ID: 1103335269

View in Genome Browser
Species Human (GRCh38)
Location 12:120184630-120184652
Sequence CCTTGTCTGCAGAATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 3, 2: 5, 3: 57, 4: 381}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103335269_1103335278 28 Left 1103335269 12:120184630-120184652 CCATCCCCATTCTGCAGACAAGG 0: 1
1: 3
2: 5
3: 57
4: 381
Right 1103335278 12:120184681-120184703 TTGCCCAGGATCTAATGGCTAGG 0: 1
1: 0
2: 0
3: 13
4: 147
1103335269_1103335276 14 Left 1103335269 12:120184630-120184652 CCATCCCCATTCTGCAGACAAGG 0: 1
1: 3
2: 5
3: 57
4: 381
Right 1103335276 12:120184667-120184689 AGAGGTTAAGTAACTTGCCCAGG 0: 19
1: 166
2: 533
3: 1293
4: 2621
1103335269_1103335277 23 Left 1103335269 12:120184630-120184652 CCATCCCCATTCTGCAGACAAGG 0: 1
1: 3
2: 5
3: 57
4: 381
Right 1103335277 12:120184676-120184698 GTAACTTGCCCAGGATCTAATGG 0: 1
1: 1
2: 4
3: 39
4: 280
1103335269_1103335275 -4 Left 1103335269 12:120184630-120184652 CCATCCCCATTCTGCAGACAAGG 0: 1
1: 3
2: 5
3: 57
4: 381
Right 1103335275 12:120184649-120184671 AAGGAAACTGAGGCACAGAGAGG 0: 67
1: 617
2: 2313
3: 5592
4: 10272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103335269 Original CRISPR CCTTGTCTGCAGAATGGGGA TGG (reversed) Intronic
901241598 1:7697334-7697356 CCTCGTCAATAGAATGGGGATGG - Intronic
901445136 1:9303910-9303932 CCCTGTCAGCAGAAAAGGGATGG - Intronic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
902471312 1:16648864-16648886 CCTGGTCTGTAGGATGGGGTGGG - Intergenic
902487495 1:16758581-16758603 CCTGGTCTGTAGGATGGGGTGGG + Intronic
902759659 1:18572885-18572907 GTTTCTCTGCAGAATGGGGAGGG - Intergenic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903959417 1:27047386-27047408 CCTTGCCTGCTGAGTTGGGATGG - Intergenic
904840268 1:33368011-33368033 CCTCATCTACGGAATGGGGAGGG - Intronic
904882927 1:33714390-33714412 CCTTATCTGCAAAATAGGGATGG - Intronic
905145982 1:35887122-35887144 CCCTGTCTGCAGAGTGGGACTGG + Intronic
905531035 1:38678842-38678864 CCTCATCTGCACTATGGGGATGG + Intergenic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906112816 1:43335872-43335894 CCTTGCCTGGGGACTGGGGAAGG + Intergenic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
913185563 1:116367701-116367723 CTCTGTCTGCAGAGTGGGAAAGG - Intergenic
915046176 1:153018749-153018771 CCCTGTCTGGTGAAGGGGGATGG - Intergenic
915741126 1:158119040-158119062 CCTTGACTGCAGAGTGGGAGGGG + Intergenic
917517453 1:175719808-175719830 GCTGGTTTGAAGAATGGGGAGGG - Intronic
918458935 1:184755544-184755566 TCTCGTCTGCAAAAGGGGGATGG - Intergenic
918703039 1:187629567-187629589 CCTTTACTGAAGAATGGGGATGG + Intergenic
920876932 1:209845102-209845124 CCTTGTTCCCAGGATGGGGAGGG + Intronic
920961723 1:210669900-210669922 CCTTGTGGGAAGAATGGGGTTGG + Intronic
921260959 1:213384689-213384711 CCTTGTCTGTAGAATGGAGATGG - Intergenic
922023354 1:221727035-221727057 GCTTGTCTATAAAATGGGGAGGG - Intronic
922430765 1:225550194-225550216 CTATGTTTGAAGAATGGGGAGGG - Intronic
923196555 1:231673970-231673992 CATTGTGTGCAGAATAGGGTAGG + Intronic
923897471 1:238288095-238288117 CCTTGTCTGCAGAAGTTGTAAGG - Intergenic
923966761 1:239150114-239150136 CCTTATCTGCAAAAAGTGGATGG - Intergenic
924011825 1:239673217-239673239 CCTTGTCCAGAGAATGGGGTAGG + Intronic
924633338 1:245762853-245762875 CCTTGTGTGCAGAAGAGTGACGG - Intronic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
924929047 1:248711486-248711508 CCTTTTCTCCGCAATGGGGAGGG - Intergenic
1064120510 10:12614175-12614197 CCTTATCTCCAAAATGGGCATGG + Intronic
1067178451 10:43966979-43967001 CCCTCTCTGCATTATGGGGATGG - Intergenic
1067688144 10:48480192-48480214 TCTTGTCTTCAGGATGGGGAAGG - Intronic
1069624892 10:69861449-69861471 CCTTAACAGCTGAATGGGGATGG + Intronic
1069892016 10:71657867-71657889 CTTTATCTGCAGCCTGGGGAGGG + Intronic
1070464290 10:76703934-76703956 CTTTGCTTGCAGAAAGGGGAGGG + Intergenic
1070766431 10:79059235-79059257 CCTTATCTGTAAAGTGGGGATGG - Intergenic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1072664925 10:97385791-97385813 CCTTGTCTACAGAGTGAGGTTGG - Intronic
1072686443 10:97540040-97540062 CCTTCTCTGAGGAAGGGGGAGGG + Intronic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1073426850 10:103460146-103460168 CCATCTCTGTAAAATGGGGATGG - Intergenic
1073683910 10:105732229-105732251 CCTTTTCTGAAGATTGAGGATGG - Intergenic
1074509759 10:114101382-114101404 CCCGGCCTGCAGAGTGGGGAGGG + Intergenic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074971552 10:118543571-118543593 TTCTGTGTGCAGAATGGGGAAGG + Intergenic
1075178311 10:120186146-120186168 CCTATTCTGCTGAAGGGGGATGG + Intergenic
1078092837 11:8278008-8278030 CCCTGCCTGCAGCATGGAGAAGG - Intergenic
1078359661 11:10658455-10658477 CCCTGTTTGGAGAATGGCGAGGG - Intronic
1078455662 11:11472781-11472803 CCTTGTATACAAAATGAGGATGG - Intronic
1078535627 11:12171088-12171110 CCTTCCCTGCAGGGTGGGGATGG + Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079098150 11:17524302-17524324 CCTTCTCTGCAGGGTGGGTAGGG + Intronic
1079129158 11:17737523-17737545 CCTTATCTGTAAAATGGGGGAGG + Intronic
1079400301 11:20101613-20101635 CCTTCTCTGTAAAATGGGGATGG - Intronic
1080014419 11:27489671-27489693 TCCTGTCTGCAGCATGGGAAGGG + Intergenic
1080197944 11:29633511-29633533 ACTTTTCTGCAAAATGTGGAAGG + Intergenic
1083150090 11:60786496-60786518 CCCTGTAAGCAGGATGGGGATGG + Intronic
1083700507 11:64474447-64474469 CCTTTTCTACAAAATGAGGATGG + Intergenic
1083767286 11:64847674-64847696 CCTTGTCTGTAAAAGGGGGTTGG + Intergenic
1084155962 11:67312642-67312664 CCTTCTCTGCTGGCTGGGGAAGG + Intergenic
1084937024 11:72592330-72592352 CATTGGCTGCTGACTGGGGAGGG - Intronic
1085267220 11:75244011-75244033 CCTCATCTTCAGGATGGGGATGG + Intergenic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085708843 11:78811134-78811156 CCTTGTCTATAAAATGGGAATGG - Intronic
1085876924 11:80418754-80418776 CCTTGTCTGTAAAATGGGAAGGG + Intergenic
1086084120 11:82937718-82937740 CATGGCCTGCAGAAGGGGGAAGG + Intronic
1089022079 11:115226649-115226671 ACTTGTCTGCAGAGAGAGGACGG + Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1092728274 12:11505382-11505404 TCTTGTCTGGAAAATGGGGTTGG - Intergenic
1093302984 12:17477465-17477487 CCTTTCCTGAAGAATGAGGACGG - Intergenic
1093317154 12:17666249-17666271 CATTGCCTGCAGCATGGCGAGGG + Intergenic
1093358900 12:18200439-18200461 CCTTTCCTGAAGATTGGGGATGG - Intronic
1093484406 12:19637932-19637954 CTTTTTCTGCAAAATGGGGATGG + Intronic
1094038867 12:26102045-26102067 CCTTATCTATAGAATGGGGATGG - Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094237452 12:28184935-28184957 CCTTATCTCCATAATGGGCATGG + Intronic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096618152 12:52846282-52846304 CCTTGTCTCCAGGATGTGGATGG - Exonic
1097335864 12:58382637-58382659 CCTTTTCTGGAGAATGCAGAAGG + Intergenic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1098075430 12:66724789-66724811 CTTTGTCTGCAGAAGTGGAAGGG + Intronic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1099657543 12:85513652-85513674 CCTTGTCTCTAGAATCTGGAAGG - Intergenic
1099899736 12:88693086-88693108 TCGTGTGTGCAGAAGGGGGAGGG + Intergenic
1100137561 12:91572349-91572371 CCCTGTATGCAGTATGGGAAAGG - Intergenic
1100271783 12:93032399-93032421 CCTTGTCTATAAAATGGGCATGG - Intergenic
1101294180 12:103403650-103403672 CCATGTCTGCAGGGAGGGGAAGG + Intronic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102721179 12:115017734-115017756 CCATGTCTGCAGCATGAGGTAGG - Intergenic
1103261476 12:119593079-119593101 CCTTGTTTCCACACTGGGGAGGG + Intergenic
1103335269 12:120184630-120184652 CCTTGTCTGCAGAATGGGGATGG - Intronic
1103462677 12:121117515-121117537 CATGGTCAGCAGAATGAGGATGG + Intergenic
1103822952 12:123712787-123712809 CCCCGTCTGGACAATGGGGACGG - Intronic
1103931837 12:124454640-124454662 CCTTTTCTGCCAAATAGGGATGG - Intronic
1104098947 12:125588228-125588250 CCTTATCTATAAAATGGGGATGG + Intronic
1104390974 12:128390400-128390422 CCAGCTCTGCAGAATAGGGAAGG - Intronic
1104481115 12:129109344-129109366 TCTCCTCTGCAAAATGGGGATGG + Intronic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1110167436 13:72460324-72460346 CTTGGTCTGTAGAATGGGGAGGG + Intergenic
1113832290 13:113305617-113305639 CCTTTGCTTCAGGATGGGGAAGG + Intronic
1114408581 14:22479255-22479277 CCTCCTCTGTAGAATGGGGGAGG + Intergenic
1115099004 14:29675407-29675429 GGTTGTCAGAAGAATGGGGATGG - Intronic
1119669273 14:76506369-76506391 CCTTCTCTGCAGAATGGTGGGGG + Intergenic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1120875264 14:89369504-89369526 CCTTGTCAGCAGCATGAGAATGG - Intronic
1121096920 14:91223853-91223875 GCTTATCTGTAAAATGGGGAGGG - Intronic
1121495632 14:94389898-94389920 CCCTATCTGTAAAATGGGGATGG + Intronic
1121898378 14:97670250-97670272 ACGTGTCTGCAGAAATGGGAGGG - Intergenic
1122532961 14:102441819-102441841 TACTGTCAGCAGAATGGGGAAGG + Intronic
1122623464 14:103072642-103072664 CCTTATCTGCACAGTGAGGAGGG - Intergenic
1124455108 15:29835021-29835043 CCTCATCTGCAGAATGGAGGAGG + Intronic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1125591320 15:40856259-40856281 CCTTCTCTGCAGAATGATGAGGG - Exonic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1126231076 15:46325845-46325867 CCTTGTCTGCAGGATTTGGAAGG - Intergenic
1127310097 15:57744853-57744875 CCACATCTGCAGAATGGGGCTGG - Intronic
1128704213 15:69826969-69826991 CCTTCTCTGCAAAATTAGGAAGG - Intergenic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129331077 15:74827438-74827460 CCTTTTCTGGAAAGTGGGGATGG + Intronic
1130304954 15:82707201-82707223 CCTTTTCTGAAGATTGAGGATGG - Intronic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1131365196 15:91833198-91833220 CCCTTTCAGCAGAAGGGGGATGG - Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132561250 16:595287-595309 CCTCGTCTGCACAGTGGGGGTGG - Intronic
1132708761 16:1257432-1257454 CCTTGTCTGTAGCACAGGGATGG - Intronic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133736351 16:8618988-8619010 CCATGTCTGCAGCAGAGGGAAGG - Intergenic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134677644 16:16101910-16101932 CCTTGGTTGCAGAATTAGGAAGG - Intronic
1135151233 16:20008011-20008033 CATAGTCTGGAGACTGGGGATGG - Intergenic
1135514419 16:23118135-23118157 TCTTTTCTGCAAAATGGGAATGG + Intronic
1135968709 16:27056497-27056519 CCTTGTGTGATGGATGGGGATGG - Intergenic
1136676543 16:31913682-31913704 CTCTGCCTGCAGAAAGGGGAGGG - Intronic
1136710945 16:32235739-32235761 GCTTGTCAGGAGCATGGGGATGG + Intergenic
1136756963 16:32693672-32693694 GCTTGTCAGGAGCATGGGGATGG - Intergenic
1136811146 16:33176703-33176725 GCTTGTCAGGAGCATGGGGATGG + Intergenic
1136817622 16:33286783-33286805 GCTTGTCAGGAGCATGGGGATGG + Intronic
1136824186 16:33343312-33343334 GCTTGTCAGGAGCATGGGGATGG + Intergenic
1137291738 16:47056129-47056151 CTTTGTCTGTACAATGGGGATGG + Intergenic
1137378955 16:47980012-47980034 GCTGTTCTGCAGAATGTGGAAGG - Intergenic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1137699314 16:50484912-50484934 CCCTGTCTGTAAAATGGGGAGGG - Intergenic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138131681 16:54485154-54485176 CCTCGTCTGTAGAATGGATATGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1139372260 16:66476423-66476445 CCTTGTCTGTAGAATGGGGATGG + Intronic
1139907489 16:70376717-70376739 CCTTGTCTGCTGCCTGTGGATGG + Exonic
1140443323 16:75003493-75003515 CCTTACCTGCACAATGGGGGTGG - Intronic
1140696874 16:77543421-77543443 CCCTGTCTGTAGAAGGAGGAAGG + Intergenic
1140971021 16:80012610-80012632 TCTTATTTGCAGAATGGGAATGG - Intergenic
1142363241 16:89637033-89637055 CCTTGTCTGTAAAATGGAGCTGG + Intronic
1203059112 16_KI270728v1_random:954023-954045 GCTTGTCAGGAGCATGGGGATGG - Intergenic
1142933416 17:3307839-3307861 CCTGGCCTGCAGCATGGGGCTGG - Intergenic
1143295358 17:5867309-5867331 TCTTGGCTGCAGCCTGGGGAGGG + Intronic
1143392374 17:6567297-6567319 CCTTATCTGTAAAATGGGAATGG - Intergenic
1143751503 17:9031554-9031576 CTCTGTCTGCAGGTTGGGGAAGG - Intronic
1144743432 17:17597163-17597185 CCGTGTCTGTGGAATGGGGAGGG + Intergenic
1144860850 17:18300865-18300887 CATGGTCTGCAGAAGGGGCAGGG + Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145059187 17:19721462-19721484 CCTGGCCTGCAGGATTGGGAGGG - Intergenic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1146950415 17:36901518-36901540 TCTTGTCTGTAAAATGGGGATGG - Intergenic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1150233319 17:63571626-63571648 CCTTTTCTGAAAAATGAGGATGG + Intronic
1150316590 17:64174377-64174399 ACTAGTAAGCAGAATGGGGAGGG + Intronic
1150456887 17:65313425-65313447 CAGTGTCTGCAGAGTGGGGCTGG - Intergenic
1151352772 17:73541496-73541518 CCTTGTCTGTGAAATGGGGGTGG - Intronic
1151929818 17:77225291-77225313 CCTTATTAGCAGAATGAGGATGG - Intergenic
1152173989 17:78774590-78774612 CCATGTCTCCAGAATAGGCATGG - Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152585553 17:81187997-81188019 CCCTGTCTGCAAAAGGGGGAAGG + Intergenic
1153097412 18:1423322-1423344 CCTTCTCTGTAAAATGGAGATGG + Intergenic
1154023555 18:10685908-10685930 CCCTTTCTGCAGGATGGTGATGG + Intronic
1154245241 18:12690941-12690963 TCTTGTGTGCAGAACGGGGGGGG - Intronic
1155244837 18:23897465-23897487 GCGTGTGTGCAGAATGGTGAAGG - Intronic
1155250579 18:23949662-23949684 GCTTGTCAGCAAAAGGGGGAAGG - Intronic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1156849732 18:41712481-41712503 CCTTCTTTGAAGAATGGGGCAGG - Intergenic
1157444005 18:47731324-47731346 CCGTGAGAGCAGAATGGGGAAGG + Intergenic
1157528255 18:48401571-48401593 CCCCATCTGCAGTATGGGGATGG + Intronic
1158140443 18:54249977-54249999 CCAAGTATGCAGAATGTGGAAGG - Intergenic
1159442758 18:68502848-68502870 CCTTGTCTGCAAAATGGGGATGG - Intergenic
1159503544 18:69305221-69305243 CCTTGACTGCAAACTGAGGAGGG - Intergenic
1160094971 18:75862777-75862799 GCTTGTCAGCACAATGGGCAGGG + Intergenic
1160152477 18:76405809-76405831 CCCTGACTGAAGTATGGGGAGGG - Intronic
1160879705 19:1313752-1313774 CCTTGTCTGGAACAGGGGGAGGG + Intergenic
1161028510 19:2047517-2047539 GCTTGTCCACAGAATGGGGACGG + Intronic
1161244897 19:3245537-3245559 CCTTGTCTGCAGGGTTTGGAGGG - Intronic
1161310552 19:3591683-3591705 ACTGGGCTGCAGGATGGGGATGG - Exonic
1161439389 19:4281902-4281924 CCTTGTCTGGAAAAGGGGAATGG + Intronic
1161913273 19:7210568-7210590 CCCTGTCTGTAGAATGGGCTGGG + Intronic
1162552064 19:11363627-11363649 CCTTATCTGAAAAATGGGGATGG + Intronic
1162918963 19:13889289-13889311 CCTGGTCTGCAGAATGAGGCAGG + Exonic
1163238880 19:16046632-16046654 CCTTGACGGGAGAATGGTGATGG + Intergenic
1164690316 19:30206097-30206119 CCTTCTCTATAAAATGGGGATGG - Intergenic
1165906195 19:39196352-39196374 CCCCCTCTGCAGAGTGGGGAGGG + Intergenic
1166258502 19:41621763-41621785 TGTTTTCTGCAGAAAGGGGAAGG + Exonic
1166411135 19:42555918-42555940 TTTTTTCTGCAGAAAGGGGAAGG + Intronic
1166566699 19:43769917-43769939 GCTTGTCTGCTAACTGGGGATGG - Intronic
1167019709 19:46863897-46863919 CCTGGTCTTCAAAATGGTGAGGG + Intergenic
1167643857 19:50695445-50695467 CCTTGGCGGGAGAAGGGGGAGGG + Intronic
1167685507 19:50953201-50953223 CCTGGCCCGGAGAATGGGGAGGG + Intergenic
1167917719 19:52755653-52755675 CCTTTTCTGAAGATTGAGGACGG - Intergenic
1168297145 19:55383018-55383040 CCTCCACTGCAGAATGGGGATGG + Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168645405 19:58056164-58056186 TGTTGGCTGCAGGATGGGGATGG - Intergenic
1202703711 1_KI270713v1_random:5659-5681 CCTGGTCTGTAGGATGGGGTGGG - Intergenic
925712051 2:6750609-6750631 CCTTATCTGCAGAATAGGCAAGG - Intergenic
926855160 2:17248015-17248037 CCTTGTCTGTAAGATGGAGATGG + Intergenic
928130497 2:28645684-28645706 CCTTCTCTGTAGAAAGGGAATGG - Intergenic
928240153 2:29578955-29578977 CATGGACTGCTGAATGGGGAGGG + Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
932777866 2:74539265-74539287 CTTTGTGGGCAGCATGGGGATGG + Intronic
935507579 2:103925353-103925375 CCTGGCCTGCAGCATGGGGCTGG + Intergenic
935555661 2:104507215-104507237 CCTCGTCTGTAAAATGGAGATGG - Intergenic
935658416 2:105444322-105444344 GCCTGTCTGCAGAATCTGGAAGG + Intergenic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
938615362 2:132992120-132992142 CCTTATCTGTAAAATGGGAAAGG - Intronic
938703391 2:133898891-133898913 CCGTGTCTGAAAACTGGGGAGGG - Intergenic
940176089 2:150878939-150878961 CCATATATGCAGAGTGGGGAGGG + Intergenic
941751845 2:169142565-169142587 CCTTTGCAGCAGAGTGGGGATGG - Intronic
945306840 2:208266616-208266638 CCTTGTCTGGCGAGTGGGGACGG + Intronic
946046099 2:216822372-216822394 CCTAATCTGGAAAATGGGGATGG - Intergenic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
948501341 2:238397206-238397228 CCTTCCCTGCTCAATGGGGATGG - Intronic
948794928 2:240397628-240397650 CCTCGTCTGTAGAAAGGGGTTGG - Intergenic
1171436637 20:25129918-25129940 CCTTGTCTGTAAAATGGAAATGG + Intergenic
1172538919 20:35696253-35696275 CCTTCTCTTCACAATGGGGTGGG + Intronic
1172612552 20:36262629-36262651 CCTTGTCTGGACAACGAGGAAGG - Intronic
1172645686 20:36467886-36467908 CCTTATCTGCAAAACAGGGATGG - Intronic
1172905250 20:38364301-38364323 CCTTTTCTGCATGATGGGCAAGG - Intronic
1173103217 20:40107039-40107061 CCCTGTCTGAAGAATAGGGGTGG + Intergenic
1173153770 20:40590212-40590234 CCTTATTTGAAAAATGGGGAGGG - Intergenic
1173664176 20:44753384-44753406 CCTTGTCTGTAAAATGGAAATGG + Intronic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1175019405 20:55828337-55828359 CCTAATCTGCAACATGGGGATGG + Intergenic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175550085 20:59811852-59811874 CCTTGTTTGTGAAATGGGGATGG + Intronic
1176118568 20:63444045-63444067 CTTTGTCTGCAGAATGGGCAGGG - Intronic
1176267318 20:64216980-64217002 CCTGGGCTGCAGATTGGGGTTGG + Intronic
1177412607 21:20749884-20749906 CCATGTCTCCAGAATGAGAAGGG - Intergenic
1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG + Intergenic
1178089091 21:29142796-29142818 CCTCCTCTGCAAAATGGGAAGGG - Intronic
1178248696 21:30979789-30979811 CCTTATCTGTAAAATGGGCATGG + Intergenic
1178294792 21:31400613-31400635 CCTTATCTGTAAAATGGGGTAGG - Intronic
1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG + Intronic
1181907041 22:26206474-26206496 CCTTATTTTCAAAATGGGGATGG - Intronic
1182427987 22:30284931-30284953 CCTCGTCTGGAAAATGGTGATGG + Intergenic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1182898085 22:33875243-33875265 CTTTCTCTCCAGAATGGTGAGGG - Intronic
1183114834 22:35683388-35683410 CCTTATATGCAGATTGGAGAAGG + Intergenic
1183479566 22:38056164-38056186 CCTTGCCTGCACAATGTGGCTGG + Intergenic
1183740492 22:39666138-39666160 CCTCTTCTGCAAAATGGGTAAGG + Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184902442 22:47456331-47456353 CCTTGTCTTGAGAATGGGAAGGG - Intergenic
1185252575 22:49812779-49812801 CCTTGTCTCCAGAATGGTCCTGG - Intronic
1185252598 22:49812904-49812926 CCTTGTCTCCAGAATGGTCCTGG - Intronic
1185280312 22:49967038-49967060 CTCTGTCTGCAGAAAGGGGAAGG + Intergenic
949319293 3:2790880-2790902 TCATGTCTGCAAAATGGTGATGG - Intronic
949917439 3:8975697-8975719 CCTTGGCTGCAGCCTGGGGCAGG + Intergenic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950772601 3:15324148-15324170 CATTGTCTGCAGGTTGAGGAAGG - Intronic
951411263 3:22370715-22370737 CCTTGTCTACGGAATGGAGATGG + Intronic
951600803 3:24372701-24372723 TCCTGTCTGTAAAATGGGGATGG - Intronic
952474465 3:33692608-33692630 CCTTGTCTGTAAAATACGGAAGG + Intronic
952881087 3:37986778-37986800 CCTGGGCTGCAGGATGTGGAAGG - Intergenic
952943591 3:38460917-38460939 CCTTGGCTGGAGAATGGAGGAGG + Intronic
952986575 3:38790767-38790789 CATTATCTGTAAAATGGGGATGG + Intronic
953274633 3:41482763-41482785 ACTTGTCTGCAGAGAGAGGAAGG - Intronic
954298120 3:49685377-49685399 CCTGGTCTGTAGGATGGGGTGGG + Exonic
955131690 3:56175692-56175714 CCCTGAATGCAGAATTGGGAAGG + Intronic
955338827 3:58109167-58109189 GCTTTTTTGCAGGATGGGGAAGG + Exonic
955730363 3:61978979-61979001 CATTATCTGTAAAATGGGGAAGG + Intronic
956093481 3:65692562-65692584 CCTTATCTACAAAATGGGGATGG - Intronic
956440945 3:69279811-69279833 CCTTTTCTGCAGAAGTGGGAAGG - Intronic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956882597 3:73526371-73526393 CCTTATCTGTGGAATGGGTATGG - Intronic
957385049 3:79485661-79485683 CTGTATCTGCAAAATGGGGATGG - Intronic
958052242 3:88363121-88363143 CACTGCCTGCAGAGTGGGGATGG + Intergenic
961440087 3:126947603-126947625 CCCCGTCTGCAGAACGGGGTGGG + Intronic
962408114 3:135117659-135117681 ACTAGTCTCCAGAATGGGAAGGG - Intronic
963233031 3:142928005-142928027 CCTTATCTGTAAACTGGGGATGG + Intergenic
963840935 3:150105711-150105733 CTTTGTATGCATAATGGGGTTGG + Intergenic
963955936 3:151253715-151253737 GCTTGTCTGGGGAATGGGGTGGG + Intronic
966808031 3:183821357-183821379 CCTTGTCTGTAGAATGGGGACGG + Intronic
966850733 3:184163645-184163667 CTTTCTCTGCAGAGTGGTGAAGG + Exonic
968072038 3:195790093-195790115 CCTTTGCTGGAGAATGAGGAAGG + Exonic
968466755 4:755688-755710 CCTTGTGTGTAGAATGGACAAGG + Intronic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
969814247 4:9674902-9674924 CCTTGTCTGTAACTTGGGGATGG - Intergenic
970560355 4:17276170-17276192 CCTCGTCTGTAAAATGGGAAGGG + Intergenic
971157329 4:24097085-24097107 CCCTGTCTCAACAATGGGGAAGG + Intergenic
971565433 4:28133319-28133341 CCTTGACTGTGGAGTGGGGAAGG - Intergenic
973158812 4:46991730-46991752 CCTTATCTGTAAAGTGGGGATGG + Intronic
973194508 4:47424330-47424352 CCTTATCTATAAAATGGGGATGG + Intronic
973668846 4:53192664-53192686 TCTTATCTACAAAATGGGGATGG + Intronic
975657495 4:76656208-76656230 CCTTGTCTTGGGAATGGTGAGGG - Intronic
975677957 4:76846248-76846270 CCTTGTCTAAAGCATGGGGCTGG + Intergenic
975767849 4:77687807-77687829 ACTTGTCTTCAGTTTGGGGATGG + Intergenic
978701738 4:111655160-111655182 CCTGGTCTGTAGAGTGGGTAAGG - Intergenic
979353218 4:119670423-119670445 CCTTGTCTGTAAAATGAGAATGG + Intergenic
983346921 4:166538646-166538668 CCTTATCTTCAGAAAGGGGATGG + Intergenic
986410624 5:7475302-7475324 CGTGGTCTGGAGAATGGAGAGGG + Intronic
986631112 5:9775168-9775190 CTTTGTGTGCAGAAAGGGGAGGG - Intergenic
987353670 5:17043584-17043606 CTTTGTCTGGAGCAAGGGGAAGG - Intergenic
990176887 5:53117956-53117978 CATTGTCTGCAAAATGCTGAGGG + Intergenic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
995963301 5:117872229-117872251 CCATTTCTGCAGAATGGTCAGGG + Intergenic
998059766 5:139110777-139110799 CCCTGTCTTCAGAAGAGGGAAGG + Intronic
998409452 5:141898187-141898209 CCTTTTCTTCAGTATAGGGAGGG - Intergenic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998516954 5:142764976-142764998 CCTTACCTGTAAAATGGGGATGG + Intergenic
998633763 5:143929802-143929824 CCTTCTCTGCAAAATAGGAATGG + Intergenic
999563447 5:152830571-152830593 CCTCAACTGCAGAATGGTGATGG - Intergenic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
999996231 5:157095035-157095057 CCTTCACTGTAAAATGGGGATGG + Intronic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1001879992 5:175235017-175235039 CCTCGTCAGCAGAATGAGGTTGG - Intergenic
1004743666 6:18488770-18488792 CCTTGAATGCACAATGGGAATGG + Intergenic
1006884293 6:37367810-37367832 TTTTGTCTGCAGAACAGGGATGG - Intronic
1006990472 6:38210988-38211010 CCTTTTGCCCAGAATGGGGAAGG - Intronic
1007112864 6:39323034-39323056 CCTTGGCTACAAAATGGGGCAGG + Intergenic
1007187851 6:39987694-39987716 CATTGTCTGTACAATGGGCAAGG - Intergenic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008010483 6:46461897-46461919 TCTTGACTGCAGAATGGAGAAGG + Intronic
1008886124 6:56432856-56432878 CCATGTCTGCAGCATGTGGGTGG - Intergenic
1009270203 6:61604995-61605017 CCTTTTCTGAAGATTGAGGATGG - Intergenic
1011178331 6:84588987-84589009 TATTGTCTGGAAAATGGGGAAGG - Intergenic
1011688183 6:89840881-89840903 CCTTATCAGCAGAATGGTGGAGG - Intronic
1013285413 6:108677192-108677214 CCCTTTCTGCAGATTGGGGTTGG - Intronic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1013646088 6:112142753-112142775 CCTTGTCTACACAGTTGGGAGGG + Intronic
1015267913 6:131307631-131307653 TCTTGTCTGTGGAATAGGGAGGG - Intergenic
1015744350 6:136493929-136493951 TCATGTCTGTAAAATGGGGAAGG + Intronic
1016190769 6:141261496-141261518 GCTCCTCTGCAGAAAGGGGAGGG + Intergenic
1017064091 6:150512709-150512731 CCTTGCCAGCAGAAAGGGCATGG + Intergenic
1017444943 6:154499141-154499163 TCCTTTCTGCAGAATAGGGAGGG - Intronic
1017922414 6:158883867-158883889 CCTTTCCTGAAGATTGGGGATGG + Intronic
1019020484 6:168913771-168913793 CCTTGCCGGCAGATTGTGGATGG - Intergenic
1019336186 7:484054-484076 CCCTCTCTGCAGTCTGGGGAGGG - Intergenic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1019653252 7:2172259-2172281 GCTTGTCTGTTGAATGGGAAGGG - Intronic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022247196 7:28571717-28571739 CCTTATCCCCAGAATGAGGATGG + Intronic
1022673316 7:32476270-32476292 CCTACTCTGCAAAATGGGGATGG - Intergenic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1023881024 7:44321518-44321540 CTTTGTCTGTAAAATGGGGCTGG + Intronic
1024177971 7:46860754-46860776 CCTTCACTGCAGAATGGAGATGG - Intergenic
1026212940 7:68323038-68323060 CTTTGTCTACAGATTTGGGATGG + Intergenic
1026574828 7:71563452-71563474 CCTTGTCCTCTGACTGGGGAGGG - Intronic
1026892135 7:73988477-73988499 CCTTGTCTGGTGACTGGGGAGGG - Intergenic
1026935877 7:74254945-74254967 CCTCCTCTGCAAAATGGGGTGGG - Intergenic
1027522209 7:79223516-79223538 TCTTGTCTGAAAAATGGAGATGG - Intronic
1027987527 7:85312561-85312583 CCTTGTCTCTAAAATTGGGATGG - Intergenic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1030889513 7:114982176-114982198 CCTGATGTGCAGAATGGGGCAGG + Intronic
1031948171 7:127863046-127863068 CCTTGTTTGCAAAATGAGGGAGG - Intronic
1032488575 7:132306837-132306859 CCCTTTCTGCAGAATGAGAAAGG - Intronic
1032518857 7:132527409-132527431 CCTCATCTGCTCAATGGGGATGG - Intronic
1033464601 7:141579286-141579308 CCTTTTCTGAAGATTGAGGAAGG + Intronic
1033499947 7:141937434-141937456 CTCTGCCTGCAGAAAGGGGAGGG + Intronic
1033660098 7:143396992-143397014 CCTGGCCTCCAGGATGGGGAGGG + Intronic
1034329537 7:150270414-150270436 CCTTCTCGGCAGAATGGGGATGG - Intronic
1034453391 7:151149919-151149941 CCTTGGCTGGGGAAAGGGGAAGG - Intronic
1034668519 7:152839447-152839469 CCTTCTCGGCAGAATGGGGATGG + Intronic
1036062781 8:5342744-5342766 CTGTGTCTGCAGAATATGGAGGG + Intergenic
1036496870 8:9277696-9277718 CCTTCTCTTCAGAATATGGAGGG + Intergenic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1037290251 8:17342690-17342712 CCGTCTCTGCAGAATGGTGTTGG - Intronic
1038524068 8:28258197-28258219 CCTTGTCTGAAAAATGGAGATGG + Intergenic
1038644345 8:29350335-29350357 CCTAGGCTGCAGAAAGGGGCGGG + Exonic
1042224380 8:66504138-66504160 TCTTCTCTGCACAGTGGGGAGGG - Intronic
1042864029 8:73341115-73341137 CCTTGCCTGCAGAGAGGGGCTGG - Intergenic
1043268931 8:78304105-78304127 CCTTATCAGTAAAATGGGGATGG + Intergenic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1046668042 8:117026695-117026717 CCTTATCTGCAGAACAGGGGAGG + Intronic
1047873030 8:129106091-129106113 CCTGGCCTGTAAAATGGGGATGG + Intergenic
1048568777 8:135632367-135632389 CCTTGACTCCAGAATGCAGAGGG - Intronic
1049017951 8:139934687-139934709 CCATCCCTGCAGACTGGGGAAGG + Intronic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049290293 8:141798081-141798103 CATTGTCGGGAGACTGGGGAGGG + Intergenic
1049309166 8:141924293-141924315 CCTGGTCTGCAGCATGGAGGTGG - Intergenic
1049553979 8:143273271-143273293 GCCTGTCTCCACAATGGGGAGGG + Intronic
1050118214 9:2282071-2282093 AATTGTCTTCAGGATGGGGATGG - Intergenic
1050508280 9:6369487-6369509 CTATGCCTGCAGAAAGGGGAGGG + Intergenic
1053004297 9:34593934-34593956 TCTAGGCTGCAGAATGGGGTGGG - Intergenic
1053313095 9:37031807-37031829 CCCTATCTGCCCAATGGGGAGGG - Intronic
1053350269 9:37409390-37409412 CCTTATCTGTAAGATGGGGATGG + Intergenic
1053419479 9:37968276-37968298 ACTTATCTGTAAAATGGGGATGG - Intronic
1055574898 9:77650958-77650980 CCTTATCTGTAGAATCTGGAAGG + Intergenic
1056363283 9:85880121-85880143 CCTTTTCTGAAGATTGAGGACGG + Intergenic
1056772276 9:89486909-89486931 CCTTGTCTCCAAAAAGGGAAAGG + Intronic
1056820555 9:89838796-89838818 CCTCGTCTGTAGATTGGGGATGG + Intergenic
1057298657 9:93863859-93863881 CCCTTTCTATAGAATGGGGAGGG - Intergenic
1057507224 9:95644985-95645007 TCTTGGCTGCAGAATAGAGAAGG + Intergenic
1057621026 9:96635211-96635233 TCTTCTCTGCAAAATGGTGATGG + Intergenic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058799057 9:108527069-108527091 CCTAGTCTGCAGAATTGAGTAGG + Intergenic
1059437210 9:114284039-114284061 CCTTGTCTGCTGTCTGGGGAAGG + Intronic
1059653057 9:116333492-116333514 CGTTCTCTGCAGAATGGTGTGGG - Intronic
1060153106 9:121301070-121301092 CTCTGTCTGCAGATTGGGGTTGG + Intronic
1060509355 9:124220872-124220894 CCTCCACTGCAGCATGGGGAGGG + Intergenic
1060568921 9:124619702-124619724 CCTTATCTGTAAAATAGGGAGGG + Intronic
1061226950 9:129285974-129285996 CCTTGTCTATAAAATGGGGATGG - Intergenic
1061565761 9:131438760-131438782 CCTTGTCTGTAGAGTGGGCCTGG + Intronic
1061628169 9:131854578-131854600 CCAAGTCTGCAGAAAGGGGAAGG - Intergenic
1061697397 9:132387292-132387314 CCCTGTCTGTAGATTGGGGGGGG - Intronic
1061785555 9:133025868-133025890 CCTTGGCTGCCAAATAGGGAAGG + Intergenic
1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG + Intronic
1061901088 9:133672443-133672465 CCTTGTCTGTAAGATGGGGTTGG + Intronic
1061927967 9:133815515-133815537 CCTTGTCTGTAGAATGTCAACGG + Intronic
1062033865 9:134374140-134374162 CCTTGTCCCCAGAAAGGGGATGG - Intronic
1062363429 9:136198045-136198067 CCTTGTCTGCAAAATGTGGGTGG - Intronic
1062564820 9:137159503-137159525 CCCTGTCTGCAGAGCAGGGAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186683468 X:11900199-11900221 TTTTGTCTGAAGAAGGGGGAAGG + Intergenic
1187009467 X:15265293-15265315 CCTTGGATGCAGGATGAGGAGGG - Intronic
1190319989 X:49174384-49174406 TCTTGGCTGCCGAACGGGGAAGG - Exonic
1190726229 X:53192645-53192667 CCTTGTCTCTGGAATGGTGATGG + Exonic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192486817 X:71534219-71534241 ACTGGGCTGAAGAATGGGGATGG - Intronic
1192496251 X:71618199-71618221 TCTCGTCTGCAAAATGGGGGGGG - Intronic
1192549595 X:72043457-72043479 CCTTGTGTGTAAAATGGGGATGG - Intergenic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1194795941 X:98210985-98211007 CTCTGCCTGCAGAAAGGGGAGGG + Intergenic
1195326443 X:103762342-103762364 CCTTTTCTGAAGATTGAGGATGG + Intergenic
1195502151 X:105613746-105613768 CTTTGCCTGCAGAAAGGGGAGGG + Intronic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1197172397 X:123448965-123448987 CCTCCTCTGAAAAATGGGGATGG - Intronic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1200019028 X:153186596-153186618 CCATGTGTCCAGAAAGGGGAAGG - Intergenic