ID: 1103332189

View in Genome Browser
Species Human (GRCh38)
Location 12:120162016-120162038
Sequence CTCCCTTTCCGTCCTGTCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103332189_1103332195 20 Left 1103332189 12:120162016-120162038 CCGGCGACAGGACGGAAAGGGAG 0: 1
1: 0
2: 0
3: 2
4: 118
Right 1103332195 12:120162059-120162081 CTGCCAGACAAACGCAGACATGG 0: 1
1: 0
2: 2
3: 16
4: 148
1103332189_1103332191 -7 Left 1103332189 12:120162016-120162038 CCGGCGACAGGACGGAAAGGGAG 0: 1
1: 0
2: 0
3: 2
4: 118
Right 1103332191 12:120162032-120162054 AAGGGAGCCCATGGCATTCATGG 0: 1
1: 0
2: 2
3: 17
4: 216
1103332189_1103332192 -4 Left 1103332189 12:120162016-120162038 CCGGCGACAGGACGGAAAGGGAG 0: 1
1: 0
2: 0
3: 2
4: 118
Right 1103332192 12:120162035-120162057 GGAGCCCATGGCATTCATGGAGG 0: 1
1: 0
2: 0
3: 15
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103332189 Original CRISPR CTCCCTTTCCGTCCTGTCGC CGG (reversed) Exonic
901204562 1:7486667-7486689 CTCCCTGTCTGTCCTGTGTCCGG + Intronic
902181589 1:14693285-14693307 CTCCCTTAGCATCCTGTTGCCGG - Intronic
903769057 1:25752762-25752784 CTCCCTTGCTGTCCTGTGGGTGG + Intronic
907063348 1:51453691-51453713 CCCTCTTTCCCTCCTGTCTCAGG - Intronic
909744270 1:79073789-79073811 CTCCCTTTCTCTCCTGGAGCTGG - Intergenic
911565829 1:99462219-99462241 CTCCCTTTTCCTCCTGTCCTTGG - Intergenic
914844506 1:151274476-151274498 CTCCCTTCCCTTCCTGCCTCTGG - Intergenic
916841862 1:168609375-168609397 CTGCCTTTCTGACCTGTCACAGG + Intergenic
918040817 1:180912975-180912997 CCCGCTTCCCGTCCTCTCGCCGG + Intergenic
920254344 1:204644331-204644353 CTCCCTTTCTGTCCTGGTGATGG + Intronic
920342372 1:205283649-205283671 CTCCCTTTTCTCCCTGTCCCCGG - Intergenic
1065047808 10:21759508-21759530 CCCCCTCTGCGTCCTCTCGCTGG + Exonic
1067539882 10:47143747-47143769 CTCCCTATCCTTCCTGCAGCAGG - Intergenic
1067860490 10:49842058-49842080 TCCCCTTTCCTTCCTGTCCCAGG - Exonic
1069646753 10:70005234-70005256 CTTCCTTTCCTTCCTCTCTCTGG - Intergenic
1070257745 10:74825910-74825932 CTCCCGTCCCGTCCCGTCCCGGG - Intronic
1076081051 10:127580885-127580907 CTCACTGTGCGTCCTGTGGCCGG + Intergenic
1080383134 11:31794759-31794781 CTCCCCCTCCTTCCTGTTGCTGG + Exonic
1083936401 11:65872198-65872220 CTCCCTACCCTTCCTGTCCCAGG + Intronic
1085880461 11:80462251-80462273 CTCCCTGTCCCTCCTGCCCCTGG - Intergenic
1089522303 11:119073327-119073349 CTCCCTGTACGTGCTGACGCGGG + Exonic
1089911238 11:122102621-122102643 TTCCCTTTCCTTCCAGTGGCTGG + Intergenic
1101108135 12:101459946-101459968 CTCCCTGTCCCTCCTGTTGGTGG + Intergenic
1101433918 12:104649000-104649022 CTTCCTTTCTGTCCTCTTGCTGG + Intronic
1102674820 12:114650217-114650239 CTCCATTTCCTTTCTGTGGCAGG - Intergenic
1103332189 12:120162016-120162038 CTCCCTTTCCGTCCTGTCGCCGG - Exonic
1107167345 13:37298269-37298291 CTCCTTTTCCTTCCTTCCGCAGG - Intergenic
1113428262 13:110228045-110228067 ATCCCTTTCCCACCTGTCACCGG - Intronic
1114268510 14:21087372-21087394 CTCCCTTCCCGGCCTTTCGCCGG + Exonic
1122447770 14:101781812-101781834 TTTCCTTTCCGTCCCGTCTCGGG + Intronic
1122631573 14:103109694-103109716 CTCCCTCTCCACCCTGTCCCTGG + Intronic
1123985740 15:25644347-25644369 CTCCCTCTCCGCCCAGTCCCTGG - Intergenic
1124368158 15:29088532-29088554 CCACCTTTCCGTCCTGTTGATGG + Intronic
1125345669 15:38716244-38716266 TTCCATTTCCGTCCTGTCAGAGG - Intergenic
1129360476 15:75021005-75021027 CTCCCTTTCCCTTCTCTCTCTGG + Exonic
1133655255 16:7855963-7855985 CTCCTTTTCCCTCCAGTGGCTGG + Intergenic
1136633343 16:31502656-31502678 CTCCATTTCTGTCCTGACTCTGG + Intronic
1143433019 17:6900692-6900714 CTTCCTCTCAGTCCTGTCCCAGG + Intronic
1143495737 17:7311762-7311784 CTCCCTATCCTTCCTGTTGAAGG + Intronic
1147181025 17:38685819-38685841 CTCCCTTGCTGTCCTGCCTCTGG + Intergenic
1147262369 17:39216009-39216031 CTCCCTGTCCTTCCTTTCTCAGG + Intronic
1148395225 17:47302867-47302889 CTCCCTCTCCCTCCTGGGGCAGG - Intronic
1155865214 18:30956383-30956405 CTCCCACCCCGTCCTGTAGCTGG - Intergenic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1161203368 19:3028334-3028356 CTGCATTTCCGTCTTCTCGCTGG + Exonic
1161476503 19:4488794-4488816 GTCGCTCTCCATCCTGTCGCTGG - Exonic
1162615481 19:11797648-11797670 CTCCCTTTCCCTCCCTTTGCCGG - Intronic
1162659958 19:12161184-12161206 CTCCCTTTCCCTCCCTTTGCAGG - Intergenic
1164592909 19:29515909-29515931 CCCCCTTTCCCTCCTCTCTCCGG - Intergenic
1165718673 19:38063427-38063449 CACTCTTTCCATCCTGCCGCTGG - Intronic
1168281226 19:55306389-55306411 CTCCGCTGCCGTCCCGTCGCGGG - Exonic
926045077 2:9704178-9704200 CTCCCTGTCTGTCCAGTAGCAGG + Intergenic
932420107 2:71596573-71596595 AGCCCTTTCCGTCCTGCCCCTGG - Intronic
934085898 2:88509284-88509306 CTCCCTGTCTGACCTGGCGCGGG - Intergenic
934604296 2:95682562-95682584 CTCCCTTTGCTTCCTTTCCCTGG + Intergenic
936537693 2:113324792-113324814 CTCCCTTTGCTTCCTTTCTCTGG + Intergenic
937284654 2:120742205-120742227 CGCCCTTCCTTTCCTGTCGCCGG - Intronic
937424931 2:121790754-121790776 CTCCCTTTCCATCCCTTCCCTGG - Intergenic
942429737 2:175898021-175898043 CTGCCTTTCTGTCCTGAAGCTGG - Intergenic
948585523 2:239016522-239016544 CCCCCTTTGGGTCCTGTGGCAGG - Intergenic
1172955625 20:38756119-38756141 CTCTCTTTCCCTCCTGACTCTGG - Intronic
1175116414 20:56685779-56685801 GTCCCTCTCCTTCCTGTCTCTGG + Intergenic
1175181360 20:57149998-57150020 CTCACTTTCCAACCTGACGCTGG - Intergenic
1177209988 21:18059229-18059251 CTCCCTTTCTGGCCTGTAGATGG - Intronic
1184681752 22:46075969-46075991 CATGCTTTCCGTCCTGTCCCTGG - Intronic
957468934 3:80632770-80632792 CTCCCTTTCCTGCCTGTCTTGGG - Intergenic
966659111 3:182394347-182394369 CTCCCATTCTTTCCTGTCACCGG + Intergenic
967730772 3:192904862-192904884 CTTCCTTACCGTCCAGTCCCTGG + Intronic
969209218 4:5673581-5673603 CTCACTTTCCTTCTTGTCTCTGG + Intronic
978073944 4:104505986-104506008 CTCCTATTCCATCCTGTTGCTGG - Intergenic
978880824 4:113700675-113700697 TTCACTTTCCCTCCTGACGCTGG + Intronic
981731487 4:147903613-147903635 ATCCCTTTCCCTCCAGTCCCTGG + Intronic
986721269 5:10563316-10563338 CTCCCCGTCAGTCCTGGCGCCGG - Intergenic
989715532 5:44458207-44458229 CTCCCTTTCCATCCTGGTGGGGG - Intergenic
994578306 5:101609202-101609224 CTCCTTTTCCCTCCTCTGGCAGG - Intergenic
997337458 5:133118311-133118333 CTCCCTCTCCCTCCTGCCCCAGG - Intergenic
998107245 5:139476383-139476405 CTTCCTTTTCCTCCTGCCGCAGG + Exonic
998570258 5:143250755-143250777 CACCCTTTCCTTCTTGTCCCAGG + Intergenic
1000277327 5:159749678-159749700 CTCCCTTTCCATCCTTTTCCAGG + Intergenic
1001966652 5:175914400-175914422 CTCCCTTCCCGGCCTGGCTCAGG - Intergenic
1002171705 5:177378359-177378381 CTCCCTTTGCTTTCTGTCCCTGG - Intergenic
1002250295 5:177924804-177924826 CTCCCTTCCCGGCCTGGCTCAGG + Intergenic
1004171152 6:13296467-13296489 CTGCCTTTCCTTACTGTGGCCGG - Intronic
1007197770 6:40077509-40077531 ATCCCTTCCCCTCCTGTAGCAGG + Intergenic
1007416369 6:41693783-41693805 CTCCCTTCCCATCCTGCAGCAGG + Intronic
1007472321 6:42098974-42098996 CTCCCTGTCCACCCTGTCGTCGG - Intergenic
1007757813 6:44111729-44111751 ATCCCATTCCCTCCTGTCACAGG + Intergenic
1015459024 6:133467049-133467071 CTACCTTTTCTTCCTGTTGCAGG - Intronic
1015545258 6:134355337-134355359 CTGCCTTTCCCTACTGTTGCAGG + Intergenic
1016091536 6:139985193-139985215 CTCCCTTTTGGTCATGTCTCAGG + Intergenic
1018945836 6:168346155-168346177 CTCCCTCTCCGGCCTGGCTCTGG - Intergenic
1021979304 7:26039031-26039053 CTCCCTTTCCGGCACCTCGCTGG - Intergenic
1022794890 7:33724250-33724272 CTCCCTTCCCTTCCAGTCCCGGG + Intergenic
1023719522 7:43078439-43078461 CTCCCTTCCCGTCATGTCTGGGG + Intergenic
1025789988 7:64680224-64680246 CTCCCTGTCTGACCTGTCTCAGG + Intronic
1028123489 7:87084588-87084610 ATGCCTTTCCGTCCTCTCTCAGG + Intergenic
1031026541 7:116685966-116685988 CTCCCCTTCCTTCCTGGCCCAGG + Intronic
1032938063 7:136756965-136756987 CTTCCTTTCCTTCCTTTCACTGG + Intergenic
1034105568 7:148486872-148486894 CTCCCTTCCCACCCTGCCGCGGG + Intergenic
1034410283 7:150937608-150937630 CTCACTTCCCGTCCTGCTGCAGG - Intergenic
1034946586 7:155266435-155266457 CTGCCTTCCCCTCCTGTCACTGG + Intergenic
1040077141 8:43247394-43247416 CTGCCTGTCTTTCCTGTCGCGGG - Intergenic
1040669797 8:49676207-49676229 CTGCCTTTCTGTCCTGAAGCTGG + Intergenic
1046564210 8:115877940-115877962 CTCCCTTTCCCTCTTCTCTCTGG - Intergenic
1046817872 8:118605182-118605204 ATCCCTTTCTGTTCTGTCCCTGG - Intronic
1048907791 8:139105132-139105154 CTTCCTTTCTGTCTTGTTGCTGG + Intergenic
1050090701 9:2015170-2015192 CTCCCTGCCCGTCCGGGCGCGGG - Intergenic
1050754889 9:8990517-8990539 CTCCCCTGCCCTCCTGTCCCTGG + Intronic
1057201378 9:93142172-93142194 CTCCCTCCCTGTCCTGTGGCAGG + Intergenic
1057684531 9:97221026-97221048 CTACCTGTCCTTTCTGTCGCGGG + Intergenic
1057934572 9:99226266-99226288 CTCCCACTCCGTCATGTAGCAGG + Intronic
1058863518 9:109140446-109140468 CTCCCCTTCCCTCCTCTCCCAGG - Intronic
1059024810 9:110615064-110615086 CTCCCTTTCAGTCCTGGTACTGG - Intergenic
1061196559 9:129110186-129110208 CTCCCCTACCGGCCTGTCTCTGG + Intronic
1061430359 9:130526925-130526947 CTCCCTTGTCGTCATGTAGCGGG - Intergenic
1187891718 X:23942376-23942398 CTCCCTCTCGTTCCTGTGGCTGG + Intergenic
1188604908 X:32016270-32016292 CTCCCTTTCCCTCCTGCTTCCGG + Intronic
1189446686 X:41086382-41086404 CCCCCTTCCCGTCCTGTCTGGGG + Intronic
1200078228 X:153562387-153562409 CTTCCCTTGCGTCCTGTCCCTGG - Intronic
1200794137 Y:7325568-7325590 ATCCCTTTCCCTCCTGTGGCGGG + Intergenic
1201065560 Y:10091844-10091866 CTCCCTTGCTCTCCTGTAGCAGG - Intergenic