ID: 1103339459

View in Genome Browser
Species Human (GRCh38)
Location 12:120213762-120213784
Sequence GTCTTCCTCATTGTGCTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103339459_1103339467 19 Left 1103339459 12:120213762-120213784 CCAGACAGCACAATGAGGAAGAC 0: 1
1: 0
2: 0
3: 10
4: 186
Right 1103339467 12:120213804-120213826 GCTCCTCGCCCCTCCAGATGTGG 0: 1
1: 0
2: 2
3: 17
4: 134
1103339459_1103339471 26 Left 1103339459 12:120213762-120213784 CCAGACAGCACAATGAGGAAGAC 0: 1
1: 0
2: 0
3: 10
4: 186
Right 1103339471 12:120213811-120213833 GCCCCTCCAGATGTGGTCAGGGG 0: 1
1: 0
2: 2
3: 5
4: 141
1103339459_1103339470 25 Left 1103339459 12:120213762-120213784 CCAGACAGCACAATGAGGAAGAC 0: 1
1: 0
2: 0
3: 10
4: 186
Right 1103339470 12:120213810-120213832 CGCCCCTCCAGATGTGGTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 70
1103339459_1103339469 24 Left 1103339459 12:120213762-120213784 CCAGACAGCACAATGAGGAAGAC 0: 1
1: 0
2: 0
3: 10
4: 186
Right 1103339469 12:120213809-120213831 TCGCCCCTCCAGATGTGGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103339459 Original CRISPR GTCTTCCTCATTGTGCTGTC TGG (reversed) Intronic
900506331 1:3031456-3031478 GTCTTCCTATCTGGGCTGTCTGG + Intergenic
900852955 1:5158129-5158151 CCCTTCCTCATTGTTCTCTCTGG + Intergenic
901105249 1:6750693-6750715 GTCTTCCTCATTGCTCTGATAGG + Intergenic
902227242 1:15004141-15004163 GCCAACCTCATGGTGCTGTCTGG + Intronic
905883066 1:41476958-41476980 GTTTTCCTCATGCTGCTGCCAGG + Intergenic
908474941 1:64478257-64478279 CTGTCCCTAATTGTGCTGTCTGG + Intronic
908477287 1:64502353-64502375 GAGTTCCCCATTGTCCTGTCTGG + Intronic
908645084 1:66269324-66269346 GGCTTCCTCGTTGTTCTTTCTGG - Intronic
908785149 1:67728345-67728367 GTCTCCCTGATTGCTCTGTCTGG + Intronic
910591530 1:88931758-88931780 GTCCTTCCCATTGTGCTCTCAGG - Intergenic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
915742043 1:158126152-158126174 GTCTCTCTCACTGTGCTGTATGG + Intergenic
918060099 1:181053620-181053642 GTCCTTGTCATTGTGCTGGCTGG + Exonic
919588320 1:199467012-199467034 GTCTTCCTCATGGTTCAGTGAGG - Intergenic
921425957 1:215001371-215001393 ATGTTCTTCATTGTGGTGTCTGG + Intergenic
922987848 1:229880287-229880309 GTCTTGCTCTTTTTCCTGTCTGG + Intergenic
923736353 1:236611833-236611855 GGTTTCCTCCTTGGGCTGTCTGG - Intergenic
924288830 1:242516125-242516147 GTCTTCCTCACTTTTCTGTTGGG + Intronic
1065279432 10:24119805-24119827 GGCTGCTTCAATGTGCTGTCTGG + Intronic
1067085520 10:43236009-43236031 CTCTTTCTCATTGGGGTGTCAGG - Intronic
1067272089 10:44801180-44801202 TCATTCCTCATTGTGCTGGCTGG - Intergenic
1069020937 10:63487691-63487713 GTCCCCCTCATTGATCTGTCAGG - Intergenic
1069321795 10:67180964-67180986 TACTTCCTCATGGTGCTGTCAGG - Intronic
1070516460 10:77212718-77212740 CTCTTCCTCATTAAGCTGTATGG + Intronic
1072433974 10:95398670-95398692 GTCTTCATTATTGTTCTGTGTGG - Intronic
1072761130 10:98057725-98057747 GTCTACCTCATGGTACTGCCAGG + Intergenic
1073332678 10:102680812-102680834 GCCTACCTCATTGTGCCATCAGG + Intronic
1074056420 10:109926184-109926206 GTCTCCCTCTTTCTGCTGTGTGG - Intergenic
1074446694 10:113526548-113526570 GTCTGCCCTATTGTGCTGTAAGG + Intergenic
1075736448 10:124667402-124667424 GCCTTCCTCATGGGGCTATCTGG + Intronic
1075777631 10:124998569-124998591 GTCTCCCTCATGGAGCTGGCAGG + Intronic
1076997626 11:306452-306474 GTCCTCCTCCTTCTGCTGGCTGG - Intergenic
1078500142 11:11865415-11865437 GTCATCTTCATTCTGCTGTTGGG + Intronic
1079458858 11:20661978-20662000 CTCTTCCATATTTTGCTGTCTGG + Intergenic
1080049659 11:27846567-27846589 GTCATCCTCATTTTACAGTCAGG - Intergenic
1080171008 11:29302626-29302648 GTCTTCATCTTTCTGCTGGCAGG + Intergenic
1083436160 11:62645056-62645078 GTTTTCTTCATTTTTCTGTCTGG - Intronic
1088389515 11:109298810-109298832 CTCTTCATCATTGTTCTCTCAGG + Intergenic
1089946631 11:122480446-122480468 GTCTCTCTCTTTGTGCTGTCTGG - Intergenic
1091622338 12:2098862-2098884 GTCTTCACCATTGTTCTGTGAGG + Intronic
1093872892 12:24313556-24313578 TTCTTCCTCAGTGTTCTGGCAGG + Intergenic
1094050404 12:26214331-26214353 TTCTTGCTTATAGTGCTGTCAGG + Intronic
1095561983 12:43576056-43576078 TTCTTCCACATTGTGCACTCAGG - Intergenic
1096035379 12:48464287-48464309 GTGTTCCTCATTTGGCTCTCAGG - Intergenic
1096566465 12:52486054-52486076 GTCTTCACCTTTCTGCTGTCAGG + Intergenic
1096918840 12:55062180-55062202 GTCTTGCTCAATGTGCTCTTTGG - Intergenic
1097867549 12:64571427-64571449 GGCTTCCTGATTGTGCTCACTGG - Intergenic
1100360951 12:93878765-93878787 CCCTTCCCCAGTGTGCTGTCAGG - Intronic
1102934811 12:116887486-116887508 ACCTTCCTCATTGTGTTGTGAGG + Intergenic
1103339459 12:120213762-120213784 GTCTTCCTCATTGTGCTGTCTGG - Intronic
1104110477 12:125699837-125699859 GTCCTCCTCAGTGTACTGACTGG + Intergenic
1105873518 13:24532068-24532090 GTGTTCCTGATTGGGCTCTCAGG - Intergenic
1109986363 13:69991223-69991245 GTTCTCCTCATTGTGATGTTAGG - Intronic
1110681680 13:78321096-78321118 GTCTGTCTCATAGTGCTGTGGGG + Intergenic
1111258068 13:85698317-85698339 GTATTCCTCATAGTTCTGGCTGG - Intergenic
1111918981 13:94390830-94390852 GTCTTCCTGACTGTCCTGGCAGG + Intronic
1114055038 14:18960647-18960669 GTCTCCCTCCTTTTTCTGTCTGG + Intergenic
1114107503 14:19441131-19441153 GTCTCCCTCCTTTTTCTGTCTGG - Intergenic
1117095895 14:52297344-52297366 GTCTTCCTCATTGATTTGTGAGG - Intergenic
1118353451 14:64990997-64991019 GCCTTCCTTATTGTGCCATCTGG + Intronic
1118714888 14:68552242-68552264 GTCTTCCGCACTGTACTGTCTGG + Intronic
1118889556 14:69896764-69896786 GTCTTCCTCCATGTGCCGTGTGG + Intronic
1120998671 14:90435898-90435920 ATCTTCCTAGTTGTGCTGTGAGG + Intergenic
1126244417 15:46487422-46487444 GTCTTCCTCAGAGCTCTGTCTGG - Intergenic
1126441277 15:48692107-48692129 ATCTTCCTCATTGTCTTTTCTGG - Intergenic
1126452910 15:48829280-48829302 TTTTTCCTCATTGATCTGTCTGG + Intronic
1127860857 15:62993375-62993397 GTCTACCTCACAGTGCTGTGAGG - Intergenic
1131972671 15:97907732-97907754 CTCTTCTTCATTTTTCTGTCTGG + Intergenic
1135765756 16:25176589-25176611 GTCTTGCTCATTGTCCAGGCTGG + Intronic
1135882313 16:26269916-26269938 CTCTTCCTGATTGTGGTGTGTGG - Intergenic
1137053703 16:35733619-35733641 GTCTTCATCATTAGACTGTCTGG + Intergenic
1138885089 16:61066948-61066970 GCCTTCCTCATTTTCCTGACAGG - Intergenic
1138895990 16:61205511-61205533 GTCTTCCTCATTGTTATGTGTGG + Intergenic
1139252227 16:65507391-65507413 GTCAACCTCATGGGGCTGTCTGG - Intergenic
1141216375 16:82028116-82028138 GTCTCCCTCATTGTGTTCTTAGG - Intergenic
1141326253 16:83062166-83062188 ATCTTTCTCATTTTACTGTCTGG + Intronic
1141706091 16:85665535-85665557 GTCTTCCTCACTCTGCCCTCTGG + Intronic
1142573231 17:889050-889072 GTCTTTCTCTTTGTGCTGTAAGG - Intronic
1142808557 17:2384691-2384713 GTCTCCCCCAGAGTGCTGTCGGG - Exonic
1145293527 17:21569896-21569918 GTCTTCCTGATTTTGGTATCAGG + Intronic
1146654972 17:34629769-34629791 GTCCACCTCACTGTGCTGCCGGG - Intronic
1147794788 17:43034674-43034696 GTCTGTTTCATTGTGCTGTGGGG - Intergenic
1152495906 17:80671215-80671237 CTCTTCGTCCTTGTGCTGCCCGG + Intronic
1159082645 18:63752891-63752913 ATTTTCCTCTTTGTGCAGTCTGG + Intergenic
1159782693 18:72677911-72677933 GGCTTCTTCAGTGTCCTGTCTGG - Intergenic
1166122447 19:40693700-40693722 GCCTTCCTCATGGGGCTGTTGGG + Intronic
1166720851 19:44994904-44994926 TTCTTGCTCAGTGTTCTGTCTGG + Intergenic
1167506324 19:49872978-49873000 GTCCTCCTCGTTGTCCTCTCTGG + Exonic
925032723 2:663435-663457 GTCTTCACCATTGTCCTGGCAGG - Intergenic
925359118 2:3265157-3265179 GTCTTCCTCAGGGTGGTTTCTGG - Intronic
929640450 2:43572992-43573014 GTCTTTGTTATTGTGCTTTCAGG - Exonic
929930780 2:46253955-46253977 AGCTTCCTGATGGTGCTGTCTGG + Intergenic
932223801 2:70023060-70023082 TTCTAGCTCATTGTGCTTTCTGG - Intergenic
936921034 2:117688442-117688464 GCCTTCAACATTGTGCTGTTGGG - Intergenic
938473049 2:131583434-131583456 GTCTCCCTCCTTTTTCTGTCTGG + Intergenic
938682970 2:133711169-133711191 GTCTTTTTCATTGTGATGTGTGG - Intergenic
938816044 2:134905238-134905260 GTCTTCCTCATTATGGTATATGG - Intergenic
942076190 2:172359109-172359131 GTCTCCCTCAGGGTGCTGGCTGG + Intergenic
944091263 2:195914589-195914611 GTCTTCCTCATTGGCCTGGTAGG - Intronic
944135063 2:196390130-196390152 GTCTACCTCATGGAGTTGTCAGG - Intronic
946484245 2:220085698-220085720 ATCTTCCTCATTTTGCTACCAGG - Intergenic
947326139 2:228979390-228979412 GTCTTCCCCATTCTGCTATCTGG + Intronic
947350645 2:229240968-229240990 TTCTTCTTCAATTTGCTGTCAGG + Intronic
948165249 2:235856394-235856416 ATCCTCCTCATGGTGCTGTTTGG - Intronic
1169525283 20:6417653-6417675 CCCTTCCTCATTGTCCTGGCTGG - Intergenic
1169603724 20:7291624-7291646 TTCTTCCACATTGTGGTGTGGGG + Intergenic
1170460317 20:16571580-16571602 GCATTCCTCAGGGTGCTGTCTGG - Intronic
1172653769 20:36524452-36524474 GGCTTCCTCATGGTGCTGGAAGG + Intronic
1172766684 20:37354868-37354890 GTCTTCCTCACCGGGCTGTTGGG + Intronic
1174715452 20:52753023-52753045 GTTTTGCTCATAGTGCTGGCAGG - Intergenic
1179484743 21:41702737-41702759 GCCTTCTTCCTTGTGCTGTGCGG - Intergenic
1179825828 21:43965961-43965983 GGCTTACTCATTGTGCTTTAGGG + Intronic
1180150232 21:45943504-45943526 GTCTTCCGCATCCTGGTGTCTGG - Intergenic
1180473519 22:15683197-15683219 GTCTCCCTCCTTTTTCTGTCTGG + Intergenic
1181296421 22:21843438-21843460 GTGATCCTCAGAGTGCTGTCTGG - Intronic
1182308286 22:29386770-29386792 GTCTTTCTCATGTTGATGTCAGG + Intronic
1184676391 22:46045453-46045475 GCTTGCCTCCTTGTGCTGTCGGG - Intergenic
949299459 3:2567112-2567134 GTCTTGCTCATTGTCCAGGCTGG + Intronic
950566204 3:13771120-13771142 GTCTTCCCCATTCAGCTGCCTGG + Intergenic
951227836 3:20141931-20141953 GCTTTCCTCATTGTTCTCTCTGG + Intronic
951445767 3:22778655-22778677 GTCTTTCTCTTTGAGCTATCAGG - Intergenic
954287153 3:49627010-49627032 ATCTGCCTCATTGTGCTGGGAGG + Intronic
955061620 3:55497313-55497335 GGATTCCTCCTTGTGCTGGCTGG + Intergenic
955132363 3:56183528-56183550 GCCTTCTTTAATGTGCTGTCGGG - Intronic
955804433 3:62719519-62719541 GTCTTCCTCAATGATCTGTATGG + Intronic
956339566 3:68206921-68206943 CTCTTCATCACTGTGCTGTGGGG - Intronic
965791330 3:172391208-172391230 ATCTTCTTAATTATGCTGTCAGG - Intronic
968518471 4:1024643-1024665 GCCTTCCTCACCGTGCTGCCAGG + Exonic
968664659 4:1814612-1814634 CTCTGCCTCACTGTGCTGTAGGG - Intronic
968958789 4:3732336-3732358 GGCTTCCTCCTTGTGCAGTGGGG - Intergenic
969137039 4:5037819-5037841 GTTTTCTTCATTGGGCTGTGAGG + Intergenic
971701240 4:29979694-29979716 GTCCTCCTCATTGTATTGCCAGG - Intergenic
972364356 4:38360373-38360395 GTGTTCCTGATTCTGCTGGCAGG - Intergenic
976125134 4:81826341-81826363 CTCTTGCTCTTTGTGCTGCCAGG + Intronic
978163378 4:105576776-105576798 TTCTTCCTCAGTGTGATGTTGGG + Intronic
978907861 4:114030059-114030081 TTCTTCCTCATTGTGCTAAGGGG + Intergenic
978935688 4:114372418-114372440 GTTTTCCTGATTCTGCTTTCTGG + Intergenic
980142561 4:128938039-128938061 GACTTCCTTATTGTACTCTCAGG + Intronic
984054517 4:174910378-174910400 GCCTCCCTCATGGTGCTGGCTGG + Intronic
988716138 5:33830016-33830038 GTCTTCCAGTTTGGGCTGTCTGG - Intronic
990368855 5:55096603-55096625 GTCTTCCTCATTGATCTCGCTGG - Intergenic
990506368 5:56449366-56449388 TTCTTCATCAGTGTGCAGTCTGG - Intergenic
995568929 5:113459029-113459051 CTCTTCTTCAGTGAGCTGTCTGG - Intronic
995852320 5:116559336-116559358 GTCTTCCTGCTTCTGCTATCTGG - Intronic
996762397 5:126999457-126999479 GACTTCATCATTGTTCTCTCAGG + Intronic
996915132 5:128703249-128703271 GGCTTCCTGCTTGTGCTGTCTGG - Intronic
998274281 5:140737292-140737314 GCCATCCTCACTGTGGTGTCAGG + Intergenic
998432930 5:142082143-142082165 GTCTACCTGATTGGGCTATCTGG + Intergenic
999885077 5:155913355-155913377 CTCTTCCATATTGTGCTCTCTGG - Intronic
1001265491 5:170271252-170271274 GTCTTTCTCATGGTGATGCCTGG - Intronic
1002379186 5:178813358-178813380 GTCTTCCTCCTTTTTCCGTCTGG - Intergenic
1009356390 6:62752274-62752296 CTCTTGCTCTTTGTGCTGGCTGG + Intergenic
1010756109 6:79667910-79667932 GTTTTCCTCATTGTCCTCTGTGG + Intronic
1013342213 6:109225868-109225890 GTCTTCCTCACAGTGTTATCTGG + Intergenic
1013961054 6:115900762-115900784 GTCTTGTTCATTTTGCTGTATGG - Intergenic
1014851464 6:126344168-126344190 GTCTTCCTCAATGTACTCTAAGG - Intronic
1015128584 6:129784143-129784165 GTTTTCCTGATTGTGCTGTGAGG - Intergenic
1015487225 6:133786743-133786765 GTCTTCCTCAGTGGACTGTGTGG + Intergenic
1017618926 6:156274883-156274905 TCATTCCTCATTGTTCTGTCAGG - Intergenic
1018873332 6:167799468-167799490 GTCTGCTGCATTGGGCTGTCAGG - Intergenic
1018957155 6:168417986-168418008 CTCTTCCTCTTTGTCCTCTCAGG - Intergenic
1021301699 7:18981243-18981265 TTCTTCCTCATTCTGCTGGTTGG - Intronic
1021744111 7:23721657-23721679 GACTCCCTCCCTGTGCTGTCAGG - Intronic
1026966742 7:74444978-74445000 GTCTTCATCAGTCTGCTGTCGGG - Intergenic
1027517684 7:79163203-79163225 GTCTTACTCATTGTCCAGGCTGG + Intronic
1027742325 7:82025427-82025449 GTTTTCCTCATTTTCCTTTCAGG + Intronic
1028194711 7:87892782-87892804 GACTTACTCATTGTCCTGTGGGG + Intronic
1029577651 7:101413989-101414011 GTCTGCCTCTGTCTGCTGTCTGG - Intronic
1030259492 7:107548116-107548138 GTCTTGCTAGTTGTGCAGTCCGG + Exonic
1035262573 7:157671311-157671333 GACTTCCTCATTGTGTTGGATGG - Intronic
1035757590 8:2045719-2045741 GTTTTCTTCTTTGTGCTGTTGGG + Intronic
1035895064 8:3390521-3390543 GTATTTCTCTTTGTGCTGTCAGG - Intronic
1036288414 8:7464709-7464731 GGCCTCCGCATTGTGCTGCCAGG - Intergenic
1036333061 8:7846819-7846841 GGCCTCCGCATTGTGCTGCCAGG + Intergenic
1038535038 8:28347654-28347676 GCCTTCCTCATCCTGCTTTCAGG + Exonic
1038763655 8:30407715-30407737 GTCATCTTCACTGTGCTGTGGGG + Intronic
1040976077 8:53195677-53195699 GTCTTTCTCCCTGTGCTGTTGGG + Intergenic
1041823989 8:62070878-62070900 GTCTTCCTCTGTGTTCTGTTGGG - Intergenic
1044590235 8:93907319-93907341 GACTTCCTCATTCTGCAGTTGGG - Intronic
1049155833 8:141066185-141066207 GTCTCCTTTTTTGTGCTGTCTGG - Intergenic
1051684302 9:19641423-19641445 GTCTTTCTCTCTGTGCTGTTTGG + Intronic
1052372643 9:27683075-27683097 GTCTCCCTCACTGAGCAGTCAGG + Intergenic
1053132195 9:35622255-35622277 GTCTCCCTCATGGTGCAATCAGG - Intronic
1053353386 9:37427996-37428018 GTCCTGCTCACTGTCCTGTCTGG + Intronic
1057581875 9:96294391-96294413 GTCTTCACCATGATGCTGTCTGG - Intronic
1059063406 9:111057557-111057579 GACTTCCACAATGTGCTGTGTGG - Intergenic
1059763145 9:117358461-117358483 GGATTTCTCATTGTGCTATCAGG - Intronic
1062305230 9:135902389-135902411 GTCTTCCTCCCTGTGTTGGCAGG - Intronic
1185664869 X:1757629-1757651 GTCTTCCTGATTCTCCTATCTGG + Intergenic
1189016237 X:37098954-37098976 GTCATCTTCACTGTGCTGTGGGG + Intergenic
1195861430 X:109387605-109387627 GTCTTCTCCAGTGTTCTGTCAGG - Intronic
1195941636 X:110172453-110172475 CTCTTCCTCATTCTGGTGTATGG + Intronic
1199252115 X:145675480-145675502 GTCTACCACATTGTGGTCTCTGG - Intergenic
1200061575 X:153486148-153486170 CTCTTCCTCTGTGTGCTGGCAGG - Intronic
1202250725 Y:22869504-22869526 TTCTTTTTCATTGTGCTCTCAGG - Intergenic
1202403714 Y:24503253-24503275 TTCTTTTTCATTGTGCTCTCAGG - Intergenic
1202467065 Y:25166829-25166851 TTCTTTTTCATTGTGCTCTCAGG + Intergenic