ID: 1103333122

View in Genome Browser
Species Human (GRCh38)
Location 12:120168602-120168624
Sequence AAACAGCCCCAGTCAGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 261}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103333122_1103333128 -9 Left 1103333122 12:120168602-120168624 CCCTTCCCTGACTGGGGCTGTTT 0: 1
1: 0
2: 0
3: 26
4: 261
Right 1103333128 12:120168616-120168638 GGGCTGTTTGGACTCACACTGGG 0: 1
1: 0
2: 0
3: 7
4: 119
1103333122_1103333133 24 Left 1103333122 12:120168602-120168624 CCCTTCCCTGACTGGGGCTGTTT 0: 1
1: 0
2: 0
3: 26
4: 261
Right 1103333133 12:120168649-120168671 AGGATAATGAAATCCTTCAGAGG 0: 1
1: 0
2: 3
3: 14
4: 211
1103333122_1103333129 4 Left 1103333122 12:120168602-120168624 CCCTTCCCTGACTGGGGCTGTTT 0: 1
1: 0
2: 0
3: 26
4: 261
Right 1103333129 12:120168629-120168651 TCACACTGGGCCATCCCTTCAGG 0: 1
1: 0
2: 0
3: 16
4: 125
1103333122_1103333127 -10 Left 1103333122 12:120168602-120168624 CCCTTCCCTGACTGGGGCTGTTT 0: 1
1: 0
2: 0
3: 26
4: 261
Right 1103333127 12:120168615-120168637 GGGGCTGTTTGGACTCACACTGG 0: 1
1: 0
2: 0
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103333122 Original CRISPR AAACAGCCCCAGTCAGGGAA GGG (reversed) Intronic