ID: 1103333127

View in Genome Browser
Species Human (GRCh38)
Location 12:120168615-120168637
Sequence GGGGCTGTTTGGACTCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103333122_1103333127 -10 Left 1103333122 12:120168602-120168624 CCCTTCCCTGACTGGGGCTGTTT 0: 1
1: 0
2: 0
3: 26
4: 261
Right 1103333127 12:120168615-120168637 GGGGCTGTTTGGACTCACACTGG 0: 1
1: 0
2: 0
3: 10
4: 119
1103333121_1103333127 -6 Left 1103333121 12:120168598-120168620 CCTGCCCTTCCCTGACTGGGGCT 0: 1
1: 0
2: 6
3: 67
4: 438
Right 1103333127 12:120168615-120168637 GGGGCTGTTTGGACTCACACTGG 0: 1
1: 0
2: 0
3: 10
4: 119
1103333120_1103333127 -5 Left 1103333120 12:120168597-120168619 CCCTGCCCTTCCCTGACTGGGGC 0: 1
1: 0
2: 4
3: 57
4: 531
Right 1103333127 12:120168615-120168637 GGGGCTGTTTGGACTCACACTGG 0: 1
1: 0
2: 0
3: 10
4: 119
1103333116_1103333127 20 Left 1103333116 12:120168572-120168594 CCTGAGGTTTACAGACTCTGGCT 0: 1
1: 0
2: 0
3: 16
4: 122
Right 1103333127 12:120168615-120168637 GGGGCTGTTTGGACTCACACTGG 0: 1
1: 0
2: 0
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103333127 Original CRISPR GGGGCTGTTTGGACTCACAC TGG Intronic