ID: 1103338278

View in Genome Browser
Species Human (GRCh38)
Location 12:120206599-120206621
Sequence CTCTGATTGTAAAGGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103338278_1103338282 15 Left 1103338278 12:120206599-120206621 CCTGGACACCTTTACAATCAGAG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1103338282 12:120206637-120206659 AACTGTATCTTGACTCTCACTGG 0: 2
1: 0
2: 1
3: 7
4: 122
1103338278_1103338283 29 Left 1103338278 12:120206599-120206621 CCTGGACACCTTTACAATCAGAG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1103338283 12:120206651-120206673 TCTCACTGGTGCTTTTCCTTTGG 0: 2
1: 0
2: 2
3: 33
4: 279
1103338278_1103338281 -8 Left 1103338278 12:120206599-120206621 CCTGGACACCTTTACAATCAGAG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1103338281 12:120206614-120206636 AATCAGAGGTAGCATCTGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103338278 Original CRISPR CTCTGATTGTAAAGGTGTCC AGG (reversed) Intergenic
902762790 1:18594732-18594754 CTCTGATTCCAGAGGTTTCCTGG - Intergenic
903549527 1:24148260-24148282 CTCTGTCTGTAAAGGAGTCTTGG + Intergenic
903826418 1:26148841-26148863 CTCTGATTGAACAGGAGGCCAGG - Intergenic
904249083 1:29209867-29209889 CTGGGATTCTAATGGTGTCCTGG + Intronic
906785975 1:48616304-48616326 CTCTGGTTGTAGAGGCCTCCTGG - Intronic
908335275 1:63116266-63116288 CCCTGATGGTAAAGGGGGCCAGG + Intergenic
910351792 1:86307100-86307122 CTCTGATTATAAGGGAGTCTGGG - Intergenic
913590168 1:120316798-120316820 CTCTGATGGTAAAGTTATACAGG - Intergenic
913618016 1:120581566-120581588 CTCTGATGGTAAAGTTATACAGG + Intergenic
914572198 1:148928657-148928679 CTCTGATGGTAAAGTTATACAGG - Intronic
914600640 1:149201608-149201630 CTCTGATGGTAAAGTTATACAGG + Intergenic
914851373 1:151316633-151316655 ATCTGATTTTGAAGGAGTCCAGG - Intronic
915805618 1:158845829-158845851 CTCTGAATGTAAAGGAGTAATGG + Exonic
917321292 1:173784226-173784248 ATCTGTTTTTAAAGGTGTTCAGG + Intronic
918574567 1:186041740-186041762 TTCTGAATGTAAAGGTATACTGG - Intronic
922228140 1:223663559-223663581 CACTGATTGGAAAGGTGGTCAGG - Intronic
923847969 1:237759066-237759088 CTCAGATTGTAATGCTGTTCGGG + Intronic
1063961138 10:11306208-11306230 CTCTGCTTGAAGAGGTGTTCTGG + Intronic
1064296158 10:14080611-14080633 CTGTGATTGTAGCTGTGTCCAGG - Intronic
1069560239 10:69424040-69424062 ATCTGGTTGTAATGGTGACCTGG - Intergenic
1071390079 10:85165242-85165264 CTCTAATTGTACAGGTGGACAGG - Intergenic
1074108618 10:110407203-110407225 CACTGATTTAGAAGGTGTCCTGG + Intergenic
1077863088 11:6200150-6200172 TTCTGAATGTGAAGGTTTCCAGG - Exonic
1083092130 11:60210749-60210771 GACTGAATGTAAAGGTGCCCAGG + Intronic
1093405812 12:18802608-18802630 TTCTGATTATAATGGTGTGCAGG + Intergenic
1103338278 12:120206599-120206621 CTCTGATTGTAAAGGTGTCCAGG - Intergenic
1106684005 13:32037631-32037653 CTCAGATTGTAAAATTATCCGGG - Intronic
1110384194 13:74889567-74889589 CACTGATACTAAAGGTTTCCTGG - Intergenic
1113825171 13:113247115-113247137 ATCTGATTGTTAAGGAGTCTGGG - Intronic
1117382314 14:55177064-55177086 TTCTGTTTTTAAAGGAGTCCAGG + Exonic
1119452406 14:74723162-74723184 CTGTCATTGCAAAAGTGTCCTGG + Intronic
1121206424 14:92172392-92172414 CTCTAACTGTGAATGTGTCCTGG - Intergenic
1121412477 14:93757523-93757545 TTCTGACTGTGAAGGAGTCCAGG + Intronic
1121494043 14:94379842-94379864 CTCTGATATTCTAGGTGTCCTGG + Intronic
1121867019 14:97372116-97372138 CTGTGAATGTCAAGGTGTCATGG - Intergenic
1122266642 14:100549822-100549844 CCCTGGGTGAAAAGGTGTCCTGG + Intronic
1125338707 15:38653503-38653525 CTCTGATTGTGAAGAGCTCCAGG + Intergenic
1125433218 15:39618727-39618749 CTCTGCTTGTAAAGGTTACCAGG + Intronic
1128439684 15:67694004-67694026 CTCTGAATGTAAAGGTTTAGGGG + Intronic
1130901873 15:88213318-88213340 CTCTACTTTTAAAGGTGTCTGGG + Intronic
1135561582 16:23480681-23480703 CTCTGTTTCCAAAGGTGACCCGG + Exonic
1135937450 16:26793247-26793269 CTCTCACTGTAAAGGTCTCACGG - Intergenic
1138053883 16:53812188-53812210 CTCTGGTTGTAGAGGTGTCAGGG - Intronic
1140317899 16:73917141-73917163 CTCTGCTTGTAAATGGGTACTGG - Intergenic
1142276773 16:89122948-89122970 CTCTGACTGTCAGGGTGCCCAGG - Intronic
1143620053 17:8075565-8075587 CCCTGATTGCCCAGGTGTCCAGG + Intronic
1144506070 17:15832285-15832307 CACTGATGATAATGGTGTCCAGG - Intergenic
1145170243 17:20650207-20650229 CACTGATGATAATGGTGTCCAGG - Intergenic
1148727695 17:49807037-49807059 CACTGATCGCAAGGGTGTCCTGG - Intronic
1148849445 17:50547706-50547728 CTCTGATTCCCTAGGTGTCCTGG + Exonic
1149158082 17:53657813-53657835 CTCTTATTGTAAAGGTAACATGG - Intergenic
1149306410 17:55351057-55351079 CTCTGAGAGTAGAGGTTTCCAGG - Intergenic
1153702331 18:7708531-7708553 CTCTCATTGTAAAAATGTTCAGG - Intronic
1153954193 18:10082311-10082333 TTCTCATTTTAGAGGTGTCCTGG + Intergenic
1156382102 18:36572667-36572689 CTCCCATTGTAATAGTGTCCTGG + Intronic
1157550927 18:48581585-48581607 CTCTGCTGGTAAAGATGTCTGGG + Intronic
1158351725 18:56571304-56571326 CTATGATCTTAAAGGTTTCCGGG - Intergenic
1159806530 18:72964032-72964054 CTCTGGTTGAACAGGGGTCCTGG + Intergenic
1162680052 19:12333743-12333765 CTCTGATTGGATAGGGCTCCAGG + Intergenic
1162957079 19:14105004-14105026 CTCTGATGGTAAATTTTTCCTGG - Intronic
1164620960 19:29695811-29695833 GTCTGAGTGTCCAGGTGTCCAGG - Intergenic
1166205037 19:41264260-41264282 CTCTGATTGGCTAGGTTTCCGGG + Intronic
1168268219 19:55234903-55234925 TTCTGAGGGTAAAGTTGTCCTGG - Intronic
929859553 2:45664939-45664961 CACTGATTGTTCAGTTGTCCTGG + Intronic
931483190 2:62663950-62663972 CTCTTATTGTCAAAGTGTTCAGG + Intergenic
935184686 2:100721549-100721571 TTCTGACTGGAAAAGTGTCCAGG - Intergenic
936281939 2:111149138-111149160 CTCTGAGTGTAATGCTTTCCTGG + Intronic
937826352 2:126372169-126372191 CACTTCTTGTAAAGGTGTCCTGG + Intergenic
938667816 2:133557400-133557422 GTATGGTTATAAAGGTGTCCTGG - Intronic
939478771 2:142720823-142720845 TCCTGATTGTAAAGGAGCCCAGG + Intergenic
939877593 2:147595486-147595508 CTATGATTGTTACGGTCTCCCGG + Intergenic
941547077 2:166864956-166864978 CTCTTAATGTAAAGATGGCCAGG + Intergenic
945785602 2:214232569-214232591 CTCTGACTGTGAAGGAGTCGGGG + Intronic
948133615 2:235619805-235619827 CTCTGATAGCACAGGTGTCTGGG + Intronic
1173302179 20:41813920-41813942 CTCTGATTGTAAAGGGGCACAGG + Intergenic
1174599820 20:51715242-51715264 CTTTGATTGTAAAGATGTATGGG - Intronic
1177327739 21:19614004-19614026 CTCTTAGTGGAAAGTTGTCCAGG + Intergenic
1179648822 21:42793372-42793394 TTCTGCTTGTAAGAGTGTCCAGG - Intergenic
1182239925 22:28907707-28907729 CACTGATTGCAAAGGGGTACAGG - Intronic
1183109242 22:35636863-35636885 CACTGATAGTAAATGTGGCCAGG - Intronic
1183808670 22:40235533-40235555 CTCTAATTGTGAAGGAGTCTTGG + Intronic
1185138321 22:49086463-49086485 CTCTGGTTTCAAAGGTGGCCAGG - Intergenic
955525087 3:59811872-59811894 CTGTGATTGTGAAGGTGACAAGG + Intronic
956302935 3:67792149-67792171 CTTTGATGGTCAAGGTGTCATGG + Intergenic
957600330 3:82325712-82325734 ATGTGATTGTGAAGGTGCCCAGG - Intergenic
960269098 3:115655049-115655071 CTTTGATTATAAAGTTTTCCAGG + Intronic
960855975 3:122102588-122102610 CTATGGTTGTAAAATTGTCCAGG + Intronic
962377713 3:134872418-134872440 ATCAGACTGTAAAGGAGTCCAGG + Intronic
962840361 3:139227163-139227185 CGCTGAGTGTAAAGGTGTGCTGG + Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
967436197 3:189449262-189449284 CTCTGATTGTCATGGTAACCAGG - Intergenic
967649514 3:191968748-191968770 ATCTGATAGTCAAGGTATCCAGG + Intergenic
968419812 4:474223-474245 CTCTGATTGGATATGGGTCCAGG + Intronic
968606450 4:1537917-1537939 CTCTGAGTCTCAAGGTGCCCTGG - Intergenic
969689265 4:8695158-8695180 CTCTGGTTGTGAAGTGGTCCAGG + Intergenic
973899399 4:55452273-55452295 CTCTGATGGAAAAGGTCACCTGG + Intronic
978938727 4:114411997-114412019 TTCTGATTGCAAAGTTGCCCTGG - Intergenic
980077841 4:128312693-128312715 CTCTGATTATAAATGTGTCTGGG - Intergenic
980748088 4:137047908-137047930 CTCTGGTTGTTAAGGTCTTCTGG - Intergenic
982319656 4:154064807-154064829 TTCTGATTTTAAAGGTTTGCAGG + Intergenic
983179111 4:164626928-164626950 GTGTGAGTGTATAGGTGTCCTGG - Intergenic
983522502 4:168724777-168724799 CTCTGTATGTGAAGGTTTCCTGG + Intronic
985802341 5:2012994-2013016 CTCTGCTTGTCCAGGTGACCGGG - Intergenic
986995346 5:13601524-13601546 ATCTGAGTGTAAAGGGGTCAGGG - Intergenic
987922307 5:24298795-24298817 ATCTGATTGTAAATGTGAACAGG + Intergenic
988845067 5:35119458-35119480 CTCTGATTGTAAAGACTTCCAGG - Intronic
995767723 5:115637020-115637042 CTGTGATTGTAAAAGTGTGCTGG - Intergenic
998107677 5:139478631-139478653 CTCTCATTGTACAGGAGGCCAGG + Intronic
1004733126 6:18377833-18377855 CTTTCATTGTCAAAGTGTCCTGG + Intergenic
1005813417 6:29532511-29532533 CTATGATCTTAGAGGTGTCCAGG - Intergenic
1006365574 6:33613250-33613272 CTGTGACTGTGAAGGTGCCCCGG + Intergenic
1006696662 6:35936670-35936692 CTCTGATTTTAAATGTTTCAAGG + Intergenic
1007621166 6:43215489-43215511 CTCTGATTGGAAAGGGGTGGTGG - Intronic
1011025434 6:82863997-82864019 CTGTGATTATAAAGTTCTCCAGG + Intergenic
1011623613 6:89265662-89265684 CTCTGATGGTCATGCTGTCCTGG - Exonic
1013535557 6:111060241-111060263 ATCTTATTGTAATGGAGTCCTGG - Intergenic
1017013335 6:150079914-150079936 CTCTGGTTGTAAAGGAGTCTGGG + Intergenic
1019204169 6:170345029-170345051 CACTGATTGTAAATGTTCCCCGG + Intronic
1025239195 7:57257137-57257159 CTCTGATTGGATAGGGCTCCGGG + Intergenic
1026366331 7:69652186-69652208 CTCTGCTTGTTAAGGTGAGCAGG + Intronic
1027196668 7:76035297-76035319 CTCAGATTTTAAAGATTTCCCGG - Intronic
1042686756 8:71450505-71450527 CTCTGATTGTAAAGGTTCTGGGG - Intronic
1043667014 8:82826888-82826910 ATGTGTTTGTAAAGATGTCCTGG - Intergenic
1048082204 8:131140494-131140516 AGCTGATTGCCAAGGTGTCCAGG - Intergenic
1049236875 8:141516701-141516723 CTCTGCTTGTAGAGGGGTCGAGG - Intronic
1049457585 8:142701252-142701274 CTCAGAATGTAAAGAAGTCCGGG + Intronic
1051713680 9:19959089-19959111 CTCTCACTGTAAATGTGTACAGG + Intergenic
1055332857 9:75202122-75202144 CTCTGATTCTGTAGGTCTCCAGG - Intergenic
1059466770 9:114473826-114473848 TTCTGACTGTGAAGGTGTCATGG - Intronic
1060282997 9:122226563-122226585 CTCTGACTGTAAATGAGACCGGG - Intronic
1186037636 X:5441882-5441904 CTCTGTTAGTAAAGGTCACCAGG + Intergenic
1187401482 X:18964239-18964261 CTCTGCCTGTAAAGCTCTCCTGG + Intronic
1189916187 X:45857973-45857995 CTCTGAGAGTAAATGTGTCTCGG - Intergenic
1192489577 X:71563651-71563673 GTCTGATTTTAAAAGTCTCCTGG + Intronic