTGGTGGAGGCGCACGG - Exonic
1166367884 19:42286417-42286439 GGGGCCTTGGGAGTGTGGGATGG + Intronic
1166386039 19:42381880-42381902 GAGCACTTGTGAGAGTCGGAGGG - Intergenic
1166518404 19:43463765-43463787 GTGGACTAGGGAGAGGGACAAGG + Exonic
1167265319 19:48480231-48480253 GCGGGCATGGGAGAGTGACATGG - Intronic
1167572522 19:50297979-50298001 GAGGGCATGGGGGAGGGGCATGG + Intronic
1167993657 19:53384194-53384216 GAGGACTGGGCTGTGTGGCATGG + Exonic
925126687 2:1461992-1462014 GAGGACACTGGAGAGTGACATGG - Intronic
925500750 2:4501604-4501626 TAGGAGCTAGGAGAGTGGCATGG + Intergenic
926217746 2:10915657-10915679 GAGGTCTTGGGAGAGAGTTAGGG + Intergenic
927242732 2:20932752-20932774 AAGGGCGTGGGAGAGTGCCAAGG + Intergenic
928238159 2:29563347-29563369 TAGGAATTGGGAGAGGAGCAGGG + Intronic
928964303 2:36962009-36962031 GAGGATTTGAGAGGGTGGAATGG - Intronic
929762194 2:44815618-44815640 GGGGACCTGGGAGAGAGGCCCGG - Intergenic
929946358 2:46375540-46375562 GAGGACCAGGGAGAGTGACCTGG - Intronic
929947268 2:46380800-46380822 GATGGCTGGGGAGAGGGGCAGGG - Intronic
930002130 2:46868692-46868714 GAGGACCTGGGAGAGATGAAGGG + Intergenic
930361907 2:50391131-50391153 AAGGTCTTGGGAGTGAGGCAGGG + Intronic
931758172 2:65392859-65392881 GAAGACTGTTGAGAGTGGCAAGG + Intronic
932564136 2:72894999-72895021 CAGGACTGGGGAGTGGGGCAAGG - Intergenic
933811782 2:86037185-86037207 GGGCACTGGGCAGAGTGGCAGGG - Intronic
934069951 2:88374576-88374598 GGGAAATGGGGAGAGTGGCAGGG + Intergenic
934176588 2:89583613-89583635 GAGGACTGGGGAGTTGGGCAGGG + Intergenic
934286898 2:91657974-91657996 GAGGACTGGGGAGTTGGGCAGGG + Intergenic
934568289 2:95352667-95352689 GAGGACTAGGGGAAATGGCAGGG - Intronic
934613282 2:95756193-95756215 GAGGACTTTGGAGACTAGGATGG - Intergenic
934647612 2:96068227-96068249 GAGGACTTTGGAGAATAGGATGG + Intergenic
934840989 2:97624047-97624069 GAGGACTTTGGAGACTAGGAAGG + Intergenic
935111713 2:100100154-100100176 GAGGAATGGGGTGAGTGGTAGGG + Intronic
936123253 2:109765014-109765036 GAGGAATGGGGTGAGTGGTAGGG - Intergenic
936221430 2:110606451-110606473 GAGGAATGGGGTGAGTGGTAGGG + Intergenic
936491329 2:112975148-112975170 GTGGACTTGGGAAAATGCCAAGG - Intronic
937050209 2:118882379-118882401 GGACACTTGGGAGAGTGGGAGGG + Intergenic
937243914 2:120480082-120480104 GAGGGATTGGGTCAGTGGCATGG - Intergenic
938697583 2:133848536-133848558 GAGGACTGGGGAGGGTGGGGTGG + Intergenic
938814896 2:134892066-134892088 GGGGACTTGGAAGGGTGGGAGGG + Intronic
939386317 2:141503624-141503646 TAGGAATTGGGAGAGAGGGAGGG - Intronic
940543510 2:155052732-155052754 TAGGACTTGGGAGGGTGGGCAGG + Intergenic
940718726 2:157258318-157258340 GGGGACATGGGAAAGGGGCATGG + Exonic
941200378 2:162501388-162501410 GGGTACTTTGGAGAGTGGGAGGG + Intronic
941216596 2:162717497-162717519 GAGGACTTTGAAGAATGACAAGG - Intronic
941516820 2:166490804-166490826 GAGCTTTTGGGAGAGTTGCAGGG - Intronic
941610532 2:167656222-167656244 TAGAACTTGGGAGAGTGGGAGGG - Intergenic
942347210 2:175015949-175015971 GAGGGTCTGGGAGAGTGGGAAGG - Intergenic
942450524 2:176105802-176105824 GAGGCCTTGGGGGAGTGGATGGG + Intronic
942602674 2:177657621-177657643 GGGGAGTGGGGAGAGGGGCAGGG + Intronic
944078657 2:195759884-195759906 CAGGAGTTGGGAGAGCAGCATGG - Intronic
945051463 2:205828050-205828072 GTGGACTTGAAAGAGAGGCAAGG + Intergenic
945221808 2:207491130-207491152 AAGGACTGGGGAGGGTAGCAGGG - Intergenic
945912849 2:215669208-215669230 GGAAACTGGGGAGAGTGGCAAGG + Intergenic
946319176 2:218939767-218939789 CAGGATCTAGGAGAGTGGCATGG + Intergenic
946401243 2:219469439-219469461 GAGAGCTGGGGAGAGGGGCAGGG - Intronic
946413824 2:219529383-219529405 GAGGACTTGGGGGACAGGAAAGG + Intronic
946513990 2:220391794-220391816 GAGGACCAGGGAGAGGGGCAGGG + Intergenic
946595697 2:221303468-221303490 GTGGGGTTGGGAGAATGGCAGGG + Intergenic
948355277 2:237372696-237372718 GAGCACTTGGGGGAGGAGCAAGG + Intronic
948824524 2:240568000-240568022 GTAGACTTGGAGGAGTGGCAGGG + Intronic
1168887229 20:1267994-1268016 CAGGACTTGGGAGATAGGCTGGG + Intronic
1168948324 20:1779666-1779688 GAGCACTTGGGAGAGATTCATGG + Intergenic
1168964764 20:1892733-1892755 CAGGACTGGGGAGGGTGGGATGG - Intergenic
1170799701 20:19580921-19580943 TAGGTCTTGGGAGAGTGGGAGGG + Intronic
1171300829 20:24058959-24058981 GAGGAACTGGGAGTGTGGGAGGG + Intergenic
1172071549 20:32261021-32261043 GAGGACTTGAGAGAAGGGGAGGG + Intergenic
1172120761 20:32597428-32597450 GAGGCCTTGAGTCAGTGGCAGGG + Intronic
1172409762 20:34712158-34712180 GAGAACTTGGGAGAGGAGCAAGG - Exonic
1172428858 20:34874260-34874282 TAGGACTTGGGAGAGAGGATAGG + Intronic
1172778791 20:37423487-37423509 GAGGACATCAGAGAGGGGCATGG + Intergenic
1174733566 20:52941951-52941973 TAGGAATTGGGAAAGAGGCACGG + Intergenic
1175163909 20:57029616-57029638 GAGGAGTTGGAAGTTTGGCAGGG + Intergenic
1176095446 20:63341862-63341884 GGAGACTTGAGAGAGTGGCACGG + Intergenic
1176273467 20:64248521-64248543 GAGACGTTGGAAGAGTGGCAGGG + Intergenic
1177781176 21:25623868-25623890 GAGGACTTGAGAGAAAGGGATGG - Intergenic
1177801993 21:25836956-25836978 CAGGAGCTGGGAGAGAGGCATGG - Intergenic
1178660585 21:34504231-34504253 GAGGAGTTGGGAGAGTGAGAAGG + Intergenic
1178661436 21:34510657-34510679 GAGGACTAAGGAGAGTTTCAAGG - Intergenic
1179393186 21:41012312-41012334 GATGACTCAGGAGAGAGGCACGG + Intergenic
1179501165 21:41809867-41809889 GAAGAATGGGGGGAGTGGCAGGG + Intronic
1179887019 21:44318626-44318648 GGGGACTGGGGAGAGGGGCCAGG - Intronic
1180092313 21:45539424-45539446 GCCGGCTTGGGAGGGTGGCAGGG + Intronic
1181639285 22:24188337-24188359 GGGGTCTTGGGAGAGGGGCTGGG - Intronic
1181790636 22:25263029-25263051 GAGATCATGGGAGAGTTGCAGGG - Intergenic
1182738856 22:32551852-32551874 AAGGACTTGGGGGAGAGGAATGG + Intronic
1183600497 22:38837383-38837405 GAGGGCTTGGGAGAAGGGAATGG - Intronic
1183776788 22:39971333-39971355 GGGGAGTTGGGAGGGGGGCAGGG + Exonic
1183916070 22:41120369-41120391 TAGGACTTGGTACAGTGGAAGGG - Intronic
1183986210 22:41572002-41572024 GGGGACTTGGGGGAGTGGAGCGG - Exonic
1184179305 22:42809286-42809308 GAGGACTTCTGAGAGTGCAAGGG - Intronic
1185021566 22:48379712-48379734 GAGGAAGTGGCAGAGTGGAAAGG + Intergenic
950004294 3:9681796-9681818 GTGGACTTTGGAGTCTGGCAGGG + Intronic
950073596 3:10171498-10171520 GAGGACTTTGAAGACAGGCAAGG + Intronic
950334391 3:12182043-12182065 GAGGATTTGGGAGAGCAGCTGGG - Intronic
951291760 3:20879272-20879294 GAGGACTTGGGGAAGTGGAGTGG + Intergenic
951640065 3:24826989-24827011 GAACATTGGGGAGAGTGGCAGGG - Intergenic
952341638 3:32452189-32452211 GAGGACTGGGGCCAGTGGCTGGG + Intronic
953422656 3:42766348-42766370 GAGGAGGTGGGAGAGAGGGAAGG + Intronic
953773379 3:45796092-45796114 GAGGGCTTGGGAGGGCGGCTTGG + Intronic
953899418 3:46831174-46831196 CAGGACTTGGGAGGGAGGCTTGG - Intronic
954670729 3:52290095-52290117 GAGGACGTGGCTGGGTGGCAGGG + Intronic
954672772 3:52299455-52299477 GAGGACTGCGGCCAGTGGCAAGG + Intergenic
954914297 3:54135767-54135789 GAGGACTTTGGAGAGGGGGCAGG + Intronic
955260335 3:57383007-57383029 GACAAATGGGGAGAGTGGCAGGG + Intronic
955457565 3:59140626-59140648 CAGGAGTGGGGAGGGTGGCAGGG + Intergenic
955739283 3:62072987-62073009 GAGAACGTGGCAGAGTGACAGGG + Intronic
956121830 3:65974288-65974310 GAGCAAATGGGAGAGTGGGAGGG + Intronic
956398277 3:68848770-68848792 GAGGACATGGCAGAGGGGCTAGG - Intronic
956560292 3:70567407-70567429 GAAGCCATGAGAGAGTGGCAGGG + Intergenic
956725539 3:72153600-72153622 CAGGACTCGGGACTGTGGCAAGG - Intergenic
957439372 3:80224052-80224074 GATGACTTGGAAGGGTGGGAGGG + Intergenic
958918756 3:100079114-100079136 GAGGACTGGGGAGAGAGGCCTGG - Intronic
959531537 3:107439567-107439589 GAGGTCATGGGTGAATGGCATGG + Intergenic
961173478 3:124815597-124815619 GAGGGAAGGGGAGAGTGGCAAGG + Intronic
961629338 3:128284799-128284821 GTAGACATGGGGGAGTGGCAGGG - Intronic
962234130 3:133693299-133693321 GAGGGCTTGGGACATGGGCAAGG + Intergenic
962661557 3:137606232-137606254 GGGGACTGGGGAGAGAGGAAGGG - Intergenic
962714377 3:138114621-138114643 CAGGACTTTGGAGAGAGGCCTGG - Intronic
962928272 3:140014719-140014741 GAGGAATAGGGAGAGGAGCAGGG + Intronic
963256658 3:143151885-143151907 GAGCACATGGGACGGTGGCAGGG - Intergenic
964231749 3:154478301-154478323 GAGGACTTGGGAAAATGACTGGG + Intergenic
964804150 3:160588114-160588136 GAGGACTGGGAAGGGTGTCATGG + Intergenic
967642174 3:191878244-191878266 GGGGAGGTGGGAGAGTGTCAAGG - Intergenic
968853519 4:3101318-3101340 GAGGACATGGGAAAGAAGCAAGG - Intronic
968969484 4:3786100-3786122 GTGGACTTGGGAGAAAGGCGAGG + Intergenic
969228593 4:5814758-5814780 GAGGGCTGGGGAGGGGGGCAGGG - Intronic
969270193 4:6094448-6094470 GAGGGCTTGGCAGACAGGCATGG + Intronic
969556024 4:7910906-7910928 GATTACTGAGGAGAGTGGCATGG - Intronic
970206162 4:13657642-13657664 GTGGACTTGGGGAAGTGCCAGGG + Intergenic
972750100 4:41980123-41980145 GAGGACTGGGGAGAGTTGGTAGG - Intergenic
972856477 4:43113735-43113757 GAGGAAAAGGGAGAGTGGGAAGG + Intergenic
974236721 4:59191187-59191209 GAGTAACTGGGAGAGTGTCAAGG - Intergenic
975720826 4:77247115-77247137 GAGCACTTGTGACAGTGTCATGG + Intronic
975847597 4:78541449-78541471 GAGGACTGGGTAGAGTACCATGG + Intronic
976071838 4:81250062-81250084 GAAGACTTGGGAAAGTGGGGGGG - Intergenic
976763935 4:88579552-88579574 GGGGAATTGGGAGAGAGGCTGGG + Intronic
977613670 4:99063522-99063544 AAGGAGTTGGAAGACTGGCAGGG - Intergenic
978663540 4:111155099-111155121 GAAAACTTGGAAGAGGGGCAGGG + Intergenic
980492001 4:133540494-133540516 GGGGGTTTGGGAGAGTGACAGGG + Intergenic
982071328 4:151697462-151697484 GAAGACTTGGAAGGGTGGGAGGG + Intronic
982108456 4:152031670-152031692 GAGGGGTAGGGTGAGTGGCAGGG + Intergenic
983596575 4:169474103-169474125 AAGGACTTGGGAAAGAGGGAAGG + Intronic
984289943 4:177782128-177782150 GAGGATATGGGAGGGGGGCAGGG - Intronic
985115387 4:186584947-186584969 GAAGAATGGGGTGAGTGGCAGGG + Intergenic
985178415 4:187228385-187228407 GAGGGCTCGGGTGAGTAGCATGG - Intergenic
985630183 5:1009846-1009868 GAGGAGCTGGGCGAGTGGGAGGG + Intronic
985784750 5:1887742-1887764 AGGGGCTTGGGAGAGGGGCAGGG - Intergenic
986015597 5:3754530-3754552 GAGAACCTGGGAGAGAGGCTGGG + Intergenic
986685025 5:10268956-10268978 CAGCACTTGGGAGAGGAGCAGGG + Intergenic
987215961 5:15737523-15737545 GAGGACTTGGGAATGTTGGAAGG + Intronic
989080959 5:37620762-37620784 GAGGCCTTGTGAGATAGGCAAGG + Intronic
989358922 5:40577006-40577028 GAGTACTTGGGAGAAAGGGAAGG - Intergenic
990969364 5:61486113-61486135 GAAGACTTGGAAGAGTTGGAGGG - Intronic
991632352 5:68669004-68669026 AAGGATTTGGGAGAGAGACAAGG + Intergenic
992023364 5:72647356-72647378 GTGGACATGGGAGAGGAGCAAGG + Intergenic
992179959 5:74185955-74185977 GATGACTGGGGAGAGTGGAGAGG + Intergenic
992427876 5:76676991-76677013 CAGGATTGGAGAGAGTGGCAAGG - Intronic
992512504 5:77452275-77452297 GAGGACATGGGAGAACAGCAGGG + Intronic
992821669 5:80503965-80503987 GAAGACTAGGGAGAGGGGCTGGG + Intronic
997619425 5:135275782-135275804 GAGGTCTTGGGAGCCTGGCAGGG + Intronic
997952813 5:138255516-138255538 AAGGACATGGGAGATTGGTAAGG - Intronic
998139130 5:139690069-139690091 GAGGGCTGAGGACAGTGGCAGGG + Intergenic
998805360 5:145913098-145913120 CAGGAATTGGGTGAGGGGCATGG - Intergenic
998806706 5:145924080-145924102 GTTGAGTTTGGAGAGTGGCATGG + Intergenic
999036472 5:148357085-148357107 AAGCACTTTGGAGAGAGGCATGG + Intergenic
999230221 5:150057412-150057434 GAGGGGTGGGGAGTGTGGCAGGG - Intronic
999682243 5:154071314-154071336 GAGGGTTTGGGAGAGGGGCAAGG - Intronic
1000013524 5:157256726-157256748 GAGGGCTTGGGAAGGTGGCCTGG + Intergenic
1000674853 5:164108128-164108150 GAGGAATTGGCACAGGGGCAGGG + Intergenic
1001415447 5:171542257-171542279 GGGGACTTGGGAGACAGCCATGG + Intergenic
1001441301 5:171745031-171745053 GAGGACTTGGGGCAGTGCCTAGG + Intergenic
1002433886 5:179219884-179219906 GAGGCCGCTGGAGAGTGGCACGG - Intronic
1002879928 6:1242302-1242324 GAGGACTGGGCAGAGCTGCACGG + Intergenic
1003106515 6:3220703-3220725 GAAGACTGGGGAGAGGGGTATGG + Intergenic
1003353801 6:5345980-5346002 GAGTACTGGGGATGGTGGCAGGG + Intronic
1004505295 6:16242266-16242288 GAGAACATGGCAGAGTGGCTGGG + Intronic
1005257865 6:24023577-24023599 GACGACATGGGAGTGGGGCAGGG - Intergenic
1005684902 6:28244895-28244917 GAGGCCATGGGAGAGTGGTCTGG - Exonic
1006268980 6:32949476-32949498 GATGACATGGGAGACTGGGATGG + Intronic
1006362623 6:33595247-33595269 GGAGACCTGGGAGAGTGGCCTGG + Intergenic
1006411356 6:33875675-33875697 GAGGGCTAGGGAGAGTGGGTTGG + Intergenic
1006440677 6:34051824-34051846 GAGCTCTTGGGAGAATGGGAGGG + Intronic
1006987403 6:38185067-38185089 GAGGACCTGGGAGGGTGGGAGGG - Intronic
1007654578 6:43444636-43444658 GAGGATATGGGGTAGTGGCAGGG + Intronic
1007846438 6:44761125-44761147 GAGGCCTTGGGACAGTGCCTGGG - Intergenic
1007977341 6:46114866-46114888 GGGGACTTGGGAGAGTGATATGG + Intergenic
1008128722 6:47696639-47696661 GAGCACTAGGGAGAGAGGGAGGG + Intronic
1008632968 6:53381679-53381701 GAGGGCCTGGGAGAGGGGCCGGG - Intergenic
1009845873 6:69133848-69133870 GTGGACTTTGGAGACTTGCAGGG - Intronic
1010677955 6:78766742-78766764 GAGGAAGTGGGAGAGTGGGGAGG - Intergenic
1011176037 6:84561235-84561257 AAGGTCTTGGCAGGGTGGCAAGG + Intergenic
1011443626 6:87413457-87413479 GAAGACTTGGGAGGGTGAGAGGG + Intronic
1012466104 6:99517844-99517866 GAGGAAATGGGAGTGTGGGAAGG - Intronic
1012863525 6:104590758-104590780 GAAGACTTGGGATATTGGAAAGG - Intergenic
1013417730 6:109939735-109939757 TAGGGCTGGGGAGACTGGCAGGG - Intergenic
1013541072 6:111110019-111110041 GAGGACTCTGGAGAGTTACAGGG + Intronic
1016857118 6:148682248-148682270 AAGGACTGGGAAGAGTAGCAAGG - Intergenic
1017590300 6:155972180-155972202 GAGGAGTGGGGAGAGTGGCAGGG + Intergenic
1018595096 6:165470750-165470772 GAGGACCTGGGAGGCTGACAGGG + Intronic
1018852901 6:167653929-167653951 GAGGAAGTGGGACAGTGGCATGG - Intergenic
1018982314 6:168611098-168611120 GAGGACCTGGGAGGATGTCAGGG - Intronic
1019166681 6:170101852-170101874 GAGGACTGGGGTGGGTGGCATGG + Intergenic
1019482099 7:1271726-1271748 GAGGCCCTGGGAAAGTGGCCTGG + Intergenic
1021541294 7:21761691-21761713 GTGGGCCTGGGAGGGTGGCATGG - Intronic
1021919800 7:25473435-25473457 AAGGACTTGGGGGAGGTGCAAGG + Intergenic
1022152847 7:27626844-27626866 GAAGACTTGGGAGAAAGGGATGG + Intronic
1023640439 7:42251470-42251492 GGGGAGTTGGGGGAGTGGCTGGG + Intergenic
1023992059 7:45134349-45134371 GAGGGCTGGGGAGGCTGGCAGGG + Intergenic
1024937218 7:54722624-54722646 GAGAAAGAGGGAGAGTGGCAGGG - Intergenic
1024973009 7:55087839-55087861 GAGGACGAGGGAGGGTGGGAAGG - Intronic
1025620585 7:63166602-63166624 GAGAACCTAGGAGAGAGGCATGG - Intergenic
1027107583 7:75415150-75415172 GATGACATGGGAGCCTGGCAGGG - Intergenic
1029425933 7:100493994-100494016 GACTACGTGGGAGAGTGCCAGGG + Exonic
1029950335 7:104577312-104577334 GAGGGCATGGGAGAATGTCAGGG + Intronic
1030233795 7:107236494-107236516 GAGGTCTTATGAGACTGGCATGG + Exonic
1032054821 7:128675754-128675776 GAGGACATTGGGGAGTGGCAGGG - Exonic
1033114198 7:138610965-138610987 GCGGTCTTAGGAGGGTGGCAGGG - Intronic
1034757370 7:153635436-153635458 GAGGAATGGGGAGAGAGGGAGGG - Intergenic
1035097616 7:156368143-156368165 GAGGACGTGGGACACTGGAAGGG + Intergenic
1035353155 7:158260864-158260886 GAGGACCTGCCAGAGTGGCAGGG - Intronic
1036660119 8:10702400-10702422 GAGGAGTTGGGAGAGTCACAGGG + Intronic
1037029399 8:14084313-14084335 GAGGACTTGAGGCAATGGCATGG - Intergenic
1037466551 8:19166998-19167020 GAGGACTTAGGAGTTTGGCAGGG + Intergenic
1038152671 8:24956568-24956590 GAGGACAGGGGAGAGAGGGAAGG + Exonic
1038411627 8:27363620-27363642 GAGGACTTGCAAGAAGGGCAGGG - Intronic
1040337494 8:46423476-46423498 GATGACGTGGGCGAGTGACAGGG + Intergenic
1040960292 8:53024772-53024794 AAGGACTGGGGAGAGAGGGAAGG - Intergenic
1041192589 8:55368496-55368518 GAAGACCTGGGAGAGTGAAAGGG - Intronic
1041660594 8:60397586-60397608 GAGCGCTAAGGAGAGTGGCAGGG - Intergenic
1041714324 8:60920486-60920508 GAGGACTTGGGGTAGTGGAGGGG - Intergenic
1044016099 8:87050225-87050247 GAGGATTTGGGAAAGGGGAAAGG + Intronic
1047090702 8:121572534-121572556 GTGGACTTGGAAGAGTGGGAGGG + Intergenic
1047332007 8:123898434-123898456 GGGGACTTGGAAGAGTAGGAGGG - Intronic
1047624347 8:126640809-126640831 GAGGACTTTGGTGATGGGCAGGG - Intergenic
1047649879 8:126909209-126909231 GAAGACCTGGGGCAGTGGCAGGG + Intergenic
1047770717 8:128027997-128028019 GAGGACTGGGGAGAGATGCAAGG - Intergenic
1048344527 8:133566670-133566692 GCTGATTTGGGAGGGTGGCATGG - Intronic
1048857008 8:138694420-138694442 GAGAACTGGGGAGGGTGGCCTGG + Intronic
1049194785 8:141308928-141308950 GAGGTCTTCGGAGGGTGGCAGGG - Intergenic
1049306273 8:141905946-141905968 GAGTCTTTGGGAGAGTGGCATGG - Intergenic
1049439538 8:142602836-142602858 GGGGGCTAGGGAGAGTGGGAAGG + Intergenic
1049536343 8:143184154-143184176 GAGGACCTGGGAGGACGGCAGGG + Intergenic
1049697031 8:143989252-143989274 GAGGACTTGGGAGCTAAGCAGGG + Intronic
1049795382 8:144494955-144494977 GAGGACTTGGGAGCCTGGGCAGG + Intronic
1049874022 8:145003525-145003547 GAGGACTTACGAGAATGGAAAGG + Intergenic
1050376190 9:4975855-4975877 GAGAACGTGGGAGAGGGGCCAGG + Intergenic
1050445305 9:5715820-5715842 GAGGAGTGGGGAGAGAGGTAGGG - Intronic
1051062062 9:13056073-13056095 GAGGACCTGGGAGAGAGGAGAGG - Intergenic
1051135307 9:13913491-13913513 GGAGACTTGGAAGAGTGGAAGGG - Intergenic
1051264936 9:15301032-15301054 GAGCACTTGGTACAGTGGGAAGG - Intronic
1053416984 9:37953068-37953090 GAGGAGATGGAAGAGTGGCCAGG + Intronic
1053575552 9:39355549-39355571 GAGGAGGAGGGAGAGGGGCAGGG - Intergenic
1055415053 9:76072764-76072786 GAGGACTTGGGGATGGGGCACGG - Intronic
1057821185 9:98332290-98332312 CAGGACCTGGGAGGTTGGCAGGG + Intronic
1060272854 9:122159511-122159533 GAGGACTGGGGAGGGGGGCCCGG + Intronic
1060422460 9:123479153-123479175 GAGGACTTGGGCAAGTTGCCTGG - Intronic
1061365680 9:130171744-130171766 GGGGACCTGGGAGAAGGGCAGGG - Intergenic
1062205658 9:135335408-135335430 GAGGACTTGGGTATGGGGCAGGG + Intergenic
1187197220 X:17099313-17099335 GAGGAATGGGGAGGGTGGAAAGG - Intronic
1187656336 X:21479061-21479083 GGGGACTTAGAAGAGTGGAACGG - Intronic
1188469035 X:30516576-30516598 GGAGACGTGGGAGAGTGGGAGGG + Intergenic
1188987259 X:36778990-36779012 GAGGATTTGGCAGAGGTGCATGG - Intergenic
1190205352 X:48398323-48398345 GAGGATTTGGGATAGGGGGAAGG + Intergenic
1190311926 X:49122796-49122818 GTGGGGTTGGGAGAATGGCAGGG + Intronic
1190653759 X:52593012-52593034 GAGGTCTGGGGAAAGGGGCAGGG - Intergenic
1190669471 X:52727151-52727173 GAGGATTTGGGATAGGGGGAAGG - Intergenic
1190669946 X:52731253-52731275 GAGGATTTGGGATAGGGGGAAGG + Intergenic
1194398628 X:93416169-93416191 CAGGACATGAGAGAGTGGCATGG + Intergenic
1195364945 X:104116502-104116524 GAGGACAGGGGAGAGGGGGAGGG + Intronic
1196231767 X:113232454-113232476 GAGGACTTGGGAGAAAGGGTGGG - Intergenic
1196734645 X:118973705-118973727 GGGGGCGTGGGAGAGTGGCAGGG - Intergenic
1197822881 X:130559558-130559580 TGGGACTGGGGAGAGTGGCAGGG - Intergenic
1197845603 X:130798773-130798795 GAGGACAGGGGTGAGTGGCCTGG - Intronic
1198999090 X:142611354-142611376 GAGGACTTGGGAGAAAGGATGGG + Intergenic
1200064938 X:153499778-153499800 TGGGGCCTGGGAGAGTGGCAGGG + Intronic
1201257034 Y:12118134-12118156 GGGGACTTGGAAGGGTGGGAGGG - Intergenic
1201798202 Y:17924666-17924688 AAGGCCTTGGGAGATTGGAATGG + Intergenic
1201803351 Y:17981291-17981313 AAGGCCTTGGGAGATTGGAATGG - Intergenic
1201865431 Y:18648020-18648042 GTGGGGTTGGGAGAGTGGGAAGG + Intergenic
1202359527 Y:24093357-24093379 AAGGCCTTGGGAGATTGGAATGG + Intergenic
1202511251 Y:25576757-25576779 AAGGCCTTGGGAGATTGGAATGG - Intergenic