ID: 1103333127

View in Genome Browser
Species Human (GRCh38)
Location 12:120168615-120168637
Sequence GGGGCTGTTTGGACTCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103333122_1103333127 -10 Left 1103333122 12:120168602-120168624 CCCTTCCCTGACTGGGGCTGTTT 0: 1
1: 0
2: 0
3: 26
4: 261
Right 1103333127 12:120168615-120168637 GGGGCTGTTTGGACTCACACTGG 0: 1
1: 0
2: 0
3: 10
4: 119
1103333120_1103333127 -5 Left 1103333120 12:120168597-120168619 CCCTGCCCTTCCCTGACTGGGGC 0: 1
1: 0
2: 4
3: 57
4: 531
Right 1103333127 12:120168615-120168637 GGGGCTGTTTGGACTCACACTGG 0: 1
1: 0
2: 0
3: 10
4: 119
1103333116_1103333127 20 Left 1103333116 12:120168572-120168594 CCTGAGGTTTACAGACTCTGGCT 0: 1
1: 0
2: 0
3: 16
4: 122
Right 1103333127 12:120168615-120168637 GGGGCTGTTTGGACTCACACTGG 0: 1
1: 0
2: 0
3: 10
4: 119
1103333121_1103333127 -6 Left 1103333121 12:120168598-120168620 CCTGCCCTTCCCTGACTGGGGCT 0: 1
1: 0
2: 6
3: 67
4: 438
Right 1103333127 12:120168615-120168637 GGGGCTGTTTGGACTCACACTGG 0: 1
1: 0
2: 0
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103333127 Original CRISPR GGGGCTGTTTGGACTCACAC TGG Intronic
902461500 1:16580853-16580875 GAGGCTGGTTGGAGTCACAAGGG + Exonic
902462285 1:16587158-16587180 GAGGCTGGTTGGAGTCACAAGGG + Exonic
902782801 1:18715648-18715670 GAGCCTGTTTGGGGTCACACAGG - Intronic
903159279 1:21473461-21473483 AAGGCTGGTTGGACTCACAAGGG - Exonic
904533548 1:31184203-31184225 GGGTTTGTGTGGACTCACAGGGG + Intronic
904972004 1:34426550-34426572 GTGGCTGGTGGAACTCACACAGG + Intergenic
905223793 1:36466542-36466564 GGGGCTGAGTGGAGTCACAGCGG + Exonic
905270929 1:36786971-36786993 GGGGCTGTTTGAATCCAAACTGG + Intergenic
905658424 1:39701382-39701404 GGTGCGGTTTGGACTAACAGTGG + Intronic
907314832 1:53561650-53561672 GGGGCTGGCTGCACTCACTCAGG + Intronic
908039030 1:60087247-60087269 TGAGGTGTTGGGACTCACACTGG + Intergenic
910744377 1:90557392-90557414 GGGGTTGTTTGAAATCATACAGG + Intergenic
913603186 1:120441359-120441381 GAGGCTGGTTGGAGTCACAAGGG - Intergenic
913640797 1:120810428-120810450 GAGGCTGGTTGGAGTCACAAGGG - Exonic
913990391 1:143606613-143606635 GAGGCTGGTTGGAGTCACAAGGG + Intergenic
914277678 1:146139917-146139939 GAGGCTGGTTGGAGTCACAAGGG + Exonic
914365130 1:146971264-146971286 GAGGCTGGTTGGAGTCACAAGGG - Exonic
914538724 1:148590865-148590887 GAGGCTGGTTGGAGTCACAAGGG + Exonic
914587662 1:149077316-149077338 GAGGCTGGTTGGAGTCACAAGGG + Exonic
916019021 1:160776733-160776755 GAGGCTGGAGGGACTCACACAGG - Intergenic
916518323 1:165540940-165540962 AGAGCTGTTTGGAGGCACACTGG + Intergenic
920302311 1:204996641-204996663 GTGGCTGTTTGGGCTCATGCAGG + Intronic
920516554 1:206588610-206588632 GGGGCAGTATGGACTCAGCCTGG - Intronic
921948077 1:220901890-220901912 GGAGCTGTTAGGATTCACAGTGG - Intergenic
922107129 1:222522326-222522348 GAGCCTGCTTGGAATCACACTGG - Exonic
924049232 1:240063620-240063642 GGGGCTGGTTGGACACACTAAGG - Intronic
1069570691 10:69492802-69492824 TGTGCTGTTTGGACTCTCCCAGG - Intronic
1069784984 10:70982036-70982058 GGTGCTGTTGGGCCTCACCCAGG + Intergenic
1073498197 10:103912939-103912961 AGAGCTGTTTGGACCCACAGAGG + Intronic
1074422368 10:113320441-113320463 GGACATGTTTGAACTCACACAGG + Intergenic
1074879774 10:117646901-117646923 GGGGCTGTTGGGGCTGAAACAGG + Intergenic
1075747149 10:124735980-124736002 GGGACTGTTTGGCGTCACAGAGG - Intronic
1076751633 10:132546347-132546369 GGGGCTGTTCTCACTCACAACGG - Intronic
1077080738 11:723673-723695 GGGGCTGTTGGGACTGATTCAGG + Intronic
1078641566 11:13101666-13101688 GTGGTTGTTTGGCCTCACACAGG + Intergenic
1088702507 11:112426125-112426147 GTGGCTGTTTGGGCAGACACAGG + Intergenic
1094700322 12:32863627-32863649 GGGGCTGTTTAGACTATCAGTGG - Intronic
1095983125 12:47983911-47983933 GAGGCTGTGTGGACCCACATTGG - Intronic
1101230663 12:102737831-102737853 GGGGCTATTAGCACTCACCCAGG - Intergenic
1102533059 12:113561219-113561241 GGGGATGCTGGGACGCACACAGG - Intergenic
1102763511 12:115410404-115410426 GGGGGTTTTGGGACTCAGACTGG + Intergenic
1103333127 12:120168615-120168637 GGGGCTGTTTGGACTCACACTGG + Intronic
1103392492 12:120584672-120584694 GCGGCTGTTTGCAATCACCCGGG + Intergenic
1110282846 13:73715314-73715336 GGCGCTTTATGGACTCTCACTGG + Intronic
1113961381 13:114128174-114128196 GGGGCTGTGTGGCCACACATGGG - Intronic
1116410113 14:44610816-44610838 GGGTTTGTTTGGAATCTCACTGG + Intergenic
1123117339 14:105900666-105900688 GGGGCTGTTCGGAATCCGACGGG + Intergenic
1126291310 15:47083199-47083221 AGGGTTCTTTGGCCTCACACAGG - Intergenic
1127858525 15:62973260-62973282 TTGGCTGTTTGTACTTACACAGG - Intergenic
1128613961 15:69094999-69095021 GGGGCTGTCTGGATGCACACTGG - Intergenic
1128698805 15:69788991-69789013 GAGGCGGGTTGGATTCACACAGG + Intergenic
1131064095 15:89422264-89422286 GGGCATGTTTTGAATCACACAGG - Intergenic
1135591148 16:23706034-23706056 GGGGCTGTTTGGGGTCACTCTGG + Intronic
1135843523 16:25897485-25897507 GGGGCACTTTGGACACAGACGGG + Intronic
1136003337 16:27312702-27312724 GGAGATATTTGGACTCACACTGG - Intergenic
1144814106 17:18021294-18021316 AGGGCTGCTGGGACTCACAAGGG - Intronic
1144959615 17:19037836-19037858 GGGGCTGTGTGGTCTCTGACTGG + Intronic
1144975545 17:19136688-19136710 GGGGCTGTGTGGTCTCTGACTGG - Intronic
1150216800 17:63475902-63475924 GGGGCTGTTGGGAATCACTTGGG - Intergenic
1151387575 17:73764525-73764547 GAGGCTGTTTGGGCTCCCAGGGG + Intergenic
1151597491 17:75087517-75087539 GGGACTGCCTGGACTCCCACCGG + Intergenic
1158075744 18:53526691-53526713 GGGGCTGTTGGCACAGACACAGG - Exonic
1162592176 19:11599123-11599145 AGGGCTGTTTGGGCTGACACAGG + Intronic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1166773674 19:45299721-45299743 GGGGCTGCTTGGAGTCCCAGAGG + Intronic
1167559509 19:50217317-50217339 GTGGCTGCCTGGACTCACACAGG - Intronic
1167652625 19:50741304-50741326 GGTGCAGTTTGGACTAACATTGG - Intergenic
1202677937 1_KI270711v1_random:24600-24622 GAGGCTGGTTGGAGTCACAAGGG + Intergenic
926246248 2:11123951-11123973 GGGGCTGTATGGCCTCCCTCTGG - Intergenic
926482186 2:13413102-13413124 GGGGGTGTTAGAACTGACACTGG - Intergenic
928331503 2:30361214-30361236 GTGGCTGTTAGGCCTCACCCAGG + Intergenic
929625525 2:43402930-43402952 GGGGCAGTTTGGGTTCACACAGG - Intronic
933870767 2:86563324-86563346 GGGGCTGTTTGGAAAGACCCAGG - Intronic
934942980 2:98515794-98515816 AGGGGTGTTAGGATTCACACAGG - Intronic
935169320 2:100598403-100598425 GGGGCAATTTGGAGTCACCCTGG - Intergenic
937895333 2:126973467-126973489 GAGCCAGTTTGGACTCACATGGG - Intergenic
941969050 2:171330143-171330165 GGATCTGTTTGGCTTCACACAGG - Intronic
942445482 2:176074635-176074657 GGGGATCTTTGTAGTCACACAGG + Intergenic
946459819 2:219858630-219858652 GGGCCTGTTTGGACTGGAACAGG - Intergenic
1174048155 20:47748346-47748368 GGGGTTGTGTGGCCTAACACTGG - Intronic
1175522652 20:59611959-59611981 GTGGCTGTCTGGAATGACACAGG + Intronic
1175698586 20:61121244-61121266 AGGCCTGTTTGGAATCACCCAGG - Intergenic
1179611786 21:42556658-42556680 GGGGCTCTTGGGACACAGACTGG + Intronic
1180054303 21:45349224-45349246 GGGGCTGTGGGGACCCAGACAGG - Intergenic
1181599396 22:23940382-23940404 GGGGCTGATGTGACTCACCCAGG + Intergenic
1181609111 22:24000921-24000943 GGGGCTGATGTGACTCACCCAGG - Intergenic
1182427653 22:30283439-30283461 CGGGCTGCTCTGACTCACACAGG - Intergenic
954347764 3:50014754-50014776 TGGGCTGTTGGGAATCACATTGG + Intronic
954639180 3:52087962-52087984 AGCCCTGTTTGGACTCACCCTGG - Intronic
955127846 3:56132126-56132148 GGGACTGTATGCATTCACACGGG - Intronic
959929100 3:111959200-111959222 TGAGCTCTTTGGAATCACACTGG + Intronic
961442810 3:126962808-126962830 AGGGCTGCGAGGACTCACACAGG - Intergenic
963690017 3:148487649-148487671 TTGGGTGTTTGGACTCAGACTGG + Intergenic
964732921 3:159886320-159886342 GGTGCTGTTTGGACTCACCATGG - Exonic
975220467 4:71807776-71807798 TGGGCTCTTTGCACACACACTGG - Intergenic
982676428 4:158381364-158381386 GGGGCTGTTTTGCCTCCCAAGGG - Intronic
986892711 5:12328525-12328547 GGGCCTGTCTAGACCCACACTGG - Intergenic
992198750 5:74364113-74364135 GGGCCTGTTTGGCCTCCCTCTGG + Intergenic
997062963 5:130529155-130529177 TGGGATGTTTGGACCCACAGTGG + Intergenic
1000900340 5:166904715-166904737 GGGGCTGCTTACACTCACAGGGG - Intergenic
1001958990 5:175868593-175868615 GGGCCTGTTTGCACTCCCGCTGG + Intronic
1004177212 6:13350289-13350311 GGGCCTGTTTTGACCTACACAGG + Intergenic
1006396441 6:33790358-33790380 GGGGCTGTTGGGACAGATACGGG - Intergenic
1007500898 6:42296083-42296105 GGGGCTGCGTGGACTCACTGTGG - Intronic
1012636888 6:101554212-101554234 GGGCCTGGTTGGTCTCACATTGG - Intronic
1018698006 6:166405647-166405669 GGGGCTTAGTGGACTGACACGGG + Intergenic
1019301953 7:309847-309869 GGGGCTGTTTCCACACAAACTGG + Intergenic
1020951132 7:14679097-14679119 GGTGCTGTTCTGACTCAGACTGG + Intronic
1022508449 7:30921143-30921165 GGGGCTAAGTGCACTCACACAGG - Intronic
1028262525 7:88683793-88683815 GGGGCTGTTAAAACTCACAAGGG + Intergenic
1030482270 7:110119760-110119782 GTGGCTGTTTGGGCAGACACTGG + Intergenic
1034746634 7:153529230-153529252 GGGCCTGTGTGAACTCACAGGGG - Intergenic
1043738332 8:83775292-83775314 GGGGCAGGGTGCACTCACACTGG - Intergenic
1045734286 8:105276919-105276941 GAGGCTGTGTGGACTTACAAGGG - Intronic
1047961567 8:130015692-130015714 GGGGCTGTGTACACACACACTGG - Intronic
1049747235 8:144268194-144268216 GGGGCTGTCTGCAGTCACCCCGG - Exonic
1050092624 9:2030429-2030451 CTGGCTCTTTGGACTCAGACTGG - Intronic
1053292257 9:36888894-36888916 GGTGGAGTTTGGAGTCACACAGG + Intronic
1053467648 9:38321704-38321726 GGGGCAGTTTAGAGCCACACTGG + Intergenic
1055724417 9:79212124-79212146 GGGGCTTTTTGGACTGAGCCAGG + Intergenic
1056944833 9:90985365-90985387 AGGGCTGCTTGGCCTCACACTGG - Intergenic
1057041913 9:91854105-91854127 GGGTCTGTGTGGCCTCCCACAGG - Intronic
1057217061 9:93234961-93234983 GGGGCCAGGTGGACTCACACAGG - Exonic
1057623415 9:96655921-96655943 GGGCCAGTTTGGTCTCACAAAGG - Intergenic
1061426097 9:130499373-130499395 GGGAGGGTTTGGACCCACACAGG + Intronic
1061892872 9:133631945-133631967 GGGGCTGCTTGGGGTCACACAGG + Intergenic
1186573885 X:10744811-10744833 GGGAGTGTTTGGATTCTCACTGG - Intronic
1189596755 X:42574414-42574436 GAGGCTTTTTGGACTCCAACTGG + Intergenic
1190107635 X:47571263-47571285 GGGGCTGTTGGGATGCCCACAGG + Intronic
1194432298 X:93824014-93824036 GGAGCTGTCAGAACTCACACTGG + Intergenic