ID: 1103326465

View in Genome Browser
Species Human (GRCh38)
Location 12:120124642-120124664
Sequence GGAGGACTTGGGAGAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 455}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103326465_1103326473 15 Left 1103326465 12:120124642-120124664 CCTGCCACTCTCCCAAGTCCTCC 0: 1
1: 0
2: 3
3: 48
4: 455
Right 1103326473 12:120124680-120124702 GACAAAGAGAATGTACCTGAAGG 0: 1
1: 0
2: 3
3: 12
4: 255
1103326465_1103326474 20 Left 1103326465 12:120124642-120124664 CCTGCCACTCTCCCAAGTCCTCC 0: 1
1: 0
2: 3
3: 48
4: 455
Right 1103326474 12:120124685-120124707 AGAGAATGTACCTGAAGGTCTGG 0: 1
1: 0
2: 2
3: 31
4: 519
1103326465_1103326469 -7 Left 1103326465 12:120124642-120124664 CCTGCCACTCTCCCAAGTCCTCC 0: 1
1: 0
2: 3
3: 48
4: 455
Right 1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103326465 Original CRISPR GGAGGACTTGGGAGAGTGGC AGG (reversed) Intergenic
900143793 1:1149539-1149561 GGAGGAGGTGGCTGAGTGGCTGG + Intergenic
900634324 1:3654595-3654617 GAAGGGCTTGGGAGAGTGCCTGG + Intronic
900719622 1:4166832-4166854 GGAGGAGTTGGGGGAGGAGCAGG - Intergenic
900996446 1:6125775-6125797 TGAGGACTTTGAAGAGAGGCCGG - Exonic
901134581 1:6984673-6984695 GCAGGACCTGGGCCAGTGGCCGG + Intronic
901275435 1:7987342-7987364 GGAGTCCTTGGGGGAGGGGCTGG + Intergenic
901401018 1:9015083-9015105 GCAGGGCCTGGGAGAGTAGCCGG + Intronic
901483010 1:9539270-9539292 GAATGACTGGGGAGAGGGGCTGG - Intergenic
901880585 1:12191547-12191569 GCAGGACTGCGGAGAGTAGCGGG + Intronic
902387135 1:16082479-16082501 GGAGGCCTTGGGTCAGTGTCTGG + Intergenic
902573029 1:17359164-17359186 GTAGGACCTGGGACAGTGTCAGG - Intronic
903281980 1:22255307-22255329 GCAGGTCTGGGGAGAGGGGCAGG - Intergenic
903445331 1:23419040-23419062 GGAAGCCTTGGGACAGTGCCTGG - Intronic
903604175 1:24562854-24562876 GGTGAACTTGGCAGAGTGCCAGG + Intronic
903694013 1:25194473-25194495 GGGGGACTTTGGGGCGTGGCTGG - Intergenic
904896953 1:33824674-33824696 GGAGGAATGGGGAGGGTGGGAGG + Intronic
905400270 1:37696907-37696929 GGAGCATTTGGGAGAGAGGTGGG + Intronic
906191996 1:43904846-43904868 GGAGGAGGAGGAAGAGTGGCAGG - Intronic
906192070 1:43905114-43905136 GGAGGAGGAGGAAGAGTGGCAGG - Intronic
906192296 1:43905953-43905975 GGAGGAGAGGGGAGAGTGGTGGG - Intronic
906192308 1:43905989-43906011 GGAGGAGGGGGAAGAGTGGCGGG - Intronic
906192439 1:43906459-43906481 GGAGGAGAGGGGAGAGTGGTGGG - Intronic
906192451 1:43906495-43906517 GGAGGAGGGGGAAGAGTGGCGGG - Intronic
906192467 1:43906558-43906580 GGAGGAGGAGGAAGAGTGGCGGG - Intronic
906192475 1:43906591-43906613 GGAGGAGGAGGAAGAGTGGCAGG - Intronic
906192481 1:43906624-43906646 GGAGGAGGGGGAAGAGTGGCAGG - Intronic
906274515 1:44506234-44506256 GAAGGACTTGGGAGGGTGGCAGG + Intronic
906518389 1:46452946-46452968 AGAGGACATGGGGGAGTGGGAGG - Intergenic
906525862 1:46492992-46493014 CGAGGCCTGGAGAGAGTGGCGGG - Intergenic
906650550 1:47509396-47509418 GGAGGAGCTGGGAGAGGGGCAGG + Intergenic
906666236 1:47624073-47624095 GGAGCACTTAGGAGAGGGCCTGG - Intergenic
907119131 1:51993211-51993233 AGAGGACTTGATAGAGTGGTAGG + Intergenic
907265596 1:53258374-53258396 TGTGTACTTGGGAGAGTGGCTGG + Exonic
907431089 1:54411957-54411979 GGTGGAGTTGGGGGAGTGGTGGG - Intronic
907864384 1:58385488-58385510 GGAGGTCTTGGCAGTGTGGTGGG - Intronic
908115554 1:60936728-60936750 GGAGGGCTTGGGAGAATTACCGG - Intronic
912468538 1:109890757-109890779 GGAGGACATGAGAGAGGAGCAGG - Intergenic
912674355 1:111663509-111663531 GTAGCACTTAGGAGAGTGCCTGG - Intronic
913971896 1:143422680-143422702 GGAGGACTGGGGAGTTGGGCTGG + Intergenic
914066275 1:144248293-144248315 GGAGGACTGGGGAGTTGGGCTGG + Intergenic
914112878 1:144718061-144718083 GGAGGACTGGGGAGTTGGGCTGG - Intergenic
914705007 1:150163088-150163110 AGAGGGGTTGGGAGAGCGGCTGG - Intronic
914812270 1:151037664-151037686 TGAGGACGTGTGAGGGTGGCTGG + Intronic
915530077 1:156498281-156498303 GGAGGACTTGGAGGGGTGGCAGG - Intronic
917435473 1:175016955-175016977 GGAGGACTAGGGGGTATGGCGGG - Intronic
917667543 1:177239908-177239930 GGAGAGCTTGGCAGGGTGGCAGG - Intronic
918149914 1:181789526-181789548 GAAGGACTGGGGTCAGTGGCTGG - Intronic
918480657 1:184974083-184974105 GGAGGGCTTGGGAGCGAGGCAGG - Intronic
919440018 1:197621108-197621130 GGAGGAAGTGGGAGAATGGCAGG + Intronic
920029864 1:203030364-203030386 GGAGGCCTGGGGAGTGGGGCCGG + Intronic
920298789 1:204975928-204975950 GTAGGACTTAGGACACTGGCAGG + Intronic
920693106 1:208161775-208161797 GGAGGGCAGGGGAGAGAGGCTGG - Intronic
921302695 1:213765700-213765722 GGAGTAGTAGGGAGAGGGGCTGG - Intergenic
921783237 1:219194283-219194305 GGAGGACTAGGAAGAGTGTAGGG + Intronic
923209606 1:231791500-231791522 AGAGAATTTGGGAGAGTGTCTGG + Intronic
923215007 1:231840616-231840638 TTAGGAATTGGGAGAGGGGCTGG + Intronic
923473236 1:234310632-234310654 GAAGGACATGGGTGGGTGGCAGG - Intronic
923685090 1:236148135-236148157 TGGGGACTTAGGAGAGGGGCAGG + Intronic
924242911 1:242057330-242057352 GGTGGAGGTGGGAGAGGGGCTGG + Intergenic
924581858 1:245330447-245330469 GGAGGACTAGAGGGAGTGGGAGG + Intronic
924953359 1:248906035-248906057 GGAGGGTAAGGGAGAGTGGCGGG + Intergenic
1062883588 10:998754-998776 GCAGGACTTGGGAGGGTGAGGGG + Intronic
1063241538 10:4174666-4174688 GGCTGAGGTGGGAGAGTGGCTGG + Intergenic
1064222680 10:13455353-13455375 GGAGGGGTGGGGAGAGTGGAGGG + Intronic
1064714595 10:18163746-18163768 GGAGGAAGTGGTAGAGTGGGTGG + Intronic
1065596499 10:27318546-27318568 GGAGGAGTTGGGGGAGAGGAAGG - Intergenic
1067064363 10:43095379-43095401 GGAGGGCTTTGGAGAGATGCTGG - Intronic
1067306734 10:45071512-45071534 GGTGGAGAAGGGAGAGTGGCGGG - Intergenic
1067528016 10:47050027-47050049 GGAGCACTATGGAGAGTGGTGGG - Intergenic
1068298169 10:55103028-55103050 GGAGGATGTGGAAGAGGGGCAGG + Intronic
1068429647 10:56914111-56914133 TGGGGACTTGGGAGAATGGATGG - Intergenic
1069303441 10:66937785-66937807 GGAGGACTTGGGAGGGAGGAAGG - Intronic
1069640760 10:69954101-69954123 GGAGGAGTGTGGAGGGTGGCTGG - Intronic
1070145547 10:73771255-73771277 GCAGGACATGACAGAGTGGCAGG - Exonic
1070330310 10:75411740-75411762 GGATGTCTTGGGAGACTGGGTGG - Intergenic
1070572435 10:77650284-77650306 GGAGGCCCTGGGAGGCTGGCAGG + Intergenic
1070915769 10:80153659-80153681 GGAGTTCTTGGGAGAGCAGCAGG + Exonic
1071470248 10:85979186-85979208 GGAGGCCATGGGAGGGGGGCTGG - Intronic
1072030125 10:91511553-91511575 GGAGGAGTGGGGAGAGTGGGAGG + Intronic
1073104913 10:101027029-101027051 GGAGCACCTGGGGGAGAGGCTGG - Intronic
1073118741 10:101108425-101108447 TGAGGGCTATGGAGAGTGGCAGG - Intronic
1074813773 10:117129835-117129857 GAAAGAGTTGGGACAGTGGCAGG + Intronic
1075743874 10:124712913-124712935 TGAGGACTTGGGAGGTGGGCAGG - Intronic
1075885015 10:125892392-125892414 GGAGGATTTGGGTCAGTGACTGG - Intronic
1076055403 10:127368351-127368373 GGATGATTTAGGAGAATGGCTGG - Intronic
1076674847 10:132142493-132142515 GGAGGCCGGGGGAGAGGGGCCGG - Intronic
1076776885 10:132702908-132702930 TGTGGGCTTGGGGGAGTGGCAGG + Intronic
1076785692 10:132748850-132748872 GGAGGACCAAGGAGAGGGGCTGG - Intronic
1076816734 10:132918782-132918804 GGAGGAGTTGGGAGAGCCACAGG - Intronic
1076917160 10:133430020-133430042 GCAGGACTGGGCAGAGTGGCTGG + Intergenic
1076937255 10:133574779-133574801 GCAGGACTGGGCAGAGTGGCTGG + Intergenic
1077785989 11:5383966-5383988 GGGGGACATGGGAGAGAGGAGGG + Intronic
1078489255 11:11754202-11754224 GTAGGACATGTGAGTGTGGCAGG - Intergenic
1080571164 11:33558429-33558451 GGAGGATATGGGAGAGAGGGAGG - Intronic
1082011063 11:47449767-47449789 GAAGGACTTAGGACAGTGCCCGG + Intergenic
1083628783 11:64085409-64085431 GGAGGGCGGGGGAGACTGGCAGG + Intronic
1084042076 11:66547983-66548005 AGAATACTTTGGAGAGTGGCAGG + Intronic
1084179880 11:67440927-67440949 GGAGGCCATGGGGGAGTGGTGGG + Intronic
1084488506 11:69464740-69464762 GGAGGACTGGGGAGAGGGCAGGG + Intergenic
1084488829 11:69467000-69467022 GGAGGACCAGGGACAGTGGAAGG + Intergenic
1085296175 11:75433047-75433069 GGAGCACTTGGGAGAGGGTATGG - Intergenic
1085446516 11:76604429-76604451 GGAGCAGGTGGGAGAGAGGCGGG - Intergenic
1086066797 11:82754151-82754173 GGAGGATTTGGCAGAGAGGCTGG - Intergenic
1086828092 11:91524954-91524976 GGAGCATTAGGGAAAGTGGCTGG - Intergenic
1087185454 11:95187935-95187957 GTAGGACTTTGGTGACTGGCAGG - Intronic
1088059345 11:105627317-105627339 GGAGGGGTTGGGAGAGGGACTGG + Intronic
1088930095 11:114342554-114342576 GGAGGACTTAGGAGTGGGGTGGG + Intergenic
1089119970 11:116126768-116126790 GGGGGACTTGGGGGACTGGGGGG + Intergenic
1090652523 11:128819942-128819964 GGAGAAATTGGAAGTGTGGCTGG + Intergenic
1091399919 12:175438-175460 GGAGCACTAGACAGAGTGGCTGG + Exonic
1091635561 12:2194133-2194155 GGAGGAGGAGGGAGAGTGGGAGG - Intronic
1091780735 12:3213179-3213201 GGAGGACATGGGACTGTGGCTGG + Intronic
1092036942 12:5344326-5344348 GGAGGTCATGGGAGTGTGGGCGG + Intergenic
1092246286 12:6866211-6866233 GGAGGCCGTGGGAGAATGGCTGG + Exonic
1095827632 12:46546780-46546802 GGAGGAATTGGCAGGGTGGGAGG + Intergenic
1095835922 12:46638473-46638495 GGAGCACATGGGAGAGGGACTGG - Intergenic
1095930007 12:47615885-47615907 GGAGGACTGGGGAGGAAGGCTGG + Intergenic
1096480280 12:51935639-51935661 AGTGGACTTTGGAGAGAGGCAGG + Intergenic
1096992671 12:55817895-55817917 GGTGGAACTGGGAGAGGGGCGGG + Intronic
1097266099 12:57745658-57745680 AGAGGACTTGGGAGCGGGGCAGG - Intronic
1102416962 12:112772208-112772230 GGAGGAATTGGGTGACTTGCCGG - Intronic
1102444936 12:112994783-112994805 GGAGGTCTGGGGACAGGGGCTGG - Intronic
1102505916 12:113384544-113384566 GGTGGACGTGGGTGGGTGGCAGG + Intronic
1102525798 12:113511714-113511736 GCAGGATTTGAGAGGGTGGCAGG + Intergenic
1103326465 12:120124642-120124664 GGAGGACTTGGGAGAGTGGCAGG - Intergenic
1103727117 12:123003495-123003517 GGAGGACCTGGAATGGTGGCTGG - Intronic
1103957050 12:124582994-124583016 GGAGGACATGGGCCAGTGGTGGG + Intergenic
1104312243 12:127663842-127663864 AGAGGCCTTCGGAGAATGGCAGG - Intergenic
1104787378 12:131458135-131458157 GGAGGACTTGGGCGTGTGTTTGG - Intergenic
1104976480 12:132554211-132554233 GGAGGACTCTGGGCAGTGGCAGG + Intronic
1105243634 13:18628766-18628788 GGAGGAGCTGGAAGAGAGGCCGG + Intergenic
1106381262 13:29241937-29241959 GCAGGAAATGGGAGTGTGGCAGG - Intronic
1107651490 13:42549634-42549656 GGAGGGCATGGGAGTGGGGCTGG + Intergenic
1109178051 13:59179682-59179704 GGAGAATTTGGGTGAGGGGCAGG - Intergenic
1111720034 13:91931724-91931746 GGAGAACTTGGGAATGAGGCAGG + Intronic
1112319785 13:98395699-98395721 GGAGGACTTCGCAGAGTGCGGGG - Intronic
1112696105 13:101949934-101949956 GGAGGTCTTGGGCAGGTGGCAGG + Intronic
1113896296 13:113766427-113766449 CCAGGACCTGGGACAGTGGCAGG + Intronic
1114360373 14:21965662-21965684 GGGAGACTGGGGAGAGTGGGGGG + Intergenic
1114656175 14:24316803-24316825 GGAGGGCGTGGGAGCGTGGGAGG + Exonic
1116399163 14:44484066-44484088 TGGGGACTTGGGGGAGTGGTGGG - Intergenic
1116957014 14:50935106-50935128 GGTGGTCTTGGGAGACTTGCTGG - Exonic
1117378756 14:55139104-55139126 GAAAGACTTGGGGGAGTGGGTGG + Intronic
1117911835 14:60644030-60644052 GGCGGAGCTGGGAGAGTGGAGGG + Exonic
1118350526 14:64970341-64970363 GGAGGACTTGGGGAAGAGGCAGG - Intronic
1118884327 14:69853820-69853842 GGAGGACTTTGCAGAGTGGAAGG + Intergenic
1119381906 14:74234570-74234592 GGAGGGCCTGGGGGAGTGGGAGG - Intergenic
1120948058 14:90016400-90016422 GGAGGACTTGGGAGGGTGTGAGG - Intronic
1121304377 14:92896959-92896981 GGTGGGCTGGGGAGAGTGGAGGG - Intergenic
1121308033 14:92919180-92919202 GGAAGTCATGGGAAAGTGGCTGG + Intergenic
1121646059 14:95517361-95517383 GCAGGGGTTGGGAGAGTGGGAGG - Exonic
1122250654 14:100437132-100437154 TGAGGGCTCAGGAGAGTGGCAGG + Intronic
1122338823 14:101011582-101011604 GGTGGAGTTGGGAGAGTTGGAGG - Intergenic
1122883639 14:104700989-104701011 GGAGGACTCGGGGGAGCGGGAGG - Intronic
1122895196 14:104753309-104753331 GGAGGTCTTCGGTGAGTGTCGGG + Exonic
1202873024 14_GL000225v1_random:181562-181584 GGAGGATTTGGGTCAGTGACTGG + Intergenic
1123843240 15:24270056-24270078 GGAGTACAGGCGAGAGTGGCTGG - Intergenic
1123862947 15:24486737-24486759 GGAGTACAGGCGAGAGTGGCTGG - Intergenic
1124378384 15:29143369-29143391 GGAGGAGCAGGGAGAGGGGCTGG + Intronic
1125106207 15:35974430-35974452 GGAAGAGTGGGGAGAGTGTCGGG - Intergenic
1125142081 15:36420094-36420116 GGAGGACCAGGGACAGTGGTCGG + Intergenic
1125721296 15:41846386-41846408 GGAGGACTTTGGAGAGAAGCAGG - Intronic
1126867026 15:52947843-52947865 GGAGGCCATGAGAGACTGGCTGG + Intergenic
1127385069 15:58460487-58460509 GGAGGGCTTGGTAGAGTGTCTGG - Intronic
1127816238 15:62611554-62611576 AGAGGACTTCAGAGAGAGGCTGG - Intronic
1127974094 15:63984461-63984483 GGAGTCCATGGCAGAGTGGCAGG + Intronic
1128010923 15:64295184-64295206 ATAGGACTAGGGAGAGTGGTTGG - Intronic
1128194953 15:65744543-65744565 GGAGGACTGGGCAGGGTGGAGGG - Intronic
1128565449 15:68697956-68697978 TGAGGTGCTGGGAGAGTGGCGGG + Intronic
1128874176 15:71188611-71188633 GCAGGCCATGGGAGAGGGGCAGG - Intronic
1128994988 15:72289239-72289261 GGAAGACCTGGGAGGGTGCCAGG + Exonic
1129519767 15:76178265-76178287 GGAAGACTGGGGACAGAGGCTGG + Intronic
1129644242 15:77415811-77415833 GGTGGGCGTGGGAGACTGGCTGG - Intronic
1129846569 15:78770557-78770579 GGAGGACTGAGGGGTGTGGCGGG + Intronic
1130992112 15:88881720-88881742 GGAGGTCTTGGGGGAGAGACAGG + Exonic
1131070691 15:89463862-89463884 AGAGGACTTTGGAAAGTGGAGGG - Intergenic
1131106333 15:89737302-89737324 AGAGAACTTGGAAGAGAGGCTGG + Intronic
1131219593 15:90571246-90571268 AGAGGAGTTCAGAGAGTGGCTGG + Intronic
1135861402 16:26059179-26059201 AGAGGTCTTGTCAGAGTGGCAGG + Intronic
1136267350 16:29129560-29129582 AAAGCACTCGGGAGAGTGGCAGG - Intergenic
1138559486 16:57792172-57792194 GGAGAACATGGGGGAGTGGTGGG + Intronic
1139482494 16:67238173-67238195 AGAGGTCATGGGAGAGGGGCGGG + Intronic
1140078341 16:71722993-71723015 GCAGGAATTGGGGGAGTGGGAGG - Intronic
1140553908 16:75897785-75897807 TGAGGACTTCAGAGAGTGACAGG - Intergenic
1140576482 16:76175742-76175764 AGAGTACTTGGCAGAGTGTCTGG - Intergenic
1140818382 16:78641087-78641109 GGAGGGTTTGGGAGAGAAGCAGG + Intronic
1141150886 16:81564016-81564038 GGACGAAATGGGAGAATGGCTGG - Intronic
1141664055 16:85456819-85456841 GCGGGGCTTGGGAGTGTGGCGGG - Intergenic
1141921111 16:87136043-87136065 GGAGGAGTTGGGGGTGGGGCGGG + Intronic
1142070642 16:88089883-88089905 AAAGCACTCGGGAGAGTGGCAGG - Intronic
1142264832 16:89058857-89058879 GAAGACCATGGGAGAGTGGCCGG + Intergenic
1142959486 17:3543522-3543544 GGAGGAGTTGGTAGAGTTGCTGG - Exonic
1143180822 17:4982942-4982964 TGAGAACATGGGGGAGTGGCAGG - Intronic
1143383366 17:6509935-6509957 GGAGGTCTTGGAAAAGAGGCAGG - Intronic
1143761256 17:9105782-9105804 GGGGGACTTGGGGGAGGGGGAGG - Intronic
1143954345 17:10657024-10657046 GGAGGACAGGGGAGAGTGTGTGG + Intronic
1144405492 17:14949056-14949078 GGAGGTGCTGGAAGAGTGGCAGG + Intergenic
1144649413 17:16997886-16997908 CGAGGCCTTGGGTGAGGGGCTGG + Intergenic
1144931693 17:18864244-18864266 GGAGGACCTGGGATCGAGGCTGG + Intronic
1145325575 17:21821040-21821062 GGAAGACTAGGGATAGTGGATGG + Intergenic
1145986266 17:29048980-29049002 GGAGGAATTGGGAGAGGAGACGG - Intronic
1146476180 17:33164460-33164482 AGAGGAATTGGGTCAGTGGCTGG - Intronic
1147240101 17:39085294-39085316 GAAGGCCCTGGGAGAGTGGATGG + Intronic
1147245201 17:39115661-39115683 GGAGCATTTGGGAGCGTGGGAGG + Intronic
1147412769 17:40265444-40265466 GGAGGAGTGGGGAGAGAGTCAGG + Intronic
1147486025 17:40815204-40815226 AGGGGAGTTGGGAGATTGGCAGG + Intergenic
1147557972 17:41491658-41491680 GGAGAACTGGGGAGATTGGGTGG - Intronic
1147919539 17:43907428-43907450 GGAGGTCTTGGGATAGGAGCTGG + Intronic
1148018489 17:44538838-44538860 GGGAGACTTGGGGGAGTGGAGGG + Intergenic
1148489128 17:48012100-48012122 GGAGGGGTTGGGTGAGGGGCTGG - Intergenic
1148612353 17:48972736-48972758 GGAGGACTTGGCAAAGTTGTTGG - Intergenic
1149991922 17:61388152-61388174 GGAGGTCTTGGGAGTGGGGGAGG + Intronic
1150219925 17:63490400-63490422 AGGGGACATGGCAGAGTGGCTGG + Intronic
1150289863 17:63974906-63974928 GCAGAGCTGGGGAGAGTGGCCGG - Intergenic
1150634375 17:66902627-66902649 GAAGGAGTAGGGAGAGAGGCTGG + Intergenic
1151758346 17:76087339-76087361 GAAGGATTTGGGAGGGGGGCAGG + Intronic
1151855729 17:76720390-76720412 GGAGGAGCTGGAAGAGTCGCTGG + Exonic
1152078217 17:78171368-78171390 GGAGGACTTGGAAGCCGGGCCGG - Intronic
1152350163 17:79779598-79779620 GGAGAAGGTGGGAGAGGGGCTGG - Intronic
1152670303 17:81600256-81600278 GGGGGAGTTGGGAGAGTGGCCGG - Intronic
1152769303 17:82157571-82157593 GGAGGAATGGGGAGAGGGGGTGG + Intronic
1153013645 18:563833-563855 GGAGGATTTGGGAGGTTGGGGGG + Intergenic
1153229822 18:2925002-2925024 GGAGGTCTGGGGTGGGTGGCAGG + Intronic
1154445308 18:14431119-14431141 GGAGGAGCTGGAAGAGGGGCCGG - Intergenic
1155319859 18:24608647-24608669 TGAGGACTAAGGAGAGTGGATGG + Intergenic
1156514729 18:37670167-37670189 GGAGCACCTGAGAGAGTGGCTGG + Intergenic
1157433505 18:47650252-47650274 CCAGGAGTTGGGAGAGTGGTCGG + Intergenic
1157571672 18:48716413-48716435 GGAGGATTTGGGAGATGGGAGGG + Intronic
1157843527 18:50981101-50981123 GGAAGACTTGGAAGAGTAGGAGG - Intronic
1158599346 18:58843770-58843792 GCAGGGTGTGGGAGAGTGGCAGG - Intergenic
1159769899 18:72537626-72537648 GGAGGACTTGGGAGGGGGATGGG - Exonic
1160521236 18:79509364-79509386 GGGGGACCTGGGGGAGTGGCTGG - Intronic
1161497954 19:4597830-4597852 GGAGGAGCTGAGAGAGGGGCGGG + Intergenic
1161509313 19:4661872-4661894 GGAGCAGTTGGGATGGTGGCTGG - Intronic
1161570877 19:5030362-5030384 GGGGGACATGAGAGTGTGGCAGG + Intronic
1162025276 19:7890238-7890260 GGAGGACCTGGGAGGGAGGAGGG + Intronic
1162028777 19:7908609-7908631 TGAGGGCTTTGGAGAGCGGCAGG + Intronic
1162754147 19:12847273-12847295 GGAGGACTGGGGACAGGGGCAGG - Exonic
1163521601 19:17795098-17795120 GGAGGAAGCGGGAGAGGGGCGGG + Exonic
1163727914 19:18932894-18932916 GCGGGACTTGGGGGCGTGGCAGG - Intronic
1163810842 19:19430429-19430451 GCAGGACCTAGGAGAGGGGCGGG + Intronic
1163847682 19:19646651-19646673 GGAGGGGGTGGGAGATTGGCTGG - Intronic
1165796551 19:38523330-38523352 GGAGCACTTGGCAGAGAGGGCGG + Intronic
1166051279 19:40261987-40262009 GGAGCACTTGGGAGAGCTTCCGG + Intronic
1166811565 19:45517631-45517653 GGAGGAAAAGGGAGAGGGGCCGG - Intronic
1168115268 19:54218688-54218710 GGAGGACATGGGAGTGTGAGGGG + Intronic
1168260610 19:55191944-55191966 GGAGGAGGTAGGAGAGGGGCTGG - Intronic
925943371 2:8839787-8839809 GGAGGACTAGGGGAAGTGGTGGG - Intergenic
926217745 2:10915656-10915678 GGAGGTCTTGGGAGAGAGTTAGG + Intergenic
926356368 2:12044313-12044335 TGAGGACTTGGAAGGGTGGCTGG + Intergenic
926822741 2:16871167-16871189 AGAGGACCTGGGAGGGTGGAGGG - Intergenic
927055465 2:19361897-19361919 GCAGGAATCGGGAGAGGGGCTGG - Intergenic
927489242 2:23509805-23509827 GGAGGCCTCTGGAGAGCGGCTGG + Intronic
927630678 2:24771354-24771376 GGAGGAGTTTGGAGTGTTGCTGG + Intergenic
927873848 2:26641260-26641282 GGAGGACCTGGAAGAGTACCAGG - Exonic
928021933 2:27712244-27712266 GGAGGAATTGGCAGAGTGAATGG + Intronic
928209828 2:29315265-29315287 GGAGGAGGTGGGAGTGGGGCAGG + Intronic
929419614 2:41777472-41777494 GGAGGAATTGGGCGGGGGGCGGG + Intergenic
931646372 2:64425280-64425302 GGAGCAATAGGGAGAGTGGAGGG - Intergenic
931692468 2:64846780-64846802 GGAGGACTTGGCAGAGAGCATGG + Intergenic
931997954 2:67857036-67857058 GGAGGATTTTGGACAGTGGAGGG - Intergenic
932414705 2:71566615-71566637 GGAGGACAGGGGAGAGAGCCGGG + Intronic
932616427 2:73234336-73234358 GGAGAAGAGGGGAGAGTGGCGGG + Exonic
932841355 2:75085744-75085766 GGAAGAGTAGGGAGAGTGGTTGG - Intronic
933377793 2:81502194-81502216 GGAGCACGAGGGAGAATGGCAGG + Intergenic
934176587 2:89583612-89583634 GGAGGACTGGGGAGTTGGGCAGG + Intergenic
934286897 2:91657973-91657995 GGAGGACTGGGGAGTTGGGCAGG + Intergenic
934568290 2:95352668-95352690 GGAGGACTAGGGGAAATGGCAGG - Intronic
934736911 2:96694219-96694241 GGGGGACTTAGGGGAGAGGCTGG - Intergenic
935111712 2:100100153-100100175 GGAGGAATGGGGTGAGTGGTAGG + Intronic
935692725 2:105745191-105745213 GGCGGAGTTGGGAGCGCGGCGGG + Intronic
935827135 2:106962947-106962969 CAAGGACTGGGGTGAGTGGCAGG + Intergenic
936123254 2:109765015-109765037 GGAGGAATGGGGTGAGTGGTAGG - Intergenic
936221429 2:110606450-110606472 GGAGGAATGGGGTGAGTGGTAGG + Intergenic
936724718 2:115299323-115299345 TGAGAAATTGGAAGAGTGGCTGG + Intronic
937435262 2:121874641-121874663 GCAGGAATTGGGAGAGTGGCAGG + Intergenic
938272026 2:129980735-129980757 AGATGACATGGGAGAGTAGCAGG - Exonic
938443981 2:131363079-131363101 AGATGACATGGGAGAGTAGCAGG + Intergenic
938747074 2:134289415-134289437 GTAGCACATGGGAGACTGGCAGG - Intronic
939386318 2:141503625-141503647 GTAGGAATTGGGAGAGAGGGAGG - Intronic
940859080 2:158753725-158753747 GGCTGACTTGGGAGAGGAGCCGG + Intergenic
941200377 2:162501387-162501409 GGGGTACTTTGGAGAGTGGGAGG + Intronic
941516821 2:166490805-166490827 GGAGCTTTTGGGAGAGTTGCAGG - Intronic
941610533 2:167656223-167656245 TTAGAACTTGGGAGAGTGGGAGG - Intergenic
942450523 2:176105801-176105823 TGAGGCCTTGGGGGAGTGGATGG + Intronic
942602673 2:177657620-177657642 GGGGGAGTGGGGAGAGGGGCAGG + Intronic
943655463 2:190503759-190503781 GGGGCAGTTGGGAGAGAGGCTGG + Intronic
945221809 2:207491131-207491153 GAAGGACTGGGGAGGGTAGCAGG - Intergenic
945968027 2:216209254-216209276 GGAGGACTTAGAAAAATGGCTGG - Intergenic
946311469 2:218884415-218884437 GGAGGGAGTGGGACAGTGGCTGG + Intronic
946401244 2:219469440-219469462 GGAGAGCTGGGGAGAGGGGCAGG - Intronic
946513989 2:220391793-220391815 GGAGGACCAGGGAGAGGGGCAGG + Intergenic
947519102 2:230830041-230830063 TGAGGACCTCGGAGAGTGCCTGG + Intergenic
947723101 2:232381032-232381054 GTAGGCCTGGGGAGAGTGGCAGG + Intronic
947727451 2:232409113-232409135 GTAGGCCTGGGGAGAGTGGCAGG + Intronic
947736590 2:232458409-232458431 GTAGGCCTGGGGAGAGTGGCAGG + Intronic
947811642 2:233008297-233008319 GGAGAGCTTGGGAGAGGAGCAGG + Intronic
948355000 2:237371143-237371165 GGGGGACTTGAGCTAGTGGCAGG - Intronic
948803403 2:240442912-240442934 GGTGGACGGGGGTGAGTGGCAGG - Intronic
1168887228 20:1267993-1268015 TCAGGACTTGGGAGATAGGCTGG + Intronic
1170799700 20:19580920-19580942 GTAGGTCTTGGGAGAGTGGGAGG + Intronic
1170992288 20:21314496-21314518 CGAGAACCTGGGAAAGTGGCTGG - Intronic
1171455396 20:25269186-25269208 GGAGGCCTGGGGAGGCTGGCAGG + Exonic
1171970697 20:31563215-31563237 GGATGACTGGGGAGAAGGGCTGG - Intronic
1176273466 20:64248520-64248542 GGAGACGTTGGAAGAGTGGCAGG + Intergenic
1176295503 21:5069927-5069949 GGAGGACTTAGGATAGTGCTGGG + Intergenic
1176450680 21:6858744-6858766 GGAGGAGCTGGAAGAGGGGCCGG + Intergenic
1176828850 21:13723762-13723784 GGAGGAGCTGGAAGAGGGGCCGG + Intergenic
1179086243 21:38220402-38220424 GGAGGTGTTGGGAGAGTCTCTGG - Intronic
1179501164 21:41809866-41809888 GGAAGAATGGGGGGAGTGGCAGG + Intronic
1179861547 21:44192197-44192219 GGAGGACTTAGGATAGTGCTGGG - Intergenic
1179886638 21:44316953-44316975 GCAGGCCCTGGGAGAGGGGCTGG + Intronic
1180092312 21:45539423-45539445 GGCCGGCTTGGGAGGGTGGCAGG + Intronic
1180197530 21:46206660-46206682 GGAGGTCTTCGGTGAGTGGTCGG - Exonic
1180285072 22:10737954-10737976 GGAGGATTTGGGTCAGTGACTGG - Intergenic
1180553739 22:16560169-16560191 GGCTGACTTGGGAGGCTGGCTGG - Intergenic
1180725961 22:17946790-17946812 GGAGGACCTGAGGGAGTGGTGGG + Intronic
1180958248 22:19750757-19750779 GGAGGGCTGGGGAGAGGGGAGGG - Intergenic
1180970401 22:19812041-19812063 GGAGGCGTTGGGGGAGGGGCCGG - Intronic
1181113083 22:20613179-20613201 GGAGGAGGTGGGGGAGTGGGGGG + Intergenic
1181639286 22:24188338-24188360 CGGGGTCTTGGGAGAGGGGCTGG - Intronic
1181694556 22:24586407-24586429 TGAGGCTATGGGAGAGTGGCAGG + Exonic
1181790637 22:25263030-25263052 GGAGATCATGGGAGAGTTGCAGG - Intergenic
1181826452 22:25520089-25520111 GGAGATCATGGGAGAGTTGCGGG - Intergenic
1182736413 22:32534439-32534461 GGTGGGCTGGGGAGACTGGCAGG + Intronic
1182775099 22:32825143-32825165 GGAGGACTTGGGGGAGGGATGGG + Intronic
1183110765 22:35646930-35646952 GGAGGACTTGGCTGCCTGGCTGG - Intergenic
1183292163 22:37009629-37009651 GGAGCACTTGGGAAAGTGAGAGG - Intergenic
1183554714 22:38516236-38516258 GCAGGACATGTAAGAGTGGCTGG + Intergenic
1183583159 22:38737587-38737609 GGTGGACGAGGGACAGTGGCAGG - Intronic
1183588915 22:38768893-38768915 GGAGGACTTGGGGGAGACACTGG - Intronic
1183597241 22:38820033-38820055 GGAGGACTTGGGAGAAGGATGGG - Exonic
1183671513 22:39275654-39275676 AAGGGACTTGGGGGAGTGGCTGG + Intergenic
1183776787 22:39971332-39971354 GGGGGAGTTGGGAGGGGGGCAGG + Exonic
1184040274 22:41939046-41939068 GGAGGACCTGTGAGGGTGGCTGG - Exonic
1185028544 22:48429517-48429539 GGAGGACAAGAGAGAGTGGCAGG + Intergenic
1185220340 22:49626429-49626451 AGAGGTCTTGGGACAGGGGCAGG - Intronic
1185239400 22:49734632-49734654 GGTGGAGGTGGGAGAGTGACTGG - Intergenic
1185416762 22:50714852-50714874 GGAGGACATGGCAGTGGGGCAGG + Intergenic
949376907 3:3400793-3400815 GGGGGAGTGGGGAGAGTGGGTGG + Intergenic
949439466 3:4065033-4065055 GGAGGACTTGCCAGAGAGGGTGG - Intronic
949865389 3:8542874-8542896 GAAGCACTTGGAAGAGTGCCTGG + Intronic
950334392 3:12182044-12182066 AGAGGATTTGGGAGAGCAGCTGG - Intronic
950436701 3:12984533-12984555 GTTGGTCTTGGGAGGGTGGCAGG - Intronic
951569409 3:24046381-24046403 GGCTGACTTGGCACAGTGGCAGG - Intergenic
952341637 3:32452188-32452210 GGAGGACTGGGGCCAGTGGCTGG + Intronic
953735746 3:45492807-45492829 TGAGGACCTGGGAGGATGGCTGG - Intronic
954670728 3:52290094-52290116 GGAGGACGTGGCTGGGTGGCAGG + Intronic
955739282 3:62072986-62073008 GGAGAACGTGGCAGAGTGACAGG + Intronic
956650029 3:71496327-71496349 GGAGGAATTGGAAGATTGGGTGG + Intronic
956770287 3:72520207-72520229 GGAGGGCCTGGGAGAGAGGAAGG - Intergenic
961001368 3:123376287-123376309 GCAGGCCTTTGGAGCGTGGCAGG - Intronic
961474433 3:127137848-127137870 GGAGGAGTTGGGACACTAGCAGG - Intergenic
961594720 3:128007078-128007100 GAAAGACTTGGGAGAGGTGCAGG - Intergenic
962588078 3:136862219-136862241 GTAGCTCTTGGGAGAGAGGCGGG - Exonic
964231748 3:154478300-154478322 AGAGGACTTGGGAAAATGACTGG + Intergenic
967937885 3:194743775-194743797 GGAGGACCTGCAAGAGTGGGCGG - Intergenic
967986701 3:195100596-195100618 GGAGTACAGGGGAGAGTGCCGGG - Intronic
968144112 3:196283826-196283848 GGGTGACTTGGGAGAGTGAGGGG - Intronic
968533938 4:1112600-1112622 GGAGGACCTGGGGGAGAAGCGGG - Intronic
969274757 4:6127737-6127759 GAAGGACTTTCGAGAGAGGCTGG - Intronic
970750828 4:19358462-19358484 GGAGGCCTTGGGGCAGGGGCGGG + Intergenic
975413206 4:74079226-74079248 GGAGGAAGTGGGAGAGTGAAGGG + Intergenic
975657008 4:76651616-76651638 AGAATAGTTGGGAGAGTGGCTGG + Intronic
975808788 4:78142150-78142172 GGCTTACTTGGGAGAGGGGCTGG + Intronic
976071839 4:81250063-81250085 TGAAGACTTGGGAAAGTGGGGGG - Intergenic
976763934 4:88579551-88579573 TGGGGAATTGGGAGAGAGGCTGG + Intronic
977877929 4:102170629-102170651 GGAGGACTGGGGTGGGTAGCGGG - Intergenic
978770562 4:112452191-112452213 GAAGGACTTAGCACAGTGGCTGG + Intergenic
980182374 4:129416976-129416998 GGAGGACATGGGAGGGAGGTGGG - Intergenic
980379345 4:131991295-131991317 GGAAGACTAGGGAAAGTGCCAGG - Intergenic
982435263 4:155377393-155377415 GGAACACTTGGAAGAGTGCCTGG + Intergenic
982699079 4:158639102-158639124 GGAGGATTTGGGGAAGTGGGTGG + Intronic
983735650 4:171056251-171056273 GCTGGCCATGGGAGAGTGGCTGG - Intergenic
985630182 5:1009845-1009867 GGAGGAGCTGGGCGAGTGGGAGG + Intronic
985784751 5:1887743-1887765 GAGGGGCTTGGGAGAGGGGCAGG - Intergenic
986015596 5:3754529-3754551 GGAGAACCTGGGAGAGAGGCTGG + Intergenic
988480574 5:31627039-31627061 GGAGGGCCCGGGAGAGTGGCAGG + Intergenic
991001332 5:61786288-61786310 GGAGGACTTGGGGAAATGGTGGG + Intergenic
991005944 5:61828156-61828178 GGAGGACATGAGAGAAGGGCTGG - Intergenic
991049814 5:62260817-62260839 GGCAGACTTTGGAAAGTGGCCGG + Intergenic
992821668 5:80503964-80503986 GGAAGACTAGGGAGAGGGGCTGG + Intronic
993350553 5:86844808-86844830 GAAGGACATGGGGGAGTAGCTGG - Intergenic
995035742 5:107532142-107532164 GGATGACTGGGGAGATGGGCAGG + Intronic
995297325 5:110537106-110537128 GGAGGACTTTGAATAGTGGAAGG - Intronic
997424827 5:133796062-133796084 GGAGCACATGGGAAAGTGGTTGG - Intergenic
997619424 5:135275781-135275803 AGAGGTCTTGGGAGCCTGGCAGG + Intronic
998139129 5:139690068-139690090 GGAGGGCTGAGGACAGTGGCAGG + Intergenic
999316721 5:150588895-150588917 GAAGGAATTGGGAGAGGGGAAGG - Intergenic
999744914 5:154584575-154584597 GGAGGGTATGGCAGAGTGGCAGG + Intergenic
999979993 5:156948961-156948983 TGAGGACTTAGAAGAGTGCCTGG - Intronic
1000047832 5:157536076-157536098 GAAGGAGTTGGTAGTGTGGCCGG - Intronic
1001349946 5:170951071-170951093 GGTGGACTGGGGAGTGGGGCAGG + Intronic
1001824404 5:174733751-174733773 GGAGGAGGTGAGAGGGTGGCTGG - Intergenic
1002193548 5:177490832-177490854 GCAGGAGGTGGGAGAGGGGCTGG + Intronic
1002527721 5:179824154-179824176 GGAGGAATTAGCAGAGCGGCAGG - Intronic
1003353800 6:5345979-5346001 GGAGTACTGGGGATGGTGGCAGG + Intronic
1004065901 6:12243383-12243405 GGAGGAGGTGGGAGGGAGGCAGG + Intergenic
1004173162 6:13314999-13315021 GGGGCACATGGGAGTGTGGCAGG - Intronic
1004505294 6:16242265-16242287 TGAGAACATGGCAGAGTGGCTGG + Intronic
1006061313 6:31421919-31421941 TGAGGAATGGGGAGAGTGGCAGG + Intergenic
1006144570 6:31950814-31950836 GGAGGACTGGGGTGAGGAGCAGG + Intronic
1006309892 6:33250044-33250066 GGAGCCCTTGGGACAGTGTCTGG + Intergenic
1006440676 6:34051823-34051845 GGAGCTCTTGGGAGAATGGGAGG + Intronic
1006475990 6:34254407-34254429 GGAGGACTTGGGGGAAAGGATGG + Intergenic
1006817743 6:36864349-36864371 GGAACACCTGAGAGAGTGGCAGG - Intronic
1006987404 6:38185068-38185090 AGAGGACCTGGGAGGGTGGGAGG - Intronic
1007654577 6:43444635-43444657 GGAGGATATGGGGTAGTGGCAGG + Intronic
1007846439 6:44761126-44761148 TGAGGCCTTGGGACAGTGCCTGG - Intergenic
1007972668 6:46068364-46068386 GGAAGCCTTGGGCCAGTGGCTGG - Intronic
1008632969 6:53381680-53381702 AGAGGGCCTGGGAGAGGGGCCGG - Intergenic
1009651466 6:66481557-66481579 TGAGGACTGAGGAGAGTGGGTGG + Intergenic
1009845874 6:69133849-69133871 GGTGGACTTTGGAGACTTGCAGG - Intronic
1010962647 6:82164151-82164173 GGTGAACTGGGGAGAATGGCAGG - Intergenic
1011302072 6:85886326-85886348 GGAGGGCTTGGGAAAGAGGTTGG + Intergenic
1013092899 6:106916818-106916840 GGAGTATTTGGGAGTGTGGGTGG + Intergenic
1013417731 6:109939736-109939758 GTAGGGCTGGGGAGACTGGCAGG - Intergenic
1015539684 6:134301251-134301273 GGAGGAGGAGGGAGAGTGGATGG + Intronic
1015596995 6:134875341-134875363 GGAGTAAGTGGGTGAGTGGCTGG + Intergenic
1017038206 6:150286084-150286106 GTAAAACTTGGGAGAATGGCGGG - Intergenic
1017305687 6:152915835-152915857 GCATGACTTTGGAGAGTGGAAGG + Intergenic
1017590299 6:155972179-155972201 AGAGGAGTGGGGAGAGTGGCAGG + Intergenic
1018026566 6:159811167-159811189 GTAGGAAATGGGAGAGTAGCGGG + Intronic
1018394765 6:163369835-163369857 GGAGGCCTTGAGAGAGTGCGTGG - Intergenic
1018595095 6:165470749-165470771 GGAGGACCTGGGAGGCTGACAGG + Intronic
1018778673 6:167043192-167043214 GAAGGACATGGGAGGGGGGCAGG + Exonic
1018807852 6:167275237-167275259 GGAGGACGTGGCAGAATGACAGG - Intronic
1018896826 6:168025220-168025242 GAAGGACCTGGGGGTGTGGCTGG + Intronic
1018975060 6:168558265-168558287 GGAGGAGACGGGAGAGTGGTTGG + Intronic
1019571322 7:1713807-1713829 GGTGGCCTTGGGCGAGTCGCTGG - Intronic
1020802019 7:12743665-12743687 GGAAGACATGGGGGAATGGCTGG - Intergenic
1021952749 7:25791104-25791126 GGAGGAGTTGGCAGAGTGAATGG + Intergenic
1021978691 7:26033406-26033428 GGAGGACTTGGGGAAGAGGGTGG - Intergenic
1023640438 7:42251469-42251491 GGGGGAGTTGGGGGAGTGGCTGG + Intergenic
1026453912 7:70554506-70554528 GGAGGACTTGGGTGGGTTGGGGG - Intronic
1026775832 7:73230460-73230482 AGACGACTCGGGAGAGTGGGAGG + Intergenic
1027016690 7:74783832-74783854 AGACGACTGGGGAGAGTGGGAGG + Intronic
1027071338 7:75162104-75162126 AGACGACTCGGGAGAGTGGGAGG - Intergenic
1027374474 7:77536983-77537005 GGCGGGCTTGGGGGCGTGGCCGG + Intergenic
1028893234 7:96012062-96012084 GGAGGGTTGGGGACAGTGGCAGG + Intronic
1029419715 7:100466383-100466405 GGAGGAATTGAGACAGAGGCTGG - Intronic
1032054822 7:128675755-128675777 GGAGGACATTGGGGAGTGGCAGG - Exonic
1032083672 7:128872751-128872773 GGGGGTCTCGGGAGACTGGCAGG - Intronic
1032160147 7:129503349-129503371 TGAGGACTTGGGGCAGGGGCTGG - Intronic
1032599531 7:133278633-133278655 TGAGGCATGGGGAGAGTGGCAGG + Intronic
1034829157 7:154294291-154294313 GAAGGAGTTGGGAGTGGGGCTGG + Intronic
1035097615 7:156368142-156368164 GGAGGACGTGGGACACTGGAAGG + Intergenic
1035353156 7:158260865-158260887 TGAGGACCTGCCAGAGTGGCAGG - Intronic
1036589676 8:10157506-10157528 GGAGGGCTTGGGATAGTGGGAGG + Intronic
1036660118 8:10702399-10702421 GGAGGAGTTGGGAGAGTCACAGG + Intronic
1037466550 8:19166997-19167019 GGAGGACTTAGGAGTTTGGCAGG + Intergenic
1038021848 8:23557671-23557693 GGTGGACATGGGAGAGCTGCTGG + Intronic
1038411628 8:27363621-27363643 GGAGGACTTGCAAGAAGGGCAGG - Intronic
1039341566 8:36656187-36656209 GGAAGACTTGGGAGTGAGGGAGG - Intergenic
1040302036 8:46193043-46193065 GGGTGGCGTGGGAGAGTGGCCGG + Intergenic
1040337493 8:46423475-46423497 GGATGACGTGGGCGAGTGACAGG + Intergenic
1040888488 8:52290738-52290760 GGAGAGGATGGGAGAGTGGCAGG - Intronic
1041662654 8:60414461-60414483 GGAGGACCTGGGAGATTCTCTGG + Intergenic
1041714325 8:60920487-60920509 AGAGGACTTGGGGTAGTGGAGGG - Intergenic
1044417852 8:91956253-91956275 GGAGGAGTAGGAAGAGTGGGAGG - Intronic
1045523931 8:102927534-102927556 CCAGCACCTGGGAGAGTGGCTGG - Intronic
1046711058 8:117512178-117512200 GCAGGATCTGGGAGAGAGGCTGG - Intergenic
1047090701 8:121572533-121572555 TGTGGACTTGGAAGAGTGGGAGG + Intergenic
1047649878 8:126909208-126909230 GGAAGACCTGGGGCAGTGGCAGG + Intergenic
1047739708 8:127796696-127796718 GGAAGACTTTGGATAGTTGCCGG + Intergenic
1048280325 8:133101075-133101097 GCAGGAGTGGGGAGGGTGGCGGG + Intronic
1049160478 8:141094719-141094741 GCAGGGCTTCGGAGAGTGGACGG + Intergenic
1049194786 8:141308929-141308951 GGAGGTCTTCGGAGGGTGGCAGG - Intergenic
1049203941 8:141354668-141354690 GGATGACTTGTGAGCGTGGGTGG + Intergenic
1049257027 8:141619630-141619652 GGAGGACACAGGAGAGCGGCTGG + Intergenic
1049371949 8:142272204-142272226 GGAGTAGATGGGTGAGTGGCTGG - Intronic
1049792701 8:144479328-144479350 GGGGGACTTGGGGCAGGGGCAGG - Intronic
1050445306 9:5715821-5715843 GGAGGAGTGGGGAGAGAGGTAGG - Intronic
1052865839 9:33464211-33464233 GGAGGACCTGGGGGAGTAGAGGG - Intronic
1053575553 9:39355550-39355572 GGAGGAGGAGGGAGAGGGGCAGG - Intergenic
1055100105 9:72455360-72455382 GGGGCACTTGGCAGAGTGGCAGG + Intergenic
1055245065 9:74229955-74229977 TGAGGACTTGGGGGAGTGCGAGG + Intergenic
1055489644 9:76791884-76791906 TGAGGCCTTGGGAGAGATGCTGG + Intronic
1056399286 9:86211089-86211111 GGAGTGCTTAGGAGAGTGCCTGG - Intergenic
1057159502 9:92877889-92877911 AGAGGACGTGGGTGAGGGGCAGG - Exonic
1060868931 9:127023541-127023563 GGAGGGCTTGGGACAGTGCCTGG + Intronic
1062001230 9:134216751-134216773 GGAGGCCCTGGGGGAGAGGCTGG - Intergenic
1062028456 9:134351245-134351267 GGAGGCCTTGGGCGAGTGCCTGG + Intronic
1062491251 9:136806137-136806159 GGAGGACTGTGAGGAGTGGCGGG + Exonic
1062715859 9:138009792-138009814 GGAGGGATTGGCAGAGAGGCTGG + Intronic
1062740995 9:138175288-138175310 GGTGGGGGTGGGAGAGTGGCTGG + Intergenic
1203518502 Un_GL000213v1:25773-25795 GGAGGAGCTGGAAGAGGGGCCGG - Intergenic
1203731432 Un_GL000216v2:94983-95005 GGAGGATTTGGGTCAGTGACTGG - Intergenic
1203736672 Un_GL000216v2:144264-144286 GGAGCACCTGGGAGAGCGCCGGG - Intergenic
1187724925 X:22192534-22192556 GGAGGAAGGGGGAGAGTAGCAGG - Intronic
1188705921 X:33330254-33330276 GGAGGAGTTGGGTGTGAGGCTGG + Intronic
1189358112 X:40326962-40326984 TGAGGGCTTGGGAGAGTTGCTGG + Intergenic
1189548903 X:42072746-42072768 GGATGATTTGGGAGAGTTGGGGG - Intergenic
1190311925 X:49122795-49122817 GGTGGGGTTGGGAGAATGGCAGG + Intronic
1190325598 X:49205157-49205179 GGAGGACTTGGGAGACGAGATGG - Exonic
1192935736 X:75857210-75857232 GGCGGACTGGGGAGAGTACCAGG + Intergenic
1193099619 X:77593957-77593979 TGGGGACTTGGGAGAGGGGAGGG + Intronic
1195128465 X:101831824-101831846 GGAGGGGTTGGGATAGTGGATGG + Intergenic
1195364944 X:104116501-104116523 GGAGGACAGGGGAGAGGGGGAGG + Intronic
1196231768 X:113232455-113232477 TGAGGACTTGGGAGAAAGGGTGG - Intergenic
1196734646 X:118973706-118973728 TGGGGGCGTGGGAGAGTGGCAGG - Intergenic
1197047853 X:122021424-122021446 GGGAGACTTGGAAGAGTGGGAGG - Intergenic
1197386742 X:125811985-125812007 GGAAGACAAGGCAGAGTGGCAGG + Intergenic
1197822882 X:130559559-130559581 GTGGGACTGGGGAGAGTGGCAGG - Intergenic
1198407664 X:136330974-136330996 GGGGGACTTGGGGGAGGGGAAGG - Intronic
1198999089 X:142611353-142611375 TGAGGACTTGGGAGAAAGGATGG + Intergenic
1200142140 X:153907661-153907683 AGGGGGCTGGGGAGAGTGGCCGG + Exonic