ID: 1103336207

View in Genome Browser
Species Human (GRCh38)
Location 12:120191954-120191976
Sequence CTTCCACTGGGGAAATGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 302}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103336207_1103336214 -3 Left 1103336207 12:120191954-120191976 CCTCCCCATTTCCCCAGTGGAAG 0: 1
1: 0
2: 5
3: 36
4: 302
Right 1103336214 12:120191974-120191996 AAGTCCCCAGTTTCACATACAGG 0: 1
1: 0
2: 1
3: 9
4: 122
1103336207_1103336217 2 Left 1103336207 12:120191954-120191976 CCTCCCCATTTCCCCAGTGGAAG 0: 1
1: 0
2: 5
3: 36
4: 302
Right 1103336217 12:120191979-120192001 CCCAGTTTCACATACAGGCTAGG 0: 1
1: 0
2: 0
3: 16
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103336207 Original CRISPR CTTCCACTGGGGAAATGGGG AGG (reversed) Intronic
900918078 1:5652296-5652318 CATCCCCTGGGGACATGGGCAGG - Intergenic
902483908 1:16728898-16728920 CTTCCACTGGTGAAATAATGCGG + Intergenic
902498238 1:16889643-16889665 CTTCTACTGGTGATATGGGAAGG - Intronic
903023388 1:20410211-20410233 CTGCCACTGGGGAGAAGAGGAGG + Intergenic
903955414 1:27022055-27022077 TGTCCACTGGGAAGATGGGGTGG + Intergenic
904259572 1:29280567-29280589 CTTCCTCTGGGGAGAGGAGGTGG - Intronic
904386659 1:30146936-30146958 ATTCCATCGGGGAAATGGAGAGG + Intergenic
904879315 1:33682943-33682965 CCTCCCCTGGGGAAAAGGTGGGG - Intronic
905018216 1:34791961-34791983 CTTCCACTTGGCTAATGGAGGGG + Intronic
905423290 1:37863010-37863032 CCCCCACTGGGGACACGGGGTGG - Intronic
905488785 1:38327454-38327476 TTTCCACATGGAAAATGGGGGGG - Intergenic
905866399 1:41379399-41379421 CTCCAGCTGGAGAAATGGGGAGG + Intronic
908354801 1:63319025-63319047 CGTCCAGTGGGGGGATGGGGGGG - Intergenic
909958140 1:81802614-81802636 CTTTCACTGGGGGCCTGGGGAGG + Intronic
911804988 1:102194635-102194657 TGTGCACTGGGGGAATGGGGTGG + Intergenic
912514097 1:110207337-110207359 CTCCCAGTGGGGAAAGGGGAAGG + Intergenic
913201053 1:116495617-116495639 CTTCCAGTGGGGCACGGGGGTGG - Intergenic
913342716 1:117775326-117775348 CTGCCAGTGGGGGAAGGGGGAGG + Intergenic
916047824 1:161013842-161013864 CTTGCACTGGGAAGATGGGGTGG - Intronic
919214583 1:194535487-194535509 CATGCACTGGGGGAATGCGGTGG - Intergenic
919263869 1:195237155-195237177 CTTCCTTTGGGGAAATGAGATGG - Intergenic
919808392 1:201394447-201394469 CTTCCTCAGGGGAGATGGAGAGG + Intronic
921377544 1:214490131-214490153 CTTACAATGAGGCAATGGGGTGG + Intronic
921399822 1:214709133-214709155 CTTCCAGTGGGAAAATGTGAAGG - Intergenic
922091399 1:222398977-222398999 CTTTCACTGGGGAAATGTGAAGG - Intergenic
922201382 1:223404420-223404442 CATCCAATGGGGAGGTGGGGAGG - Intergenic
922255803 1:223892010-223892032 CTTCCACTGGGGGAAGGGCTGGG + Intergenic
923900407 1:238320197-238320219 TGTGCACTGGGGGAATGGGGTGG + Intergenic
924049251 1:240063796-240063818 CTCTGACTGGGGAACTGGGGAGG - Intronic
1063490412 10:6458650-6458672 CTGCCAGAGGGGAAATGGTGAGG - Intronic
1064057700 10:12111577-12111599 CTTGCATTGGTAAAATGGGGTGG + Intronic
1064080126 10:12301722-12301744 CTTCCACTGTGGAACCTGGGAGG - Intergenic
1064174947 10:13066733-13066755 CGTGCACTGGGGGAACGGGGTGG + Intronic
1065322927 10:24525420-24525442 CTAAGACTGGGGAAATGGGCTGG + Intronic
1067926694 10:50515681-50515703 CTTCACCTGGGGAGCTGGGGAGG - Intronic
1068188599 10:53619839-53619861 CATCCACTGGGGGAATGGGGTGG - Intergenic
1069193511 10:65519912-65519934 CTTCCACTTGAGAAAAGGAGAGG - Intergenic
1070014747 10:72515167-72515189 ATTGCACTGGGGACTTGGGGTGG + Intronic
1070551779 10:77495835-77495857 CTTCCTCTGAGGGAATGGAGGGG - Intronic
1071040815 10:81307545-81307567 CGTGCACTGGGAAAATGGGGTGG + Intergenic
1071563945 10:86662127-86662149 GAGCCTCTGGGGAAATGGGGAGG - Intronic
1073663084 10:105499115-105499137 CTTCCACTGAGGCCATGGGAAGG + Intergenic
1074104429 10:110377751-110377773 ATTCCTCTGAGGAGATGGGGAGG + Intergenic
1074428261 10:113371030-113371052 CTCCCATTGTGGAAATGGGAAGG - Intergenic
1075195829 10:120358399-120358421 CATCCTCTGGGGAAAAGTGGGGG - Intergenic
1075482245 10:122791879-122791901 CTACCACAGGGGCAATGGGTGGG + Intergenic
1075722990 10:124598168-124598190 CTCCCACTGGGGACCTGGTGAGG - Intronic
1076525452 10:131109819-131109841 CTTCCACTGTGGAAATGGGAGGG - Intronic
1077550564 11:3198229-3198251 GGTCCTCTGGGGAGATGGGGAGG + Intergenic
1078641758 11:13103448-13103470 ACTTCACTGGGGAAAGGGGGTGG - Intergenic
1080004393 11:27391261-27391283 TTTCCAATGGGAAAATGGGGGGG + Intronic
1080489841 11:32750856-32750878 CTTCCACTTGAGAAAAGGAGGGG - Intronic
1081592655 11:44435552-44435574 CTTCTGCTGGGGAAATCTGGAGG + Intergenic
1081704994 11:45177494-45177516 CTTCCACTGGGGAGAGAGAGAGG - Intronic
1082166163 11:48954121-48954143 GTTACACAGGGGAGATGGGGAGG - Intergenic
1082241659 11:49878859-49878881 GTTACACAGGGGAGATGGGGAGG - Intergenic
1083698329 11:64457393-64457415 CTTCCATAGGGGATATGGTGAGG + Intergenic
1084502347 11:69542293-69542315 CATCTACTGGGAAAATGAGGTGG + Intergenic
1084866465 11:72062181-72062203 CCTCCACTGATGATATGGGGAGG - Intronic
1085566581 11:77520024-77520046 TGTGCACTGGGGGAATGGGGTGG - Intronic
1086729288 11:90227926-90227948 CTTCTACTAGGGCAATGTGGAGG - Intergenic
1086972285 11:93096051-93096073 CCTCCACTGGGCACATGGAGAGG + Intergenic
1087492759 11:98848984-98849006 CATGCACTGGGGGAATGGGGTGG + Intergenic
1089203420 11:116739375-116739397 CTCCCACTGAGGAACTGGAGGGG + Intergenic
1090570782 11:128042553-128042575 CCCCCGCTGTGGAAATGGGGAGG - Intergenic
1091657368 12:2355364-2355386 CTTCCACTGAGGAAATGTGGGGG - Intronic
1091833760 12:3569593-3569615 CTTCCACTGCACAATTGGGGTGG + Intronic
1092013855 12:5140141-5140163 CATGCACTGGGGGAATGGGGTGG - Intergenic
1094483547 12:30905084-30905106 ATTTTACTGGGGAAATGGTGCGG + Intergenic
1096631128 12:52927372-52927394 CCTCCCCTGGGGAAAGGGTGGGG + Intronic
1097646981 12:62248214-62248236 CCTGCACTGGGACAATGGGGTGG - Intronic
1098207920 12:68132640-68132662 CTTCCACTTGAGAAAAGTGGAGG - Intergenic
1100321241 12:93494979-93495001 TGTGCACTGGGAAAATGGGGTGG + Intronic
1102302384 12:111780232-111780254 CTTCCTCTGAGCAAATGGAGGGG + Intronic
1102379001 12:112447294-112447316 TTTCCTCTGGGGAAAGAGGGAGG - Intronic
1102976881 12:117213223-117213245 CCTTCCCTGGGGAATTGGGGAGG + Exonic
1103152831 12:118656209-118656231 GTTTCAGTGGGGAGATGGGGAGG + Intergenic
1103336207 12:120191954-120191976 CTTCCACTGGGGAAATGGGGAGG - Intronic
1104216423 12:126738325-126738347 CTTCCACTGTGGATATGTGTTGG + Intergenic
1104959133 12:132479914-132479936 CTCAGACTGGAGAAATGGGGAGG + Intergenic
1105266665 13:18824910-18824932 CATGCACTGGGGGGATGGGGTGG + Intergenic
1107623513 13:42258912-42258934 CTGCCACTGGGAGAATGGGGTGG + Intergenic
1110524669 13:76522175-76522197 CAGGCACTGGGGGAATGGGGTGG - Intergenic
1111624255 13:90763626-90763648 CTTCCGCTGGGTAAATAGGAGGG + Intergenic
1112013065 13:95308190-95308212 TGTGCACTGGGGGAATGGGGGGG + Intergenic
1112515637 13:100050607-100050629 CATGCACTGGGGGAATGGGGTGG + Intergenic
1113219651 13:108085222-108085244 TGTACACTGGGGGAATGGGGTGG + Intergenic
1113491782 13:110698089-110698111 CTTCCTTTTGTGAAATGGGGTGG - Intronic
1117354118 14:54906986-54907008 CTTCTTCTGGGGTAATGTGGAGG - Intergenic
1118096913 14:62547107-62547129 CTTCCACTTGAGAAAAGGAGAGG + Intergenic
1118174720 14:63426855-63426877 CTTCCATTGGGGCACGGGGGAGG + Intronic
1118576466 14:67246451-67246473 CAGCCACTGGGGAAAGTGGGAGG - Intronic
1119163087 14:72469577-72469599 CTTCCAGTGGGGAGCTGGGAAGG - Intronic
1119647972 14:76362125-76362147 CTTCCACTTGGGAAAGGAGTGGG + Intronic
1121279956 14:92690988-92691010 CTGCGACTGGGAAAATTGGGGGG + Intergenic
1122695995 14:103552384-103552406 CTTCCACCGGGGCTCTGGGGTGG - Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124364970 15:29064735-29064757 GTTCCACTGGGGGCATGGAGGGG + Intronic
1125397947 15:39270408-39270430 CATTCACTGGAGAGATGGGGAGG + Intergenic
1126809177 15:52383425-52383447 CTTCCTGTGGGGAAAAGGAGTGG - Intronic
1126842872 15:52734199-52734221 CTTCCACTGGGGAAAAGAAAAGG + Intergenic
1127494290 15:59495202-59495224 CATGGACTGGGGAACTGGGGAGG - Intronic
1128059857 15:64728441-64728463 CTTCCTCAGGGGAGATGGGATGG + Intergenic
1128643860 15:69360550-69360572 CCTTCACTGGGGCGATGGGGAGG + Intronic
1129665737 15:77578508-77578530 CAGGCACTGGGGAAATGGGCAGG - Intergenic
1129680381 15:77655514-77655536 CATCCACTGGGGACACAGGGAGG - Intronic
1130059462 15:80559265-80559287 ATCCCACTGGAGAAATGTGGTGG - Intronic
1130070131 15:80640144-80640166 CGTCCACTGGGCAAAGGTGGAGG - Intergenic
1130333546 15:82939789-82939811 CTTCAACTGTGAAAATGGGGAGG + Intronic
1131885072 15:96903725-96903747 CTGGCACTGGGAGAATGGGGTGG + Intergenic
1132864588 16:2087171-2087193 CTGCCACTGGGGAGATGGTGGGG - Intronic
1135064607 16:19298876-19298898 CACCCCCTTGGGAAATGGGGTGG + Intronic
1135609430 16:23853342-23853364 CTTCCACTGGCCCAATGGGGAGG - Intronic
1137446776 16:48536731-48536753 CATTCACTGGGGAAATGGACTGG - Intergenic
1138061995 16:53901523-53901545 CTTCCACTGCTGAAATAGAGTGG + Intronic
1139602311 16:67994006-67994028 CCTCCACTGGGGTCCTGGGGAGG - Intronic
1141162804 16:81640293-81640315 CTTTCCCTGGGGAATTGGGGGGG - Intronic
1141600569 16:85123820-85123842 ATTCCACTGGGGAGAGGAGGGGG - Intergenic
1142318777 16:89367372-89367394 CTTCCACTGGGGAAAGGCCGGGG + Intronic
1142646240 17:1315644-1315666 CTCCAACTGGGGCAATGGGAGGG - Intergenic
1143355049 17:6321402-6321424 CTTCCACTGGGAAAGTCTGGTGG + Intergenic
1143455958 17:7067926-7067948 CTTCTACTAGGGCAGTGGGGAGG - Intergenic
1143593349 17:7899234-7899256 CCTGGACTGGGGAAGTGGGGAGG + Intronic
1144792321 17:17867323-17867345 CAGCCTCTGGGGAAAGGGGGTGG + Intronic
1145789057 17:27613535-27613557 CATGCACTGGGGGAATAGGGTGG - Intronic
1146058491 17:29592887-29592909 CTTTTGCTGGGGAAGTGGGGGGG - Intronic
1146521407 17:33528290-33528312 CTTCCTGTGGGGAAAAAGGGAGG + Intronic
1147845463 17:43401353-43401375 CTAAGACTGGGGAAGTGGGGAGG - Intergenic
1148154367 17:45414256-45414278 CTTCCACTGGGGGAGGGGGAAGG - Intronic
1149075677 17:52594577-52594599 CTTCCACTTGAGAAAAGGAGAGG - Intergenic
1150157369 17:62865491-62865513 CTTCTACTAGGGCAATGGGAAGG - Intergenic
1151362682 17:73598101-73598123 CTCCCCCTGGGGAGATGGGATGG - Intronic
1151769917 17:76153876-76153898 CTTCCACTGGGGGGAGGGGGAGG - Intronic
1153704707 18:7733811-7733833 CATGCACTGGGGGAATGGGGTGG - Intronic
1153924557 18:9824696-9824718 CTTCCACTCTGGGAGTGGGGCGG - Intronic
1153932077 18:9887373-9887395 CTTCCTCTAGGGACTTGGGGAGG - Exonic
1154485513 18:14868631-14868653 CTTCCACAGGGGAAACTAGGTGG - Intergenic
1156480730 18:37434873-37434895 CTTCAACTGGGAAAAGGAGGGGG - Intronic
1156860497 18:41830362-41830384 TTTCCAGTGGAGACATGGGGAGG - Intergenic
1157777841 18:50410180-50410202 TGTGCACTGGGGAAACGGGGTGG - Intergenic
1158639237 18:59189211-59189233 TGTGCACTGGGGTAATGGGGTGG - Intergenic
1160084548 18:75763537-75763559 CTTCCTCTGGGGGAAGGGGTGGG + Intergenic
1160604387 18:80038336-80038358 CTTCACCTGGGGACATGGTGCGG + Intronic
1160744563 19:704524-704546 CTTGAACCGGGGAAATGGGCCGG - Intergenic
1161081639 19:2313299-2313321 CTTCCACTCAGGACAAGGGGTGG + Intronic
1162584418 19:11550153-11550175 CTCCCACTGCGGGAATGGGGTGG - Exonic
1166589965 19:43988341-43988363 CTTCCTCTGGGTAAATGGATAGG - Intronic
1166978804 19:46620869-46620891 CATCCCCTGGGGACTTGGGGTGG + Exonic
1168653591 19:58110555-58110577 CTTCCACTGAGAAAATGGGATGG - Intronic
925063107 2:908718-908740 CTTCACCTGGGGAAAGGGGCAGG - Intergenic
928003916 2:27546236-27546258 CTTGCACTGGGGATAGGGGTAGG - Intronic
929889703 2:45908745-45908767 GTCCCACTGGGGCAATGTGGAGG + Intronic
932774588 2:74520063-74520085 CTGCCATTTGGGAAATGGGAAGG + Intronic
932831945 2:74998761-74998783 CATGCACTGGGGAAATGGGATGG - Intergenic
933333629 2:80926370-80926392 CATGCACTGGGGAAATCGGGTGG - Intergenic
935616006 2:105082604-105082626 CTTTCTCTGGAGAAATGGGGAGG + Intronic
935962977 2:108445438-108445460 CATGCACTGGGGGAATAGGGTGG + Intergenic
936732651 2:115402658-115402680 CTTCCACTGAGGAAAAGCGCAGG + Intronic
937327904 2:121003084-121003106 CTTCTACTAGGGCAATGTGGAGG + Intergenic
938250564 2:129812786-129812808 TTCCCACTGGGACAATGGGGAGG - Intergenic
939005944 2:136786948-136786970 CTTTCTCTGGGTTAATGGGGTGG + Intronic
940289279 2:152062603-152062625 CTTCCACTATTGAGATGGGGAGG - Intronic
940497931 2:154457549-154457571 CTTCCACTGTGGGAAAGAGGTGG + Intergenic
940683265 2:156813347-156813369 CTTCTACTTTGGAAATGGTGTGG + Intergenic
941059252 2:160827141-160827163 CTTCCACTTAGGCACTGGGGAGG + Intergenic
941431843 2:165422928-165422950 CTTCTACTAGGGCAATGTGGAGG - Intergenic
942619688 2:177833948-177833970 CATGCACTGGGGGAATGGTGTGG + Intronic
943127249 2:183809921-183809943 TTTCCACTGGAGAATTGGGTGGG - Intergenic
944420486 2:199524865-199524887 CTTCCACTGGTGCACTGTGGGGG + Intergenic
944923263 2:204437515-204437537 CTCACACTGGGGTAATGGGAAGG - Intergenic
945567057 2:211413969-211413991 CATGCACTGGGGGAATGGGGTGG - Intronic
945628663 2:212242976-212242998 CATGCAATGGGGAAAAGGGGAGG - Intronic
946665242 2:222042670-222042692 TTTCTACTGGGGAAAAGGGCCGG - Intergenic
1168771882 20:420854-420876 CTTCCGCTGGGCACACGGGGCGG - Exonic
1170145465 20:13169174-13169196 ATTCCACTGGGAAAATTGGTAGG + Intergenic
1170557346 20:17525499-17525521 CCTCCTCTGGGCAAATGGGTGGG + Intronic
1171391248 20:24802898-24802920 CGTCCTGTGGGGGAATGGGGAGG + Intergenic
1171424785 20:25042650-25042672 CACCCACTAGGGACATGGGGAGG + Intronic
1172009233 20:31836821-31836843 CTGCCTCTGGGGACAAGGGGAGG - Intergenic
1172802932 20:37590983-37591005 GTGCCACTGGGGAGATGGGTGGG + Intergenic
1172980865 20:38940561-38940583 CTTTTACTGTGGAAATGGGGAGG + Intronic
1173222612 20:41142005-41142027 CTAGCACTGGGCAAATGGGGAGG - Intronic
1173442114 20:43087064-43087086 CAGGGACTGGGGAAATGGGGAGG - Intronic
1174510878 20:51051495-51051517 CTTCCACTGAACAAAAGGGGAGG + Intergenic
1174945220 20:54977676-54977698 CTTCCATTGGAGAAACTGGGAGG - Intergenic
1175462712 20:59165131-59165153 CTTCCGCTGGGAAGCTGGGGAGG + Intergenic
1175894592 20:62330518-62330540 CTTCCACGGGGAAGGTGGGGTGG + Exonic
1176011741 20:62900517-62900539 CTTCCACTGGGGCAATTGGATGG - Intronic
1176199723 20:63854893-63854915 CTTCCAGTTGGAAAGTGGGGAGG - Intergenic
1176795823 21:13370846-13370868 CTTCCACAGGGGAAACTAGGTGG + Intergenic
1176851734 21:13923399-13923421 CATGCACTGGGGGGATGGGGTGG + Intergenic
1177098308 21:16867394-16867416 CTTATACTGGGGAAAGGGGAAGG - Intergenic
1178018917 21:28386537-28386559 CTTCCACTAGGGAATTGAGGAGG + Intergenic
1178309604 21:31518714-31518736 CTTACACTGGGAAGGTGGGGTGG + Intronic
1178415118 21:32398301-32398323 CCTACACTAGGGAAGTGGGGAGG - Intergenic
1179445374 21:41426845-41426867 CATCCACTGGGGCGGTGGGGGGG - Intronic
1180289504 22:10784076-10784098 CTTCCACAGGGGAAACTAGGTGG + Intergenic
1180305395 22:11068723-11068745 CTTCCACAGGGGAAACTAGGTGG - Intergenic
1180305400 22:11068731-11068753 TTTCCCCTGTGGAAGTGGGGAGG + Intergenic
1180728245 22:17961876-17961898 CTTCCAATGGGCAAGTGGCGGGG + Intronic
1182025965 22:27119571-27119593 CTTCCACTGGAGAAAGGGTTAGG + Intergenic
1182554036 22:31119376-31119398 CTGCCACTCAGGAAATGGGCTGG - Intronic
1183114688 22:35681825-35681847 CATGCCCTGGGGGAATGGGGTGG - Intergenic
1184448974 22:44571606-44571628 CTGCCACTGGGGCATGGGGGAGG - Intergenic
1184469117 22:44685589-44685611 CTTTCACTGGGGAGAGGGTGTGG - Intronic
1185224116 22:49643392-49643414 CTTGCACAGCTGAAATGGGGAGG + Intronic
949785250 3:7733439-7733461 CATGCACTGGGGGAATGGGGTGG - Intronic
949896127 3:8768586-8768608 CTTCCACTGGGGGAGAAGGGAGG + Exonic
950443381 3:13022627-13022649 AAGCCTCTGGGGAAATGGGGAGG - Intronic
950533125 3:13564712-13564734 CTGCCACTGTGGAAAGGTGGGGG - Intronic
950751685 3:15134083-15134105 GATGCACTGGGGACATGGGGTGG + Intergenic
951176978 3:19613874-19613896 CTTCCACTGGAGAAAAGTAGGGG + Intergenic
951933128 3:27992382-27992404 CTTCCACTGGAAAATTGGAGAGG + Intergenic
952032997 3:29167028-29167050 CTTCCAGTCGGGAGATGTGGAGG - Intergenic
952137686 3:30441743-30441765 TTTTCACTGGTGAAATGGGAAGG - Intergenic
952454341 3:33458556-33458578 CATCCACTGGGGGATTGGGTTGG - Intergenic
952625006 3:35393019-35393041 CATGCACTGTGGGAATGGGGTGG + Intergenic
953229318 3:41050591-41050613 CTTTGACTGTGGAAATGGGAGGG - Intergenic
954302100 3:49705517-49705539 CTTCAACTGGGGAGTTGGGGAGG - Exonic
957965898 3:87322038-87322060 CTTTCCCTGGGGAAAGGGGAAGG + Intergenic
961667083 3:128499179-128499201 CTTCCACGGCAGAGATGGGGAGG - Intergenic
962065510 3:131975405-131975427 CTTCTACTTTGGGAATGGGGAGG + Intronic
962240733 3:133748717-133748739 CTTCAAAAGTGGAAATGGGGAGG + Intronic
962371890 3:134827711-134827733 CTTTCCCTGGGGAGCTGGGGTGG + Intronic
962510516 3:136095160-136095182 CTTCCACTGAGGAAACTGAGGGG - Intronic
962699021 3:137978985-137979007 CTTCCACTTGAGAAAAGTGGAGG - Intergenic
963430629 3:145197369-145197391 CTTCCACTTGGGAAGAGGGGAGG + Intergenic
965408102 3:168295641-168295663 CTTAGACTGGGGATATGGAGTGG - Intergenic
968232243 3:197010909-197010931 CTTCCCCTGGGGAATGTGGGTGG + Intronic
968434929 4:579493-579515 CTGCCACTGGGGAGCTGGTGGGG + Intergenic
968556259 4:1247895-1247917 CTTCCAGTGGGGAAAAGGGAAGG - Intronic
968801832 4:2747934-2747956 CTTCCACTTAGGAAATTGAGAGG - Exonic
969086924 4:4663525-4663547 CTTGAACTGGGGAATTGGGGAGG + Intergenic
969108194 4:4823935-4823957 CTTCCACTGGAGAACTGAGCTGG + Intergenic
969498526 4:7539844-7539866 CTTCCACAGCAGGAATGGGGCGG - Intronic
969569842 4:8001845-8001867 ATTCCACAGAGGAAGTGGGGAGG - Intronic
970172794 4:13306044-13306066 CTTGCACTGGGGAGACGGTGAGG - Intergenic
971756656 4:30717171-30717193 CTAAGACTGCGGAAATGGGGCGG + Intergenic
972190147 4:36581295-36581317 CTTCGACTTGGGGAACGGGGAGG + Intergenic
975320452 4:73004479-73004501 GATCCACTGGGGAAATGGCAAGG - Intergenic
976779659 4:88745111-88745133 CTGTCACTGAGGAAGTGGGGTGG - Intronic
979240118 4:118440429-118440451 CTTCCACTGGGGGAAGGGCTGGG - Intergenic
981577531 4:146220799-146220821 CATCCCCTGGGGAAAAGGAGAGG + Intergenic
982521143 4:156417890-156417912 CGTGCATTGGGGTAATGGGGTGG + Intergenic
984327328 4:178270986-178271008 CTGGCACTGGGAGAATGGGGTGG + Intergenic
985689000 5:1296441-1296463 CTGCCACTAGGGCAAAGGGGCGG + Intergenic
989427755 5:41316104-41316126 CTTCCACTTGGGAGAAGAGGGGG + Intronic
991177210 5:63703228-63703250 CTTTCACTGTGGACATGGGATGG + Intergenic
991368424 5:65893108-65893130 CTTACCTTGGGGAAATGGTGAGG + Intergenic
993236749 5:85320680-85320702 CATGCACTGGGAGAATGGGGTGG - Intergenic
993633645 5:90317943-90317965 CTGTCACTGGGGAAGGGGGGTGG + Intergenic
993929257 5:93917763-93917785 CAGCTACTGGGGGAATGGGGAGG + Intronic
994115604 5:96058648-96058670 CTTTCACTGGTGAACTGGGATGG + Intergenic
994360862 5:98846702-98846724 CATGCACTGGGAGAATGGGGTGG - Intergenic
995700010 5:114924978-114925000 TGTGCACTGGGGGAATGGGGTGG + Intergenic
997789353 5:136743263-136743285 CTTCCACTAGGGCAGTGTGGAGG + Intergenic
998092757 5:139380757-139380779 TCTGCACTGGGGAAAAGGGGAGG - Intronic
999956609 5:156709862-156709884 CCTACTCTGGGGAAATGGGAAGG + Intronic
1000133349 5:158320914-158320936 CTTCTACAGGGGAAATGGCTTGG - Intergenic
1001308687 5:170595036-170595058 CTGCCACAGAGGAAATGGTGTGG - Intronic
1001531972 5:172469705-172469727 CTGCCACTGTGTATATGGGGTGG + Intergenic
1002724297 5:181284067-181284089 CTTCCACAGGGGAAACTAGGTGG - Intergenic
1003012573 6:2439588-2439610 ATACCACTGGAGAGATGGGGAGG - Intergenic
1003571410 6:7258704-7258726 GTCCCACTGGGGAAGTCGGGAGG + Intergenic
1006312825 6:33272950-33272972 TTTCACCTGGGGAAGTGGGGAGG + Intronic
1006798997 6:36747743-36747765 CTGACACTGGAGAAATTGGGAGG + Intronic
1006922202 6:37634308-37634330 CTGCCACTGGGGAGATGTGCTGG + Exonic
1007643004 6:43357905-43357927 GTTCCCCTGGGGAAAGGGAGAGG - Intronic
1007742288 6:44020261-44020283 CTTGCTCTGGGGTGATGGGGAGG + Intergenic
1008178566 6:48299304-48299326 CTTTCACTTGTTAAATGGGGAGG - Intergenic
1009781727 6:68280083-68280105 CTTCCACTTGAGAAATGGAGAGG + Intergenic
1012752090 6:103176881-103176903 CTTCCATTTGGTAAATGGGCTGG + Intergenic
1012891991 6:104907517-104907539 CTGCCACTGGGGAATGGGGGAGG - Intergenic
1014865254 6:126521306-126521328 CTTCCACTTGAGAAAAGTGGAGG - Intergenic
1016368274 6:143342232-143342254 CTTGTAGTGGGAAAATGGGGTGG + Intergenic
1019245483 6:170706616-170706638 CTTCCACTGGGGGAAGGGCTGGG - Intergenic
1020431828 7:8123264-8123286 AGTCCCCTGGGGAAATGGAGAGG - Intronic
1020713426 7:11637588-11637610 ACTTCACTTGGGAAATGGGGGGG - Intronic
1021123788 7:16826675-16826697 CTTCCACTTGAGGAAAGGGGAGG + Intronic
1021170259 7:17390959-17390981 CTTGCAGTGGGGAAAGGAGGAGG - Intergenic
1022761065 7:33351838-33351860 AGCGCACTGGGGAAATGGGGTGG - Intronic
1023276450 7:38523522-38523544 CTTCCACTGGCTAAATTTGGAGG + Intronic
1023656399 7:42426058-42426080 CTTCCAGTGGGAAAAGGGGTGGG - Intergenic
1023773089 7:43577603-43577625 CAAGCACTGGGGGAATGGGGTGG - Intergenic
1023970992 7:44990881-44990903 TGTGCACTGGGGAAATGGGGTGG - Intergenic
1024142951 7:46480615-46480637 GTTACACTGGGGAAGAGGGGTGG + Intergenic
1024397875 7:48889891-48889913 CCTGCACTGGGAAGATGGGGTGG + Intergenic
1024611120 7:51065277-51065299 CAGTGACTGGGGAAATGGGGAGG + Intronic
1026906988 7:74068477-74068499 CTTCCACTGGACAGATGGGGCGG - Intronic
1027793568 7:82662325-82662347 GTTCCTGGGGGGAAATGGGGAGG + Intergenic
1028472707 7:91222265-91222287 CCTGCTCTGGGGAAATGAGGCGG - Intergenic
1030514862 7:110526635-110526657 CTTCCTCTGGGGAAAAGGACAGG + Intergenic
1033866195 7:145692727-145692749 CTTGCCCTGGGAGAATGGGGTGG + Intergenic
1034126005 7:148672194-148672216 CTTGCACTGGGGGAATGGGGTGG - Intergenic
1035029956 7:155850296-155850318 CTCCCCATGGGGGAATGGGGTGG + Intergenic
1035406816 7:158604157-158604179 CTGCCACACGGGAACTGGGGTGG - Intergenic
1036184961 8:6614785-6614807 CTTCCTGTGTGCAAATGGGGAGG - Intronic
1037934700 8:22907670-22907692 CTCACTCTGGTGAAATGGGGAGG + Intronic
1039992691 8:42503129-42503151 CTTCCACTGTGGAACAGGTGTGG - Intronic
1040899456 8:52403112-52403134 CTTGGATGGGGGAAATGGGGTGG + Intronic
1042876379 8:73444049-73444071 CTTCCACTGGCTAAAAGGAGAGG - Intronic
1043754420 8:83985228-83985250 CCTCCTCTGGGGAAATGGAAAGG - Intergenic
1047040274 8:120986467-120986489 CTACCACTTGGGAAATGAGAAGG + Intergenic
1048560849 8:135535958-135535980 CTTCCCCTGGGGAGATAGTGGGG - Intronic
1049639558 8:143708663-143708685 ATTTCACTCGGGAAACGGGGGGG - Intronic
1049685814 8:143938927-143938949 CTTCCCCCGAGGAAATGGGAGGG + Intronic
1051381396 9:16462660-16462682 CTTCCACAATGGAAATGGCGGGG + Intronic
1053500359 9:38583987-38584009 CATGCACTGGGGGGATGGGGTGG + Intergenic
1054361759 9:64128788-64128810 CATGCACTAGGGGAATGGGGTGG - Intergenic
1054372877 9:64422108-64422130 CAAGCACTGGGGAGATGGGGTGG - Intergenic
1055691689 9:78838750-78838772 CTTCCAGAGGGGATATAGGGTGG + Intergenic
1056265809 9:84895761-84895783 CTTCCACTGCAGAAGTGAGGTGG - Intronic
1056395364 9:86176536-86176558 CTTCCACTGGGGAAGGCGGTGGG - Intergenic
1057174790 9:92988293-92988315 CAGGTACTGGGGAAATGGGGTGG - Intronic
1057679760 9:97168413-97168435 CATGCACTGGGGAGCTGGGGTGG + Intergenic
1057696092 9:97323920-97323942 GTTCCACTGGGGAGCTGAGGTGG + Intronic
1058027856 9:100161869-100161891 CTTCAACTGGGAAAATTGGAAGG + Intronic
1058987462 9:110221587-110221609 TTTCCAGTGAGGAAGTGGGGAGG - Intergenic
1059313290 9:113403196-113403218 TTTCCACTGGGGAGATGGGGAGG + Intergenic
1060008961 9:120026594-120026616 GTTCCTCTGGGGTCATGGGGAGG + Intergenic
1060716571 9:125935816-125935838 TTTACACTGGGGAATGGGGGTGG - Intronic
1060945287 9:127566848-127566870 CTTCCTCTGGGGAGACTGGGAGG + Intronic
1061141946 9:128772386-128772408 CTTCCAAATGGGAAATTGGGCGG + Intronic
1186831717 X:13396924-13396946 TTTCCAGTGGGGGCATGGGGAGG - Intergenic
1187597962 X:20795928-20795950 ATTCCAATGGAGAAGTGGGGAGG + Intergenic
1188113896 X:26221739-26221761 CTTTCACTGGGAATATGGGTAGG + Intergenic
1188179317 X:27034578-27034600 CATGCACTGGGGGAATGGGATGG - Intergenic
1188215579 X:27472539-27472561 CTGTCAGTGGGGAAAAGGGGAGG - Intergenic
1189831249 X:44975878-44975900 CATGCACTGGGGGAATGGGGTGG + Intronic
1190712517 X:53080996-53081018 CATACACTGGGGAAAGGGAGAGG + Intergenic
1192413272 X:70953894-70953916 CCTCTACTCTGGAAATGGGGTGG - Intergenic
1192852047 X:74967228-74967250 ATGGCACTGGGGAAATGGGGAGG + Intergenic
1193246756 X:79238670-79238692 CTTCACCTGTGGAAATGGGTGGG - Intergenic
1196182259 X:112704708-112704730 CTGCTACTGGGGAATGGGGGAGG + Intergenic
1196290061 X:113929672-113929694 CTTCCACTTGGGAGAAGGAGAGG - Intergenic
1197808279 X:130417639-130417661 CTCCCATAGGGAAAATGGGGAGG + Intergenic
1199438541 X:147841991-147842013 CTTCATCTGGGGAATGGGGGAGG - Intergenic
1200015676 X:153160822-153160844 ATTCCACAGGGGTAATGTGGGGG + Intergenic
1200219442 X:154383948-154383970 CATTCCCTGGGGAACTGGGGTGG - Intergenic
1202387859 Y:24342258-24342280 CTTCCACTGGGGGAAGGGCTGGG - Intergenic
1202482928 Y:25327870-25327892 CTTCCACTGGGGGAAGGGCTGGG + Intergenic