ID: 1103333116

View in Genome Browser
Species Human (GRCh38)
Location 12:120168572-120168594
Sequence AGCCAGAGTCTGTAAACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103333116_1103333127 20 Left 1103333116 12:120168572-120168594 CCTGAGGTTTACAGACTCTGGCT 0: 1
1: 0
2: 0
3: 16
4: 122
Right 1103333127 12:120168615-120168637 GGGGCTGTTTGGACTCACACTGG 0: 1
1: 0
2: 0
3: 10
4: 119
1103333116_1103333117 -1 Left 1103333116 12:120168572-120168594 CCTGAGGTTTACAGACTCTGGCT 0: 1
1: 0
2: 0
3: 16
4: 122
Right 1103333117 12:120168594-120168616 TTTCCCTGCCCTTCCCTGACTGG 0: 1
1: 0
2: 3
3: 36
4: 426
1103333116_1103333119 1 Left 1103333116 12:120168572-120168594 CCTGAGGTTTACAGACTCTGGCT 0: 1
1: 0
2: 0
3: 16
4: 122
Right 1103333119 12:120168596-120168618 TCCCTGCCCTTCCCTGACTGGGG 0: 1
1: 1
2: 2
3: 67
4: 507
1103333116_1103333128 21 Left 1103333116 12:120168572-120168594 CCTGAGGTTTACAGACTCTGGCT 0: 1
1: 0
2: 0
3: 16
4: 122
Right 1103333128 12:120168616-120168638 GGGCTGTTTGGACTCACACTGGG 0: 1
1: 0
2: 0
3: 7
4: 119
1103333116_1103333118 0 Left 1103333116 12:120168572-120168594 CCTGAGGTTTACAGACTCTGGCT 0: 1
1: 0
2: 0
3: 16
4: 122
Right 1103333118 12:120168595-120168617 TTCCCTGCCCTTCCCTGACTGGG 0: 1
1: 0
2: 24
3: 68
4: 429
1103333116_1103333124 9 Left 1103333116 12:120168572-120168594 CCTGAGGTTTACAGACTCTGGCT 0: 1
1: 0
2: 0
3: 16
4: 122
Right 1103333124 12:120168604-120168626 CTTCCCTGACTGGGGCTGTTTGG 0: 1
1: 0
2: 0
3: 14
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103333116 Original CRISPR AGCCAGAGTCTGTAAACCTC AGG (reversed) Intronic