ID: 1103338096

View in Genome Browser
Species Human (GRCh38)
Location 12:120205059-120205081
Sequence CTGTAGATAAAGTTGTGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103338091_1103338096 19 Left 1103338091 12:120205017-120205039 CCAAACTATAGCTCATGGGCCAA 0: 1
1: 2
2: 4
3: 16
4: 108
Right 1103338096 12:120205059-120205081 CTGTAGATAAAGTTGTGGCCGGG 0: 1
1: 0
2: 2
3: 11
4: 139
1103338093_1103338096 0 Left 1103338093 12:120205036-120205058 CCAAATATGGCTACTGTCTGTTT 0: 1
1: 1
2: 1
3: 21
4: 238
Right 1103338096 12:120205059-120205081 CTGTAGATAAAGTTGTGGCCGGG 0: 1
1: 0
2: 2
3: 11
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103338096 Original CRISPR CTGTAGATAAAGTTGTGGCC GGG Intergenic
900988324 1:6086082-6086104 CTTGAGATAAAGCTGTGTCCAGG - Intronic
905999853 1:42414924-42414946 CTGTTGTTAATGTTGTAGCCAGG - Exonic
906239027 1:44230095-44230117 CTCCAGATAAATTTATGGCCAGG - Intronic
908520886 1:64940863-64940885 AAGTAGTTAAAGTTTTGGCCAGG + Intronic
909912885 1:81282044-81282066 CTGTAGGTAAAGTAGTGAACAGG - Intergenic
911785844 1:101945933-101945955 CTGTTGATAATGTTGAGGCAGGG + Intronic
916116607 1:161490133-161490155 CCTGAGATGAAGTTGTGGCCTGG - Intergenic
918370995 1:183861338-183861360 CCTTAGATAAAGTTGTACCCAGG - Intronic
919863068 1:201755808-201755830 CTTTAAAAAAAGTTGTGGGCTGG + Intronic
920599304 1:207306783-207306805 CTGTGGATAAAGTAGTGGGGTGG + Intergenic
921860373 1:220036771-220036793 ATGTAGATAAACTTGTGTCATGG - Intronic
922587149 1:226742640-226742662 CTGTAGATCAAGCTGTTGCAGGG + Intergenic
923568065 1:235091504-235091526 CTCTAGAGAGAGATGTGGCCAGG + Intergenic
923820799 1:237438623-237438645 TTGTAGATAACTTTGTGTCCAGG + Intronic
923987431 1:239397375-239397397 ATATAGAAAATGTTGTGGCCGGG + Intronic
924414204 1:243841975-243841997 CAGCAGATAAAGTGGTTGCCAGG + Intronic
1064263376 10:13804342-13804364 TTGTAGATAAGCTTGTGGCCAGG + Intronic
1064329368 10:14379350-14379372 CTGCGGGTAAAGTGGTGGCCAGG - Intronic
1065845253 10:29737772-29737794 CTGGAGATCAAGATGTGGTCAGG + Intergenic
1069195785 10:65549490-65549512 ATATAGATAAACTTGTGGCAAGG - Intergenic
1071223784 10:83501431-83501453 CTATAGAAAGAGCTGTGGCCAGG + Intergenic
1073106940 10:101037485-101037507 CTGGAGAGAGAGTTGGGGCCTGG - Intronic
1073494012 10:103874946-103874968 CTTTAGATAAAGTTCTACCCTGG - Intergenic
1074968499 10:118515687-118515709 TTGGAGATAAAATTGTTGCCAGG + Intergenic
1075515451 10:123104556-123104578 CTGGAGATGGAGTTGGGGCCTGG + Intergenic
1082936434 11:58661527-58661549 ATGTAAATGAAGTGGTGGCCTGG + Intronic
1083818949 11:65155288-65155310 CTATATATATAGTTTTGGCCAGG + Intergenic
1085121924 11:73972978-73973000 AGGTACATAAAGTAGTGGCCAGG + Intergenic
1085490027 11:76906854-76906876 TTGTAGATAAAGTCATGTCCAGG - Intronic
1086203275 11:84228849-84228871 CTGAAGCTAAAGTTGAAGCCAGG - Intronic
1086713228 11:90034698-90034720 ATGTAGATAAACTTGTGCCATGG + Intronic
1087814659 11:102645259-102645281 CAGTTAATAAAATTGTGGCCGGG - Intergenic
1088999648 11:115041042-115041064 CTGTAGAACATGTTGTGTCCTGG - Intergenic
1089934176 11:122346463-122346485 CTGGAGATGCAGTTGTGACCAGG + Intergenic
1092583158 12:9869967-9869989 TTGAAGACAAAATTGTGGCCTGG - Exonic
1092803821 12:12200184-12200206 CTGTTAATGAAGTTGTGGCAGGG - Intronic
1096490229 12:52008998-52009020 CTGTAGAGAAAGTTGAGGAGTGG + Intronic
1100199672 12:92284817-92284839 CTGTTGATAAATTTGTGTCCTGG - Intergenic
1100480702 12:94975751-94975773 CTATAGATAATATTTTGGCCAGG + Intronic
1102221832 12:111200228-111200250 CTGTAAATAAAGGTATGGCCAGG - Intronic
1102371737 12:112387614-112387636 ATTAAGAAAAAGTTGTGGCCGGG + Intergenic
1102478545 12:113204623-113204645 TTGTAGAAAAAGTTGGGGCCAGG + Intronic
1103338096 12:120205059-120205081 CTGTAGATAAAGTTGTGGCCGGG + Intergenic
1104372738 12:128237745-128237767 CTGTTTATAAAGGTGTGGTCGGG - Intergenic
1108701157 13:52945436-52945458 TGGTAAATGAAGTTGTGGCCTGG + Intergenic
1110128195 13:71974731-71974753 CATTAGATCAAGTTTTGGCCAGG + Intergenic
1111990055 13:95107628-95107650 CTGTAGATAAAGATATAGGCTGG + Intronic
1113718927 13:112537177-112537199 TTGTTGAGAAAGTTATGGCCAGG - Intronic
1115601311 14:34958242-34958264 ATATAGATAAAGTTGTGACATGG - Intergenic
1118950433 14:70431989-70432011 CAGTGGAGAAAGGTGTGGCCTGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1121904412 14:97726606-97726628 CTTTGGGTAAAGTTGTGCCCTGG + Intergenic
1124294807 15:28491792-28491814 ATGTAGGTAAAGTTGTGTCATGG - Intergenic
1124350246 15:28950015-28950037 CTATAGGTAACGTAGTGGCCTGG - Intronic
1125827593 15:42689489-42689511 CTGCAGACAGAGATGTGGCCTGG - Exonic
1129083326 15:73061374-73061396 CTGTAGATACAGTTGCTGTCTGG + Intronic
1131917791 15:97289719-97289741 CTATAGATAAAGCTGTGTGCCGG + Intergenic
1137019824 16:35414419-35414441 CTGAGGATAAGGTTGCGGCCTGG - Intergenic
1139088962 16:63620339-63620361 ATGAAGATAAAGTCTTGGCCGGG + Intergenic
1140149671 16:72349886-72349908 CTGAAGATTAAGTTGTGGAAAGG - Intergenic
1142500491 17:330180-330202 GTGTGGTTAAGGTTGTGGCCTGG - Intronic
1144707984 17:17382337-17382359 CTGCAGACCAAGTTCTGGCCAGG - Intergenic
1150321472 17:64217846-64217868 CTGTAGCTCATGTTGTCGCCAGG + Intronic
1150530482 17:65976268-65976290 CTATAGATGAAGTTGTGGTTTGG - Intronic
1151430253 17:74057557-74057579 CTGTAAATAAACTTGTGCCAGGG - Intergenic
1158134949 18:54197926-54197948 CTGTAGATAAAGTTGGGGACAGG - Intronic
1158138067 18:54227550-54227572 TTAAAGAAAAAGTTGTGGCCGGG + Intergenic
1158817595 18:61121468-61121490 CTGTGGATAAAGATGTGGCCTGG + Intergenic
1163532899 19:17861110-17861132 TTGTGTATAAAGTTGTGGTCGGG + Intronic
1164069291 19:21751397-21751419 CTGTAAATAAATTTGTGCTCAGG - Intronic
1164407842 19:27970441-27970463 CTGTAAATAAACTTGTGTTCAGG - Intergenic
1164718126 19:30408461-30408483 CTGGAGAAAAGGCTGTGGCCTGG - Intronic
1167457100 19:49602009-49602031 CTGCAGATCCAGTCGTGGCCGGG + Intronic
925362293 2:3288049-3288071 CTGTAGGTAAGGTTGTCGCAGGG + Intronic
929439976 2:41957770-41957792 CTGTAGATAGATTTGTGGACAGG - Intergenic
932086140 2:68764056-68764078 CTGTAGAGACAGTGGTTGCCAGG - Intronic
932586608 2:73034126-73034148 CTGTAGATGCATTTGTGGGCTGG - Intronic
934505860 2:94893078-94893100 ATGTAGAGATAGATGTGGCCTGG - Intergenic
936166595 2:110125754-110125776 CTGTAAATAAACTTATGGACAGG + Intronic
936767215 2:115866873-115866895 ATGTAGATAAACTTGTGTCATGG + Intergenic
940049270 2:149444546-149444568 CTGTTGATAAAGCAGTGGCAGGG - Intronic
940725060 2:157327697-157327719 CAGTAGAGACAGTTGTGGCCAGG + Exonic
941743529 2:169061964-169061986 ATGTAGATAAACTTGTGTCATGG - Intergenic
942854137 2:180525718-180525740 CTGTTAAAAAAATTGTGGCCAGG - Intergenic
945248408 2:207742259-207742281 CTGTAAATAAATTTGTGCTCAGG - Exonic
945383740 2:209172515-209172537 CAGTTGATAAAGTAGTGGCAGGG + Intergenic
947870401 2:233433860-233433882 CTGGAAATAAAGCTGTGACCTGG - Intronic
947945356 2:234097158-234097180 CTGAAGATGAAGTTGCCGCCTGG + Intergenic
948875142 2:240822534-240822556 CTATTGATAAAGGTGTGGGCAGG + Intergenic
1168937327 20:1676732-1676754 CTGTAGATTAATTCGTGGCCTGG + Intergenic
1168939629 20:1697620-1697642 CTATAGATTAATTTCTGGCCTGG + Intergenic
1171243310 20:23588388-23588410 CTGGAGATATATTTGTAGCCAGG - Intergenic
1173480491 20:43394980-43395002 CTATAGATAAACTGGAGGCCAGG + Intergenic
1179160716 21:38895055-38895077 CTGCGGAAAAGGTTGTGGCCAGG + Intergenic
1185029047 22:48432120-48432142 TTCTAGATAAAGGTGTGGGCGGG - Intergenic
950490770 3:13303611-13303633 CTGCAGATAAAGCCGTGGCCTGG + Intergenic
952364975 3:32666190-32666212 TTGAAGATAAATTTCTGGCCAGG + Intergenic
955576026 3:60364061-60364083 CTGTTTACAAAGTTGTGGGCTGG - Intronic
957512992 3:81214092-81214114 CTGTAGCTAAACTTGTGTCATGG + Intergenic
961985863 3:131133870-131133892 TTCCAGTTAAAGTTGTGGCCAGG - Exonic
962839533 3:139221457-139221479 CTGTAGATCAAGATATGACCTGG + Intronic
967617840 3:191594279-191594301 CTGTAGAAAAAATTGTGTCCTGG - Intergenic
970967433 4:21944694-21944716 CTGGGGATAAAGTGGTGGACAGG + Intronic
974834796 4:67235254-67235276 CAGTAGATTAAGTTGTAGACAGG + Intergenic
974898011 4:67962703-67962725 CTGTATATAAAGTTATGCCAAGG + Intronic
978581932 4:110240356-110240378 CTGTAGATATACCTGTGTCCAGG - Intergenic
978924091 4:114221411-114221433 ATGTAGATAAACTTGTGTCATGG - Intergenic
981787637 4:148499725-148499747 CTGTAGTGGAAGTTCTGGCCAGG - Intergenic
984308191 4:178021250-178021272 CTCCAGATAAAAATGTGGCCTGG - Intergenic
985224613 4:187746649-187746671 GTGTAGACAAATTTTTGGCCAGG - Intergenic
987900531 5:24005215-24005237 CTGTGGAAAAAGTTGGGGGCAGG - Intronic
988960648 5:36367992-36368014 ATGTAGGGAAACTTGTGGCCTGG - Intergenic
992181271 5:74200622-74200644 CTGTACATACAGTGGTGGCGAGG + Intergenic
994927581 5:106138197-106138219 ATATAGATAAACTTGTGGCATGG + Intergenic
997121112 5:131174078-131174100 CAGTTGATAAAGTAGTGGCTGGG - Intronic
997145842 5:131432321-131432343 TTGTAAATAAAGTTTTGGCTGGG + Intronic
998179697 5:139927907-139927929 AGGTAGATAAAGTTGTGAACTGG - Intronic
1001663812 5:173416143-173416165 CTGAAGATAACGTTGGGGGCTGG - Intergenic
1006482372 6:34307281-34307303 CTTTAAAAAAAGTTGAGGCCAGG + Intronic
1007398115 6:41588720-41588742 CTGGAGATCCAGGTGTGGCCCGG + Exonic
1010219308 6:73433894-73433916 CTATAGATAAATTTGGGGCCAGG - Intronic
1012095606 6:94954876-94954898 CTGTAGATCCAGTTGTGTCTGGG + Intergenic
1013394319 6:109719212-109719234 CTATCAAAAAAGTTGTGGCCAGG - Intronic
1016966995 6:149728412-149728434 CTGTAGATGAAGTTATAGCATGG + Intronic
1020273044 7:6608108-6608130 CCGGAGATGAAGGTGTGGCCGGG - Exonic
1022990825 7:35705482-35705504 CAGTAGATGAGGTTTTGGCCAGG - Intergenic
1023425016 7:40026817-40026839 GTGTAGTTAAAGTTGTAGTCTGG + Intronic
1026894883 7:74004235-74004257 CTGTAGTTAAAGGTGTACCCTGG + Intergenic
1030406488 7:109121189-109121211 ATGTAGATAAACTTGTGTCATGG + Intergenic
1031211987 7:118841046-118841068 TTGAAAATCAAGTTGTGGCCTGG + Intergenic
1033742222 7:144284248-144284270 CTGTTGATCTAGCTGTGGCCGGG + Intergenic
1033751680 7:144365366-144365388 CTGTTGATCTAGCTGTGGCCGGG - Exonic
1033919517 7:146372198-146372220 CTCAAGATAAAGATATGGCCAGG - Intronic
1036523176 8:9511296-9511318 CTGTAGATTAAGTGCTGGGCTGG - Intergenic
1041615489 8:59901089-59901111 CTGGATATAAAATTCTGGCCTGG - Intergenic
1043632978 8:82360044-82360066 AATTACATAAAGTTGTGGCCTGG + Intergenic
1047433135 8:124810084-124810106 TTTAAGATAAAGTTATGGCCGGG + Intergenic
1049304540 8:141893966-141893988 CTGCAGAAGAAGTTGTGGACTGG - Intergenic
1050311603 9:4358932-4358954 CTGTAGTTCAAGATGTGGCTGGG + Intergenic
1051791670 9:20810761-20810783 CTGGAAATAAAGTTTAGGCCAGG + Intronic
1052917323 9:33933336-33933358 CTGTAGCTTAGGTTTTGGCCAGG - Intronic
1054714904 9:68547377-68547399 CTGTAAATAAAGTTGTGGTGAGG + Intergenic
1055025284 9:71713100-71713122 CTGTAGAAAAAGTTGTGATATGG + Intronic
1057019807 9:91688248-91688270 CTGTAAAGAAAGGTGTTGCCTGG - Intronic
1058038063 9:100274486-100274508 CTGATGATAAAGATGTGGACAGG + Intronic
1059687571 9:116652039-116652061 CCGTATGTAAAGTTGGGGCCAGG + Intronic
1186766976 X:12781115-12781137 CTGAGGATAAAGCTGTGTCCAGG + Intergenic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1191878533 X:65821685-65821707 CTGTAAATAAATTTGTGCTCAGG + Intergenic
1194327934 X:92543587-92543609 TTATAAATAAAGTTTTGGCCGGG + Intronic
1194681785 X:96863074-96863096 CTGTCTATAAAGATGTGTCCTGG + Intronic
1194984411 X:100474719-100474741 ACGTAGGTAAAGTTGTGTCCTGG - Intergenic
1200636645 Y:5662798-5662820 TTATAAATAAAGTTTTGGCCGGG + Intronic