ID: 1103340051

View in Genome Browser
Species Human (GRCh38)
Location 12:120216359-120216381
Sequence GCCCCATGATGAGGGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 210}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103340051_1103340060 14 Left 1103340051 12:120216359-120216381 CCTGCACCCCCTCATCATGGGGC 0: 1
1: 0
2: 3
3: 16
4: 210
Right 1103340060 12:120216396-120216418 CTGGACCCCAGAAGAACCACAGG 0: 1
1: 0
2: 3
3: 22
4: 203
1103340051_1103340056 -5 Left 1103340051 12:120216359-120216381 CCTGCACCCCCTCATCATGGGGC 0: 1
1: 0
2: 3
3: 16
4: 210
Right 1103340056 12:120216377-120216399 GGGGCTCTTCCCCTGCACTCTGG 0: 1
1: 0
2: 1
3: 19
4: 313
1103340051_1103340065 27 Left 1103340051 12:120216359-120216381 CCTGCACCCCCTCATCATGGGGC 0: 1
1: 0
2: 3
3: 16
4: 210
Right 1103340065 12:120216409-120216431 GAACCACAGGTATAAGCTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 138
1103340051_1103340064 26 Left 1103340051 12:120216359-120216381 CCTGCACCCCCTCATCATGGGGC 0: 1
1: 0
2: 3
3: 16
4: 210
Right 1103340064 12:120216408-120216430 AGAACCACAGGTATAAGCTGAGG 0: 1
1: 0
2: 2
3: 26
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103340051 Original CRISPR GCCCCATGATGAGGGGGTGC AGG (reversed) Intronic
900188266 1:1342930-1342952 GCCCCATGCTGGGGGGGTGGGGG - Intronic
900188294 1:1343027-1343049 TCCCCATGCTGGGGGGGTGGGGG - Intronic
900192678 1:1358158-1358180 GCCCCAGCAAGAGGGGCTGCAGG + Intronic
900243152 1:1626284-1626306 GCCCCAGGACCATGGGGTGCAGG - Intronic
900524483 1:3121797-3121819 GCCGCCTGGGGAGGGGGTGCTGG - Intronic
900673730 1:3871150-3871172 TTCCCATGAGGTGGGGGTGCTGG + Intronic
901004314 1:6164567-6164589 GCTCCAAGATGACGGGGTGAAGG - Intronic
901625585 1:10623024-10623046 CGCCCAGGATGAGGGGGAGCAGG - Exonic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902814512 1:18908497-18908519 GCCCCATGAGGAGAGGTGGCAGG + Exonic
903560032 1:24220277-24220299 GGCCCCTGAGGAGGTGGTGCGGG - Intergenic
905043108 1:34976610-34976632 GCGCCAGGCTGAGGGTGTGCAGG + Intergenic
906198338 1:43943768-43943790 TCCCCATGGTGAGGGGGCCCTGG - Intergenic
908770805 1:67593854-67593876 GTCCCAGGCTGAGGGGGTGTGGG + Intergenic
911123942 1:94322932-94322954 GCCACAGGGTGAGAGGGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912710288 1:111944964-111944986 GCCCCATGATGATGGGGCAGGGG + Intronic
913093403 1:115494998-115495020 GGCCTGTGATGAGGGGGTACAGG - Intergenic
913522412 1:119657522-119657544 GGTCCAGGATGAGGGGGTGAGGG + Intergenic
915637813 1:157198804-157198826 GCCCCATGAAGAGGTGAGGCGGG - Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916248893 1:162716615-162716637 GCCCCATAGTGAGGGGCTGAGGG - Intronic
916642426 1:166744749-166744771 ATCCCATGATGTGGAGGTGCAGG - Intergenic
917466470 1:175281702-175281724 TCACCATGATGTAGGGGTGCAGG + Intergenic
918043475 1:180927191-180927213 GGACCATGGTGAGGGGCTGCAGG + Intronic
918312188 1:183292821-183292843 GACACATGATGAGACGGTGCCGG + Exonic
919725305 1:200878557-200878579 GCCCCATCATTTGGGGGTGATGG - Intergenic
920712891 1:208311825-208311847 GAGCCATGGTGAGGGGATGCAGG + Intergenic
921055970 1:211542718-211542740 GCCCCATGGTGGGTGGGGGCGGG + Intergenic
924021413 1:239787644-239787666 GGCCCATGCTGAGGGGAAGCGGG + Intronic
924100219 1:240595438-240595460 TGCCCAGGAGGAGGGGGTGCAGG - Intronic
1062768224 10:81137-81159 GTCCCATGATGAGGATGGGCTGG - Intergenic
1063377882 10:5564896-5564918 GCCCTAGGAAGAGTGGGTGCTGG + Intergenic
1069914261 10:71777742-71777764 GCCCCACTATGAGGTGCTGCTGG + Intronic
1071199888 10:83209431-83209453 GATCCATAATGAGGGGGTGGAGG - Intergenic
1072946216 10:99812228-99812250 GCCCCAGGATGAGTTGGGGCAGG + Intronic
1075587473 10:123668034-123668056 GACCCTAGATAAGGGGGTGCTGG + Intronic
1076052904 10:127349443-127349465 GCCACTTGATGCTGGGGTGCAGG - Intronic
1076273321 10:129175151-129175173 GCCCCAGGATGTGGGACTGCCGG - Intergenic
1076729423 10:132431061-132431083 GCCCCAGGAGGAGGGTGAGCAGG - Intergenic
1077171067 11:1165960-1165982 GCCCAATGCTGGGTGGGTGCTGG - Intronic
1079071814 11:17353562-17353584 GGCCCCTGAGGAGGGGGCGCCGG - Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1083136593 11:60683961-60683983 TTCCCATGATGAGGTGGTTCTGG + Intergenic
1084407104 11:68980422-68980444 CCCCCATGATGAGGGCGGCCTGG + Exonic
1084679187 11:70656139-70656161 GCCCCATGTTGTGGGAGTGAAGG + Intronic
1089806973 11:121099103-121099125 GCCCCATGAAGAGTGTGTCCTGG + Intergenic
1092097363 12:5853898-5853920 GACCCATGATGCCGGGGTGGGGG - Intronic
1094096509 12:26711234-26711256 GACCCATGCCGTGGGGGTGCAGG - Exonic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096229509 12:49889326-49889348 GCCACCTGATGAGGGGGAGGAGG - Intronic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1101332626 12:103769334-103769356 ACCCCATGCTGAGGGCCTGCTGG - Intergenic
1102233089 12:111277115-111277137 GCCCCAGGATGAATGGTTGCTGG + Intronic
1103340051 12:120216359-120216381 GCCCCATGATGAGGGGGTGCAGG - Intronic
1106654844 13:31732256-31732278 GACCCATGGAGAGGGTGTGCTGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1113282143 13:108800013-108800035 TCCCCATGATGATGGCGGGCGGG - Intronic
1117009119 14:51452282-51452304 GCCCAATGATGAGTGGATGGTGG + Intergenic
1117864878 14:60136739-60136761 CTCCCATGATGAGGTGGTTCTGG + Exonic
1119520045 14:75278580-75278602 CCCCCAAGATGAGGGGTTTCGGG - Intergenic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120925472 14:89793305-89793327 GCCCCATGATGTTTGGCTGCTGG - Intergenic
1122114458 14:99520728-99520750 GCCCCATGGTGAGTGCGTCCTGG - Intronic
1122118763 14:99540796-99540818 CTCCCATGAGGAGGGGGTGGGGG + Intronic
1122410860 14:101525560-101525582 GCTCCATGAAGAGGGTGGGCAGG + Intergenic
1122721243 14:103723821-103723843 GCCCCCTGTGGAGGGGCTGCAGG + Intronic
1123121466 14:105918870-105918892 GCCCCAGGCTGAGGTGGTGGGGG - Intronic
1123404179 15:20010535-20010557 GCCCCAGGCTGAGGTGGTGGGGG - Intergenic
1123513518 15:21017181-21017203 GCCCCAGGCTGAGGTGGTGGGGG - Intergenic
1124344576 15:28913635-28913657 GCCCCAGGATGTGCTGGTGCTGG + Intronic
1128565032 15:68695388-68695410 GCCCCACGATGTGGGGGGGATGG + Intronic
1129034506 15:72641297-72641319 GCTCCATGAGGAGGGGAGGCAGG + Intergenic
1129215376 15:74095919-74095941 GCTCCATGAGGAGGGGAGGCAGG - Intergenic
1129392251 15:75226288-75226310 GCTCCATGAGGAGGGGAGGCAGG + Intergenic
1129472142 15:75761877-75761899 GCTCCATGAGGAGGGGAGGCAGG - Intergenic
1129732518 15:77940248-77940270 GCTCCATGAGGAGGGGAGGCAGG - Intergenic
1130656052 15:85792897-85792919 GCACCTAGATGAGGGAGTGCTGG - Intronic
1132477591 16:149059-149081 GGCCCATGAGGAGGGGATGTGGG - Intergenic
1132717902 16:1301264-1301286 GCCCCATGAGGAGGCGGCCCGGG - Intergenic
1136544814 16:30949021-30949043 GCCACATGATGGGGTGGAGCCGG - Intergenic
1137787465 16:51150809-51150831 GCCCCATGAGGCGTGGGTGCGGG - Intronic
1139337845 16:66245581-66245603 ACCCCTGGATGAGGGGTTGCTGG - Intergenic
1139361650 16:66403272-66403294 GACCCACGAGGAAGGGGTGCTGG - Exonic
1140230737 16:73115238-73115260 GCCCCAAGATTACGGGGTCCAGG + Intergenic
1141867917 16:86763389-86763411 GCCCCATGATGAAGAGGAGATGG - Intergenic
1142028237 16:87825671-87825693 GGCCCAGGCTGAGGGGGTCCAGG - Intergenic
1142028763 16:87828208-87828230 GGCCCAGGCTGAGGGGGTCCAGG + Intergenic
1142029670 16:87832264-87832286 GCCCCAGGGTTGGGGGGTGCCGG - Exonic
1142236091 16:88923270-88923292 GTGCGATGAGGAGGGGGTGCGGG - Intronic
1142485574 17:245803-245825 CCCTCAGGAGGAGGGGGTGCAGG - Intronic
1142715165 17:1743160-1743182 GCCCCAAGATGGGGGTGGGCTGG + Intronic
1143556923 17:7667867-7667889 GGCCCAGGATGAGGGGATGCTGG + Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1146891011 17:36506545-36506567 GCCCCATGAGCAGGGGGTCCTGG + Exonic
1147320683 17:39644067-39644089 CCCCCATGGGCAGGGGGTGCTGG + Intronic
1147420438 17:40319741-40319763 GCTCCATGAAGAGGCTGTGCCGG + Intronic
1147446434 17:40477857-40477879 GCCCCACCATAAGGAGGTGCTGG - Intronic
1147645199 17:42029049-42029071 GGCCCAAGAGGAGGGGCTGCAGG + Exonic
1149993134 17:61393803-61393825 GCCCCAGCAGCAGGGGGTGCTGG + Intergenic
1152040731 17:77901002-77901024 CCCCCATACTGAGAGGGTGCTGG + Intergenic
1152292509 17:79448196-79448218 GCCCCCAGAAGAGGGGGTGGGGG + Intronic
1153815099 18:8784546-8784568 CCTCCATGATGCGGGGCTGCGGG + Exonic
1153909727 18:9696333-9696355 TTCCCATGATGAGGCGGTTCTGG - Intergenic
1153992785 18:10414842-10414864 GCTCTATGATGAGGGAATGCTGG - Intergenic
1155964919 18:32026615-32026637 ACCCCCTAAAGAGGGGGTGCTGG - Intronic
1158372861 18:56829402-56829424 TCCACATGGGGAGGGGGTGCTGG - Intronic
1159056062 18:63465236-63465258 GCTCCATGATGAGGGACTCCAGG + Intergenic
1160004306 18:75058142-75058164 GCTCCATTATGCGGGGGTGGAGG - Intronic
1160222097 18:76985036-76985058 GCACCACGCTGAGGGGGTGGGGG + Intronic
1160703223 19:518033-518055 GGCCCAGGCTGAGGGGGTGCTGG + Intronic
1161060218 19:2210997-2211019 GCCCCATCCTAAGGGGTTGCTGG + Intronic
1161265658 19:3362780-3362802 GCCCCTTGCTGAGCAGGTGCGGG + Intronic
1162554920 19:11380948-11380970 GCGTCAGGATGAGGGGGTCCAGG + Exonic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163846003 19:19638314-19638336 CCCCCAGAATGAGGCGGTGCAGG - Exonic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1166957196 19:46472432-46472454 GTTCCATGATGAGGCGGTTCTGG - Intergenic
1167494434 19:49809363-49809385 GCCCCACGGTGAGTGGGTGGCGG - Exonic
1167740209 19:51320203-51320225 GGCCCAGGGTGAGGGGCTGCAGG + Intronic
925180156 2:1812387-1812409 TCCCCATGATGGGAGAGTGCTGG + Intronic
926205366 2:10831486-10831508 GCCCCAGGATGTGGGGCTGCCGG - Intronic
927874790 2:26648113-26648135 GCCCCACAATGAGGCAGTGCTGG - Intergenic
935109742 2:100081541-100081563 GCCAGATGATGAGGGGGTGCAGG - Intronic
935123017 2:100198622-100198644 GCCTCTTGAGGAGGGGGTGAGGG - Intergenic
936125232 2:109783668-109783690 GCCAGATGATGAGGGGGTGCAGG + Intergenic
936219461 2:110587800-110587822 GCCAGATGATGAGGGGGTGCAGG - Intergenic
936524363 2:113232880-113232902 TGCCCATGATGATGGGGAGCAGG - Intronic
937983996 2:127630467-127630489 GCCCCATGGAGAAGGGGAGCTGG + Intronic
938097862 2:128475203-128475225 ACCCCATGAGGAGTGGGGGCCGG + Intergenic
941403613 2:165061781-165061803 TTCCCATGATGAGGCGGTTCTGG + Intergenic
943782133 2:191836555-191836577 GCCCCACGATGAGGAGGCCCTGG - Exonic
948150453 2:235740270-235740292 TGACCATGAGGAGGGGGTGCGGG - Intronic
948505197 2:238423442-238423464 GCCCCAAGCTGAGGGCCTGCTGG + Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1168788639 20:561071-561093 TCCACATAATGAGGGAGTGCTGG - Intergenic
1168972529 20:1940381-1940403 GCCCCAGGAGGAGGGTGAGCCGG - Intronic
1169346030 20:4828707-4828729 GCCCCAGGATGAAGAGGGGCAGG + Intergenic
1171958569 20:31477300-31477322 GCCCCAGGATGATGGGGTACAGG + Intronic
1172191812 20:33066262-33066284 GCCACAAGGGGAGGGGGTGCAGG + Intronic
1172244870 20:33438877-33438899 TACCCATGATGAGGCGGTGCAGG - Exonic
1172731958 20:37095892-37095914 GCCCCACGCTGAGGGGGCGGCGG - Exonic
1173617302 20:44411478-44411500 GCGCCCTGATGGGTGGGTGCGGG + Intronic
1174195431 20:48769437-48769459 GCCCCATGCCTAGTGGGTGCTGG - Intronic
1175167332 20:57054192-57054214 GCCACGTGAAGAGGGGGTGAAGG + Intergenic
1175856947 20:62126234-62126256 GCGCCCTGATGAAGGCGTGCGGG + Intronic
1176004193 20:62850816-62850838 GCCCAATGATGACAGGGAGCTGG - Intronic
1178420196 21:32437248-32437270 GCCCCATGCTGAGAGGGACCCGG - Intronic
1179815699 21:43904674-43904696 GCCCTATGACGACGGGCTGCAGG - Intronic
1180749895 22:18117023-18117045 GGCCCAGGATAAGGGGGTTCTGG + Intronic
1181311528 22:21947297-21947319 GGTCCATGCTGAGTGGGTGCTGG - Intronic
1181742471 22:24932489-24932511 CCCCAAAGTTGAGGGGGTGCTGG - Intergenic
1182036835 22:27205506-27205528 GCTCCAACATGACGGGGTGCAGG - Intergenic
1182698127 22:32209924-32209946 TGCCCATGGTGAGGGGGTGAGGG - Intergenic
1183608769 22:38883401-38883423 GCACCCTGACAAGGGGGTGCTGG + Intergenic
1184877868 22:47286807-47286829 ACCCCAGGATGATGGGGAGCAGG - Intergenic
949191399 3:1253599-1253621 TCCCCAGGATGAGGGGTTGGAGG + Intronic
959259818 3:104062947-104062969 GCACCATCAAGAGGGAGTGCGGG + Intergenic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
962275629 3:134011379-134011401 GGCCCATGATGTGGGAGTCCTGG + Intronic
962318152 3:134371379-134371401 GCTCCTGGATGAGGCGGTGCAGG + Exonic
965415484 3:168387557-168387579 TTCCCATGATGAGGCGGTTCTGG + Intergenic
967020374 3:185517291-185517313 CCCCCATGGTGAGGGCCTGCAGG + Intronic
967298343 3:187987298-187987320 GCCAGAAGATGAGGAGGTGCTGG - Intergenic
968463901 4:740275-740297 CCCCCACCATGTGGGGGTGCGGG - Intronic
968870750 4:3240921-3240943 GCCCGAGGAGGAGGGGCTGCAGG - Exonic
969454585 4:7294196-7294218 AGCCCATGATGAGGCAGTGCCGG + Intronic
980047616 4:128006084-128006106 GTCCCATGATGAATGGGTACAGG - Intronic
983088195 4:163473136-163473158 GCGCCATGCTCAAGGGGTGCAGG + Exonic
985014815 4:185623127-185623149 GCTCACTGATGAGGCGGTGCAGG + Exonic
985652248 5:1112472-1112494 GGCCCAGCAGGAGGGGGTGCAGG - Intergenic
998104885 5:139462256-139462278 GCCCCAAGATCAGAGGGTGAGGG + Intronic
998368407 5:141645821-141645843 GGCCCAGGATGAGGTGGAGCAGG - Exonic
999426050 5:151488508-151488530 GAGGCATGATGAGGGGGAGCTGG - Exonic
1002081191 5:176738452-176738474 TCCCCATGGTGAGGGTGTGAGGG + Intergenic
1003133950 6:3418634-3418656 TCCCCCTGGGGAGGGGGTGCAGG + Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1006204856 6:32331651-32331673 TTCCCATGATGAGGGGGTTCTGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1006917631 6:37605159-37605181 CCACCATGATGAGGGGCTGCAGG - Intergenic
1007391664 6:41552981-41553003 GCCCGAGGATGTGGGGCTGCAGG - Intronic
1013079688 6:106801435-106801457 GGCACAGGAAGAGGGGGTGCGGG + Intergenic
1015502092 6:133945173-133945195 CAGCCATGATGAGGGGGAGCGGG - Intergenic
1019456470 7:1130329-1130351 GGCCCCTGATGGAGGGGTGCTGG + Intronic
1022633750 7:32111441-32111463 CCCCCATCATGAGATGGTGCAGG + Intronic
1023042073 7:36180850-36180872 GGTGCATGATGAGGGGGTGGGGG - Intronic
1025102039 7:56143620-56143642 GCCCCATCCTGAGGCTGTGCAGG - Intergenic
1026145599 7:67743891-67743913 GACCCATGATGAGGGGAGGGAGG - Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033597709 7:142868634-142868656 GCCGCAGGATGTTGGGGTGCTGG - Exonic
1033657029 7:143381435-143381457 GCCCCACGGGGAGGGGGCGCGGG + Intronic
1034450745 7:151135993-151136015 GCCCCATGATGGGTGGTGGCCGG - Intronic
1035771566 8:2151477-2151499 GCTCCATGAACACGGGGTGCAGG + Intronic
1037493130 8:19414157-19414179 GCTCTCTGAAGAGGGGGTGCAGG - Intronic
1037669468 8:21001846-21001868 GCCACACGAGGAGGGGGTGCAGG + Intergenic
1037805544 8:22056351-22056373 GCCTCTTGAGGTGGGGGTGCAGG - Intronic
1039837114 8:41265295-41265317 GGCCCATGATGAGGAAGTGGTGG + Exonic
1039839200 8:41281363-41281385 CCCCCATGCTGAGGGAGTGAGGG - Intronic
1039948731 8:42152118-42152140 GCCCTTTGCTGAGGTGGTGCGGG - Intergenic
1040323628 8:46330347-46330369 CCCCCATGATGGGGGGGCCCTGG + Intergenic
1042847096 8:73179213-73179235 GCCAAATGATGAGGAGGTGCAGG - Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1045414445 8:101952373-101952395 GCCACAGGAAGAGGAGGTGCTGG - Intronic
1046621943 8:116537456-116537478 GCCCAATGAAGAGGGGCTGCGGG - Intergenic
1048545270 8:135380861-135380883 GAGCCATGATGAGAGGCTGCTGG + Intergenic
1050424526 9:5500086-5500108 GTCCCATGATGAGGCAGTTCTGG + Intergenic
1053013207 9:34647114-34647136 GCTGCAGGATGAGTGGGTGCTGG + Exonic
1060149896 9:121281906-121281928 TCCCCATAAAGAGGAGGTGCAGG + Intronic
1060585242 9:124781445-124781467 GCCTCATGGTGAGGCGGGGCTGG + Intronic
1061297932 9:129687029-129687051 GCCCCCTGCAGAGGGGGTGGGGG + Intronic
1062079782 9:134617755-134617777 GCCCCAGGATGTAGGTGTGCAGG + Intergenic
1062290039 9:135790316-135790338 GCCTCATGCTGAGGCTGTGCAGG - Intronic
1062460932 9:136662315-136662337 GGCCCATGGTGAGGGGGTGACGG - Intronic
1203792484 EBV:159303-159325 GCCCCGTGATGAAGGTGTACAGG + Intergenic
1185643406 X:1600552-1600574 GCCCCATGGTCTGGGGATGCAGG - Intronic
1185942912 X:4341066-4341088 GGCCCAGGATGAGGGTGTGGCGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1187568690 X:20478475-20478497 GCTCCATGCTGAGGGAGTTCTGG - Intergenic
1188004111 X:25005608-25005630 GCGCCAGGATGTGGGGCTGCTGG - Intronic
1189539366 X:41970516-41970538 GACCCATGAGGAAGGGGTACTGG + Intergenic
1189539684 X:41972705-41972727 GCCTCCTGAGGAGGGGGTGCTGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1194141505 X:90215837-90215859 TTCCCATGATGAGGTGGTTCTGG + Intergenic
1194142637 X:90223484-90223506 TCCCCATGATGAGGTGGTTCTGG + Intergenic
1195065623 X:101235881-101235903 GCACCATCTTGAGGAGGTGCAGG - Exonic
1199745642 X:150770617-150770639 GCCCTATGAGGATGGAGTGCCGG - Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200487257 Y:3784941-3784963 TTCCCATGATGAGGTGGTTCTGG + Intergenic