ID: 1103326469

View in Genome Browser
Species Human (GRCh38)
Location 12:120124658-120124680
Sequence GTCCTCCCGCATCACAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103326460_1103326469 25 Left 1103326460 12:120124610-120124632 CCTGCACCCAAAACTGTCAAATC 0: 1
1: 0
2: 0
3: 11
4: 192
Right 1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 90
1103326465_1103326469 -7 Left 1103326465 12:120124642-120124664 CCTGCCACTCTCCCAAGTCCTCC 0: 1
1: 0
2: 3
3: 48
4: 455
Right 1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 90
1103326459_1103326469 26 Left 1103326459 12:120124609-120124631 CCCTGCACCCAAAACTGTCAAAT 0: 1
1: 0
2: 2
3: 21
4: 214
Right 1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 90
1103326463_1103326469 -3 Left 1103326463 12:120124638-120124660 CCTCCCTGCCACTCTCCCAAGTC 0: 1
1: 0
2: 3
3: 73
4: 592
Right 1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 90
1103326464_1103326469 -6 Left 1103326464 12:120124641-120124663 CCCTGCCACTCTCCCAAGTCCTC 0: 1
1: 0
2: 3
3: 39
4: 446
Right 1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 90
1103326461_1103326469 19 Left 1103326461 12:120124616-120124638 CCCAAAACTGTCAAATCTGCAGC 0: 1
1: 0
2: 3
3: 23
4: 188
Right 1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 90
1103326462_1103326469 18 Left 1103326462 12:120124617-120124639 CCAAAACTGTCAAATCTGCAGCC 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103326469 Original CRISPR GTCCTCCCGCATCACAGTGT TGG Intergenic
900216563 1:1485126-1485148 GACGTCCCGCATCACGGTGCTGG + Exonic
902631517 1:17707297-17707319 GTCCTCACACAGCAAAGTGTTGG - Intergenic
902880725 1:19370240-19370262 GTCCTCTCCCATCACAGTACAGG + Intronic
905309007 1:37036784-37036806 CTCCTCCTGCATCCCAGAGTGGG + Intergenic
905426522 1:37889663-37889685 CTCCTCCACTATCACAGTGTCGG - Exonic
908892030 1:68859332-68859354 TTCCTCCTGGCTCACAGTGTAGG + Intergenic
919869199 1:201807891-201807913 GTCCTCCCCCATCCCAGTAGTGG + Intronic
924749587 1:246873511-246873533 TTTCTCCTGCATCACAGTGAAGG + Intronic
1066182086 10:32972718-32972740 GTTCTTCCGCTTCACAGTGGAGG + Intronic
1068844846 10:61660290-61660312 GACCTCAGGAATCACAGTGTTGG + Intergenic
1070764217 10:79047304-79047326 CTCCTCCAGCAGCCCAGTGTAGG - Intergenic
1071359164 10:84828515-84828537 GCCCTCACACATCACATTGTTGG - Intergenic
1071611152 10:87032342-87032364 TTTCTCCCCCACCACAGTGTGGG + Intergenic
1077028437 11:452023-452045 GTCCTCCCGCAGCACAGCTGGGG + Intronic
1077677327 11:4206704-4206726 GTCCTCCAGCATCAGAATGGTGG + Intergenic
1093267172 12:17016930-17016952 TTCCACCTGTATCACAGTGTAGG + Intergenic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1104951069 12:132440399-132440421 GTCCTGCTACATCACTGTGTTGG - Intergenic
1104962116 12:132493298-132493320 ATCCTCCAGCATCCCAGAGTAGG - Intronic
1107565350 13:41597784-41597806 GTCCTCCCCCATCTCAGTGAAGG + Intronic
1112496918 13:99912560-99912582 ATCCTCCTGCAGCCCAGTGTTGG - Intergenic
1113024709 13:105928191-105928213 GTCCTTCCACAGCAGAGTGTGGG + Intergenic
1114062962 14:19037396-19037418 GTCCTCCCGTGCCATAGTGTAGG + Intergenic
1114099298 14:19362601-19362623 GTCCTCCCGTGCCATAGTGTAGG - Intergenic
1115936336 14:38557382-38557404 TTCCTCCTAAATCACAGTGTGGG + Intergenic
1117491153 14:56249342-56249364 ATCCACCCTCATCACATTGTTGG + Intronic
1122882716 14:104697224-104697246 GGCCTTCCACAGCACAGTGTGGG - Intronic
1123493586 15:20800789-20800811 GTCCTCCCGTGCCATAGTGTAGG - Intergenic
1123550094 15:21369891-21369913 GTCCTCCCGTGCCATAGTGTAGG - Intergenic
1124237277 15:28001765-28001787 GTCCTCCAGCACCACATTCTGGG - Intronic
1126522107 15:49606579-49606601 GACCTCCCACATCAGAGTGAAGG + Intronic
1131120826 15:89822616-89822638 GCCCTCCCTCGTCACAGTGTGGG - Intergenic
1131543938 15:93299839-93299861 GGCCTTACGCATCACAGGGTGGG - Intergenic
1202958424 15_KI270727v1_random:97109-97131 GTCCTCCCGTGCCATAGTGTAGG - Intergenic
1133550872 16:6853477-6853499 GTCCTCGAGCACCACACTGTAGG - Intronic
1137291626 16:47055542-47055564 GGCCTCCCGCTTCACAGAGCAGG - Intergenic
1141267049 16:82507064-82507086 GACCTCCCCCATGACAGAGTCGG - Intergenic
1144415704 17:15044197-15044219 GTCCTACTGCATCCAAGTGTAGG - Intergenic
1145289824 17:21534332-21534354 GGGCTCCAGCATCACAGTGAAGG + Exonic
1152026717 17:77814463-77814485 GTCCTCCAGCAACACATGGTGGG - Intergenic
1152738393 17:82008543-82008565 TCCCTCCCGCATCCCAGGGTGGG + Intronic
1154451118 18:14475252-14475274 GTCCTCCCGTGCCATAGTGTAGG - Intergenic
1156399567 18:36728258-36728280 GGCCTCCAGCACCACAGTATTGG + Intronic
1157339027 18:46762728-46762750 GTCCTCACGCATCACAATTCAGG - Intergenic
1161354077 19:3809488-3809510 GGCCTCCCACAGCACTGTGTGGG + Intronic
1161354967 19:3813836-3813858 GTCCTCCCGCATCAGAGGTGAGG + Exonic
1165807173 19:38587554-38587576 GCCCCCCAGCATCACTGTGTTGG + Intronic
1167877490 19:52426512-52426534 TTCCTCCCGCATCACAGCTGAGG + Intergenic
1168584908 19:57584240-57584262 GTCCTCCCGCTGAACAGTGGGGG + Exonic
925299493 2:2800408-2800430 TTCCTGCCACATCACAGTGAGGG - Intergenic
927044469 2:19263026-19263048 GTTCTCCTGAATCACATTGTAGG + Intergenic
932142609 2:69293116-69293138 GTCCTCCAGGATCTCTGTGTTGG - Intergenic
933553339 2:83802799-83802821 CTCCACCAGCACCACAGTGTGGG + Intergenic
937980580 2:127612306-127612328 GTCCTCCCGGATCACAGGCCAGG + Intronic
940977841 2:159966223-159966245 GTCCTGTCGCATGCCAGTGTGGG + Intronic
941795559 2:169595167-169595189 GTCCACCCGCCTCAGAGTGCTGG + Intronic
946406350 2:219493927-219493949 GTGTTCCCTCATCACAATGTGGG + Intronic
947539421 2:230964695-230964717 GGCCTCCCGCTGCACTGTGTGGG - Intergenic
1169704771 20:8490161-8490183 GTGCTCAAGCCTCACAGTGTTGG - Intronic
1173847174 20:46195572-46195594 GCACTCCCGCCTCCCAGTGTTGG + Intronic
1176445117 21:6815321-6815343 GTCCTCCCGTGCCATAGTGTAGG + Intergenic
1176823284 21:13680354-13680376 GTCCTCCCGTGCCATAGTGTAGG + Intergenic
1178264965 21:31134244-31134266 GTAGTCCCACATCACTGTGTGGG + Intronic
1179483749 21:41695414-41695436 GTGCTCCAGCACCACAGTGTAGG + Intergenic
1180481455 22:15760023-15760045 GTCCTCCCGTGCCATAGTGTAGG + Intergenic
1180748802 22:18110709-18110731 GCCCCCCGGCATCACAGTGCCGG - Intronic
1182288028 22:29259467-29259489 GCCCTCCCGCATCTCAGGTTGGG + Exonic
1182470574 22:30545673-30545695 ATCCTCCCGCCTCAAAGTGCGGG + Intronic
950459477 3:13112655-13112677 GTGGTCCCGCAGCAGAGTGTGGG + Intergenic
954333390 3:49902638-49902660 GGCCACCCGCAGCACAGGGTAGG + Exonic
954672178 3:52297088-52297110 GTCCTCCCTCACCTCAGTCTGGG - Intergenic
967268470 3:187713188-187713210 CACCACCTGCATCACAGTGTAGG - Intronic
968747992 4:2370810-2370832 GGCGCCCAGCATCACAGTGTGGG - Intronic
973961356 4:56112870-56112892 GTCCTGCTGCATCACATTATTGG + Intergenic
991469657 5:66954544-66954566 GTCTTCCCCTATCAGAGTGTAGG - Intronic
999878375 5:155833945-155833967 GTCCTTCCACAACTCAGTGTAGG - Intergenic
1003126095 6:3356897-3356919 CACCACCTGCATCACAGTGTCGG - Intronic
1003189531 6:3861987-3862009 GTTCTCCCACAACACAGTGCTGG + Intergenic
1008026572 6:46643378-46643400 TTACTCCTGCAACACAGTGTTGG + Intronic
1011694617 6:89901017-89901039 ATCCACCCGCCTCAAAGTGTTGG + Intergenic
1011743867 6:90389869-90389891 CTCCTCATGCATCACAGTTTGGG - Intergenic
1017840767 6:158221003-158221025 GTCCTCCGGCCTCACTGTGTTGG + Intergenic
1030115650 7:106060376-106060398 GTCCTCCTGGAACTCAGTGTTGG - Intergenic
1033681914 7:143603220-143603242 GGCCTCCCATATCCCAGTGTGGG - Intergenic
1033702975 7:143858693-143858715 GGCCTCCCATATCCCAGTGTGGG + Intronic
1033805602 7:144951349-144951371 CTCTTCCCACTTCACAGTGTTGG + Intergenic
1033805895 7:144953907-144953929 TTGCTCCCACATCTCAGTGTAGG + Intergenic
1035556355 8:569965-569987 CTCCACCCTCATCACAGTCTGGG + Intergenic
1044504987 8:93006773-93006795 CTCCTCCCTCTTCACTGTGTGGG + Intronic
1050177579 9:2884165-2884187 GTCCTGCTGCATCACAGGATGGG + Intergenic
1061546870 9:131309533-131309555 GTCCATCAGCATCACAGTGAGGG - Intergenic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1062338699 9:136083970-136083992 CTTCTCCCGCATCACTGGGTGGG + Intronic
1203524078 Un_GL000213v1:69204-69226 GTCCTCCCGTGCCATAGTGTAGG - Intergenic
1200253667 X:154567798-154567820 CTCCTCCGGTAGCACAGTGTAGG + Intergenic
1200264100 X:154636610-154636632 CTCCTCCGGTAGCACAGTGTAGG - Intergenic