ID: 1103336527

View in Genome Browser
Species Human (GRCh38)
Location 12:120194435-120194457
Sequence CGACTTCAGCAGCTGGAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103336527_1103336534 9 Left 1103336527 12:120194435-120194457 CCGAGCTCCAGCTGCTGAAGTCG 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1103336534 12:120194467-120194489 CCCCGGACTCCTCGAGCCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 104
1103336527_1103336541 28 Left 1103336527 12:120194435-120194457 CCGAGCTCCAGCTGCTGAAGTCG 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1103336541 12:120194486-120194508 GCGGTCTGCCTGCGCCGCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 171
1103336527_1103336532 -8 Left 1103336527 12:120194435-120194457 CCGAGCTCCAGCTGCTGAAGTCG 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1103336532 12:120194450-120194472 TGAAGTCGAGGCGGGAGCCCCGG 0: 1
1: 0
2: 5
3: 14
4: 203
1103336527_1103336540 27 Left 1103336527 12:120194435-120194457 CCGAGCTCCAGCTGCTGAAGTCG 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1103336540 12:120194485-120194507 CGCGGTCTGCCTGCGCCGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103336527 Original CRISPR CGACTTCAGCAGCTGGAGCT CGG (reversed) Intronic
900511976 1:3065086-3065108 AGACTTGAGCAGCAGGAGCCAGG - Intergenic
900837014 1:5012817-5012839 GGACTTCAGCAGATGGATGTTGG - Intergenic
901088265 1:6625208-6625230 CGACTTCGGCATCTCGAGCCAGG - Exonic
904617142 1:31756050-31756072 CGGCCTCAGCAGGTGGGGCTGGG + Exonic
904618871 1:31763889-31763911 CGCCGTCAGCAGCAGGAGCGGGG + Exonic
906146113 1:43561623-43561645 GGACTACAGCAGCTGGACCAGGG - Intronic
909836414 1:80260634-80260656 CTGGTTCAGCAGCTGGAGCCAGG + Intergenic
913268761 1:117071992-117072014 GGACTTCCGTAGCTGGAGATGGG + Intronic
914267014 1:146046801-146046823 CTTCTTCAGCAGCTGAAGCCTGG + Intergenic
919012921 1:191988429-191988451 CAACCTCAGCAGCTGCAACTCGG + Intergenic
920104098 1:203538354-203538376 CGCCTTCAGCAGAGGCAGCTTGG - Intergenic
920807974 1:209252910-209252932 CTACCCCAGCAGCTGTAGCTAGG + Intergenic
921828721 1:219703049-219703071 AGACTTGGGCAGCTGGAGCTAGG - Intronic
922165530 1:223112799-223112821 CAGCTGCAGCTGCTGGAGCTCGG - Exonic
1062799479 10:368696-368718 CGCCTTCAGCAGCAGGTGCAGGG - Intronic
1063199709 10:3776151-3776173 CCAGTTCCGCAGCTAGAGCTGGG - Exonic
1064072980 10:12246581-12246603 CGGCCTCAGCAGCTGGGGCTGGG - Intronic
1065189538 10:23197100-23197122 CCACTTCTGCACCTGGAGCTGGG + Intergenic
1069511835 10:69048333-69048355 TGACATCAGCAGCTGGAGGGTGG - Intergenic
1071844325 10:89505870-89505892 CGACTTGGGATGCTGGAGCTTGG + Intronic
1073165234 10:101442148-101442170 CATCTTCAGGAACTGGAGCTAGG - Intronic
1073576572 10:104631052-104631074 CCACTTCAGCAGCTGCAGGATGG - Intergenic
1075483417 10:122800480-122800502 AGAGTTCAGCAGCTGCTGCTGGG - Intergenic
1076346751 10:129784689-129784711 AAACTGCATCAGCTGGAGCTGGG + Intergenic
1076853220 10:133103142-133103164 CCACATCTGCAGCTGGAGCCCGG + Intronic
1076992134 11:280926-280948 CTGCGCCAGCAGCTGGAGCTCGG + Exonic
1078086592 11:8237138-8237160 CTACTTCAGCTGCTGGAGGTGGG + Intronic
1078925249 11:15868974-15868996 AGACTTCAGCAGCAGTTGCTGGG + Intergenic
1079310568 11:19361890-19361912 GGAATTCACCTGCTGGAGCTGGG + Intronic
1081650969 11:44824049-44824071 CGACAGCAGGAGGTGGAGCTGGG - Intronic
1083707346 11:64525618-64525640 CGAGTTCAGCATCTGGAGGTGGG - Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1088558698 11:111090258-111090280 TGACTTCAGAAGCTGGACCCTGG - Intergenic
1088765266 11:112969323-112969345 TGACTTAGGCAGGTGGAGCTGGG + Intronic
1090756004 11:129792557-129792579 TGCCTCCAGCAGCAGGAGCTTGG - Intergenic
1091510758 12:1123024-1123046 CCATCTCACCAGCTGGAGCTGGG - Intronic
1092233222 12:6789453-6789475 AAACGTCACCAGCTGGAGCTGGG - Exonic
1092745995 12:11673084-11673106 GGGTTTCAGCTGCTGGAGCTGGG + Intronic
1093913152 12:24769819-24769841 CCATTTCAGCAGGTGGGGCTTGG + Intergenic
1095813032 12:46391397-46391419 CTACTTCAATAGCTGGAACTGGG + Intergenic
1097132013 12:56818576-56818598 GGACAACAGCAGCTGGTGCTGGG + Intergenic
1097269265 12:57764398-57764420 CGCCTTCAGCAGGGGCAGCTGGG + Exonic
1097288423 12:57895045-57895067 AGACATAAGCAGCTGGGGCTGGG + Intergenic
1102177095 12:110884093-110884115 CAGCTTCAGCAGCCGGAGGTGGG - Exonic
1103210379 12:119161653-119161675 AGACAGCAGCACCTGGAGCTGGG - Exonic
1103336527 12:120194435-120194457 CGACTTCAGCAGCTGGAGCTCGG - Intronic
1104276863 12:127337003-127337025 CCACCTCTGCAGCTGGAGGTGGG - Intergenic
1104645560 12:130494958-130494980 CCACGCCAGCAGCTGGAGCGGGG - Intronic
1106026590 13:25960919-25960941 CGATTTCAGTAGCTAGAGATGGG - Intronic
1106227838 13:27798279-27798301 CGATTCCAGCACCTGGTGCTTGG - Intergenic
1106326343 13:28693904-28693926 CGACCTGAGACGCTGGAGCTTGG - Intergenic
1107286846 13:38802704-38802726 AGCCTTCAGCAGCTACAGCTTGG - Intronic
1108125571 13:47239177-47239199 AGACTTCAGCATCAGGAGCCAGG + Intergenic
1108473647 13:50791392-50791414 GGCCTTCAGCAGCTGCAGGTGGG + Intronic
1109220488 13:59636448-59636470 CTACTTCAACAGATGGAGGTTGG + Intergenic
1112611836 13:100962749-100962771 TGAATTCAGCAGCTGGAGCTGGG + Intergenic
1116835963 14:49769014-49769036 GGACTTCACCCTCTGGAGCTGGG + Intronic
1119192766 14:72694457-72694479 GAACCTCAGCAGCTGGAACTGGG - Intronic
1119472266 14:74907468-74907490 CCACTCGGGCAGCTGGAGCTGGG + Exonic
1119748668 14:77062394-77062416 CAACGTGAGCTGCTGGAGCTGGG + Intergenic
1120858655 14:89234881-89234903 AGACTTCAACAGCTGGGGATGGG - Intronic
1122296519 14:100709177-100709199 CGACGTCAGGAGCAGGAGCTAGG + Intergenic
1122648052 14:103207833-103207855 CGCCATCAGCACCTGGCGCTCGG - Intergenic
1123165889 14:106324529-106324551 CGACTCCTGCAGCTGTACCTGGG + Intergenic
1123168588 14:106349561-106349583 GGACTCCTGCAGCTGCAGCTGGG + Intergenic
1123176275 14:106421987-106422009 CGACTCCTGCAGCTGCAGCTGGG + Intergenic
1123194844 14:106606391-106606413 CGACTCCTGCAGCTGCACCTGGG + Intergenic
1123197127 14:106627521-106627543 CGACTCCTGCAGCTGCACCTGGG + Intergenic
1123198468 14:106639397-106639419 CGACTCCTGCAGCTGCACCTGGG + Intergenic
1202947411 14_KI270726v1_random:41581-41603 CGACTCCTGCAGCTGCACCTGGG - Intergenic
1123584234 15:21742639-21742661 CGACTCCTGCAGCTGCACCTGGG + Exonic
1123620885 15:22185242-22185264 CGACTCCTGCAGCTGCACCTGGG + Intergenic
1123924562 15:25094869-25094891 TGACTTCAGCAGGTGGGACTTGG + Intergenic
1124224832 15:27884260-27884282 CCACCTCAGCCTCTGGAGCTGGG - Intronic
1126381556 15:48052959-48052981 TGACTTAAGCAGCTTGAGCTGGG - Intergenic
1127353143 15:58172424-58172446 CGATTTCTCTAGCTGGAGCTTGG + Intronic
1127954922 15:63845155-63845177 GGACTTCAGGAGGTGGAGGTGGG + Intergenic
1128849691 15:70941113-70941135 AGAATTCAAAAGCTGGAGCTAGG - Intronic
1134040524 16:11064908-11064930 CGTATTCAGCAGCTGCAGCAGGG - Intronic
1136156778 16:28388394-28388416 AGACTTCCGCAGGTGGAGCAGGG - Intronic
1136206308 16:28726887-28726909 AGACTTCCGCAGGTGGAGCAGGG + Intronic
1136490420 16:30604411-30604433 CGTGTGCAGCAGCTGGTGCTGGG + Exonic
1139701818 16:68712347-68712369 CAACAAGAGCAGCTGGAGCTGGG + Intronic
1139761381 16:69187183-69187205 CGACTGCGGCGGCTGGAGCGGGG + Exonic
1139845674 16:69919560-69919582 AGACTCCAGCAGGTGGAACTGGG - Intronic
1141699417 16:85635619-85635641 CAACTGCAGCAGCAGGAGCTGGG - Intronic
1141795879 16:86273858-86273880 AGACTCCAGGACCTGGAGCTGGG + Intergenic
1142376740 16:89710614-89710636 GGTCTTCAGCTGCTGCAGCTGGG + Exonic
1142809257 17:2387552-2387574 GGACTTCAGCAGCTCCGGCTGGG + Exonic
1148015097 17:44516146-44516168 CGTCTTCAGCATCTAGAGCAGGG - Intergenic
1149656302 17:58311142-58311164 CACCTGCAGCAGCTGCAGCTGGG + Exonic
1150989853 17:70244553-70244575 ATACTTCAGTACCTGGAGCTAGG + Intergenic
1151569728 17:74920249-74920271 CGGCTGCAGCATCTGGCGCTGGG - Exonic
1151755767 17:76074565-76074587 CGACTGCGGGGGCTGGAGCTCGG + Intronic
1152559089 17:81068921-81068943 AGCCTGGAGCAGCTGGAGCTCGG - Intronic
1203173682 17_GL000205v2_random:175304-175326 TTACTGGAGCAGCTGGAGCTAGG + Intergenic
1155605867 18:27605467-27605489 ACACTTCAGCAGCCGGAGCTTGG + Intergenic
1160453486 18:78980294-78980316 CGACTTGAGGTGCTGGGGCTTGG - Exonic
1163012730 19:14435243-14435265 AGACCTCAGCTGCTGGAGGTGGG + Intronic
1163823110 19:19507579-19507601 AGAGGTCAGGAGCTGGAGCTGGG - Exonic
1167492995 19:49802582-49802604 CTTACTCAGCAGCTGGAGCTGGG - Exonic
925299267 2:2798860-2798882 AGACTTCAGCATCTGGAAATGGG + Intergenic
928627938 2:33159992-33160014 CTACCTCAGCCGCTCGAGCTGGG + Intronic
928877289 2:36054800-36054822 ACACTTCAGCAGCTGTAGCTTGG + Intergenic
930734523 2:54762898-54762920 CCTTTTCAGCAGATGGAGCTGGG + Intronic
933400253 2:81787360-81787382 TGACTTCAGCAGAGGGACCTTGG + Intergenic
935589900 2:104836541-104836563 CCACATAAGGAGCTGGAGCTGGG + Intergenic
936349995 2:111705317-111705339 AGCCTTCAGCACCTGCAGCTGGG + Intergenic
936521045 2:113212420-113212442 CGTGTTCAGGAGCAGGAGCTCGG + Intergenic
936955609 2:118019314-118019336 GGACTTCAGCAGCAGGGCCTGGG + Intergenic
938371044 2:130768502-130768524 CGAATTCAGCATCTGGGCCTGGG + Intergenic
940594009 2:155766925-155766947 CGACCTGAGACGCTGGAGCTTGG - Intergenic
942501180 2:176592417-176592439 TGACGTCAGCGGATGGAGCTGGG + Intergenic
944837378 2:203593112-203593134 GGAGTGCAGCAGCTGGATCTCGG + Intergenic
948610920 2:239166417-239166439 CATCTTCAGCAGCATGAGCTGGG - Intronic
1174408369 20:50317770-50317792 CCACTTAGGCAGCTGGGGCTCGG + Intergenic
1175074737 20:56362969-56362991 CTCCCTCAGCAGCTGGAGGTGGG + Intronic
1175504002 20:59469368-59469390 CACCTTCAGCTGCTGGTGCTGGG - Intergenic
1175658366 20:60791650-60791672 CTCCTTTAGCAGGTGGAGCTGGG + Intergenic
1175688662 20:61049909-61049931 GCAATTCAGCAGCTGGAGGTGGG + Intergenic
1181970847 22:26688705-26688727 TGTCTCCAGAAGCTGGAGCTGGG - Intergenic
1182586105 22:31345162-31345184 CGACCTCATCAGCAGGAACTTGG + Exonic
1184257775 22:43296836-43296858 GGCCTTCAGCAGGTGGGGCTGGG + Intronic
1184740480 22:46426066-46426088 CGACTCCAGCAGTTGGAGATGGG - Intronic
1184959801 22:47920766-47920788 CTACATCAGGATCTGGAGCTTGG - Intergenic
1185260026 22:49856543-49856565 CGGCTTCAGCAGCAGGCGCTTGG - Intronic
952813986 3:37431106-37431128 CGACTTGAGATGCTGCAGCTTGG - Intronic
954263262 3:49455209-49455231 TGACTTCAGCAGCAGGACATGGG - Intergenic
954293552 3:49662216-49662238 CGACTTCAGTGGCTGGGGCAAGG + Exonic
956179658 3:66505222-66505244 GAACTGCAGCAGCTGCAGCTTGG - Intergenic
956200959 3:66705449-66705471 TGAATTGAGCAGCTGAAGCTTGG + Intergenic
957402084 3:79729285-79729307 CGACTTCATTCCCTGGAGCTAGG - Intronic
960452628 3:117829205-117829227 CTACTTCAACATCGGGAGCTCGG + Intergenic
964530438 3:157661918-157661940 CCACTGCAGCATCTGGAACTTGG - Intronic
965699350 3:171443709-171443731 CCACTTCAGCCTCTTGAGCTGGG - Intronic
967190315 3:186979065-186979087 AGACCTCAGCAGCAGGAGCTGGG + Intronic
968481786 4:836375-836397 CGACTGCAGCTGCTGAGGCTGGG + Intergenic
968815728 4:2820733-2820755 ACATTTCAGCAGCTGCAGCTGGG - Exonic
974981271 4:68960267-68960289 CACCTTCAGGAGCTGCAGCTGGG + Intergenic
976447790 4:85151505-85151527 TTCCTTCAGCAGCTGCAGCTTGG + Intergenic
977671388 4:99699357-99699379 CGACCTGAGATGCTGGAGCTTGG + Intergenic
981081883 4:140644613-140644635 CGCCTTCAGCCGCTCCAGCTGGG + Intronic
981250776 4:142598387-142598409 AGACTTAAGCAGCTGCAACTGGG + Intronic
985840774 5:2303640-2303662 CGGCTTCAGCAGCGGATGCTTGG - Intergenic
986190329 5:5491144-5491166 CGACTGCAACAGGTGGAGCTGGG + Intergenic
988673386 5:33406344-33406366 CAACTACAGAAGCTGGAGTTAGG + Intergenic
990250974 5:53914654-53914676 CGAATTCCGCATCTGGAGCAAGG + Intronic
992825600 5:80547128-80547150 AGACCTCAGCAGCAAGAGCTCGG + Intergenic
993511923 5:88781432-88781454 CTGCTTCAGAAGCTGAAGCTTGG + Intronic
998322355 5:141244628-141244650 CCACCTCAGCAACTGTAGCTGGG - Intergenic
998602429 5:143598732-143598754 AGACCTCAGAGGCTGGAGCTAGG + Intergenic
1002573531 5:180158189-180158211 CCACTGCAGCAGCGTGAGCTAGG - Intronic
1003746495 6:9007911-9007933 TGCCCTCAGCAGCTGGACCTCGG - Intergenic
1004111179 6:12720475-12720497 GGTTTTCAGCAGATGGAGCTGGG + Intronic
1007335997 6:41155626-41155648 AGACTACAGCAGCTGGGGATGGG + Intergenic
1007414401 6:41683539-41683561 CGGCTTGAGAAGCTGTAGCTGGG - Intergenic
1007662495 6:43495411-43495433 AGATTTCAGAAGTTGGAGCTAGG + Intronic
1009833634 6:68970395-68970417 CTGCTTCAGCACCTGTAGCTGGG + Intronic
1010858896 6:80879732-80879754 AGAGTTCAGCACTTGGAGCTAGG - Intergenic
1011948005 6:92931398-92931420 GGACTTCAACACCTGGACCTGGG + Intergenic
1012957875 6:105590435-105590457 AGAGTTCAGCAGCTGGTGCTGGG + Intergenic
1013944336 6:115704185-115704207 AGACTTTGGCAGCTGGGGCTGGG + Intergenic
1014517682 6:122399809-122399831 CGAGTTCATCACCTGGAGCCAGG + Exonic
1016777853 6:147924821-147924843 CAACTTCAGAAACTAGAGCTGGG + Intergenic
1018808736 6:167281809-167281831 CCACATCTGCAGGTGGAGCTTGG + Intronic
1018830798 6:167441871-167441893 CGACTTCCCCAGCTGGAGAGAGG - Intergenic
1022421778 7:30230166-30230188 GGAGTACAGCAGATGGAGCTTGG + Intergenic
1026824188 7:73571033-73571055 CAACTTGAGCAGCTCCAGCTAGG + Intronic
1027259403 7:76453899-76453921 CCACCTCAGCCTCTGGAGCTGGG - Intergenic
1027283072 7:76622982-76623004 CCACCTCAGCCTCTGGAGCTGGG + Intronic
1027310774 7:76951980-76952002 CCACCTCAGCCTCTGGAGCTGGG - Intergenic
1031484352 7:122310312-122310334 CAACTCCAGCAGCGGGAACTTGG - Intronic
1032080186 7:128854776-128854798 CGAGTTCAGCATCTGGACCCGGG + Exonic
1038269501 8:26063896-26063918 CCAGTGCAGCAGCTGGAACTGGG + Intergenic
1038720020 8:30027331-30027353 CCACGGCAGGAGCTGGAGCTGGG + Intergenic
1039205759 8:35152232-35152254 CAACTTCCTCAGCTGGACCTGGG + Intergenic
1049365465 8:142234830-142234852 GGACTTCAGGAGGTGGAGCCAGG - Intronic
1049572675 8:143376584-143376606 CTCCTTCAGCAGCTGCAGGTTGG - Exonic
1049791074 8:144472998-144473020 CGACTGCTGCAGCCGGCGCTGGG + Exonic
1050873998 9:10613019-10613041 CGTCTCCAGCAGCTGCCGCTCGG + Intergenic
1053094614 9:35313972-35313994 CGACTCCAGCTGCAGGAGGTAGG + Exonic
1059644665 9:116252624-116252646 TGACTTCTACAGCTGGAGATAGG + Intronic
1060110422 9:120902718-120902740 CTCCTTCACCAGCTGGATCTGGG + Exonic
1060414855 9:123423115-123423137 CGGCTCTAGCATCTGGAGCTTGG - Intronic
1061195033 9:129102883-129102905 AGATTCCAGCAGCTGGAGCAGGG + Intronic
1061798692 9:133102862-133102884 CGACTGCAGCAGCTTGATCTGGG + Exonic
1189523035 X:41790236-41790258 CAACTTTAGCACCTGGAGATGGG + Intronic
1190097137 X:47490813-47490835 TGAATTCAGCAGCTGAAACTGGG + Intergenic
1190115993 X:47626692-47626714 AGGCCTCAGCAGCAGGAGCTGGG + Intronic
1191791395 X:64975934-64975956 CAACTTCAGAACCTGGAGTTCGG - Intronic
1197157221 X:123283532-123283554 CGACCTGAGATGCTGGAGCTTGG + Intronic
1200084277 X:153595724-153595746 GGGCTTCAGCAGAGGGAGCTTGG - Intronic