ID: 1103342740

View in Genome Browser
Species Human (GRCh38)
Location 12:120229811-120229833
Sequence AAGCAGGTAAATGTGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 506}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103342733_1103342740 -1 Left 1103342733 12:120229789-120229811 CCTCTAGTCCCAGATCAGCAGGA 0: 1
1: 0
2: 3
3: 78
4: 2974
Right 1103342740 12:120229811-120229833 AAGCAGGTAAATGTGGGGCATGG 0: 1
1: 0
2: 2
3: 30
4: 506
1103342735_1103342740 -9 Left 1103342735 12:120229797-120229819 CCCAGATCAGCAGGAAGCAGGTA 0: 1
1: 0
2: 33
3: 154
4: 429
Right 1103342740 12:120229811-120229833 AAGCAGGTAAATGTGGGGCATGG 0: 1
1: 0
2: 2
3: 30
4: 506
1103342729_1103342740 21 Left 1103342729 12:120229767-120229789 CCCTGAGGGCAAAGGGTGCTGCC 0: 1
1: 0
2: 2
3: 23
4: 180
Right 1103342740 12:120229811-120229833 AAGCAGGTAAATGTGGGGCATGG 0: 1
1: 0
2: 2
3: 30
4: 506
1103342736_1103342740 -10 Left 1103342736 12:120229798-120229820 CCAGATCAGCAGGAAGCAGGTAA 0: 1
1: 0
2: 12
3: 172
4: 419
Right 1103342740 12:120229811-120229833 AAGCAGGTAAATGTGGGGCATGG 0: 1
1: 0
2: 2
3: 30
4: 506
1103342730_1103342740 20 Left 1103342730 12:120229768-120229790 CCTGAGGGCAAAGGGTGCTGCCC 0: 1
1: 0
2: 1
3: 16
4: 191
Right 1103342740 12:120229811-120229833 AAGCAGGTAAATGTGGGGCATGG 0: 1
1: 0
2: 2
3: 30
4: 506
1103342728_1103342740 26 Left 1103342728 12:120229762-120229784 CCAATCCCTGAGGGCAAAGGGTG 0: 1
1: 0
2: 0
3: 26
4: 156
Right 1103342740 12:120229811-120229833 AAGCAGGTAAATGTGGGGCATGG 0: 1
1: 0
2: 2
3: 30
4: 506
1103342731_1103342740 0 Left 1103342731 12:120229788-120229810 CCCTCTAGTCCCAGATCAGCAGG 0: 1
1: 0
2: 2
3: 12
4: 204
Right 1103342740 12:120229811-120229833 AAGCAGGTAAATGTGGGGCATGG 0: 1
1: 0
2: 2
3: 30
4: 506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103342740 Original CRISPR AAGCAGGTAAATGTGGGGCA TGG Intronic
900602498 1:3509172-3509194 GAGCACGGCAATGTGGGGCAGGG + Exonic
901161284 1:7178070-7178092 AGGCAGGTCAATGTGTGGGAGGG - Intronic
902668059 1:17953231-17953253 AAGCAGGTGCCGGTGGGGCAGGG + Intergenic
903187070 1:21634745-21634767 CAGCAGGTAAATGGGTGGCCTGG - Intronic
903644865 1:24888859-24888881 ACGTAGGTAAATGTGTGCCATGG + Intergenic
904296613 1:29523458-29523480 GAGCAGGAGAATGGGGGGCAAGG + Intergenic
906087569 1:43148879-43148901 AAGCAGGAACAAGTGGGTCAGGG - Intronic
906128561 1:43442363-43442385 AAGAAGGTAAATATGGGGCCAGG + Exonic
906176495 1:43778359-43778381 AAAGAGGTAAATGTGTGCCATGG - Intronic
906705693 1:47893570-47893592 AAGCATTGAAATGTGAGGCAAGG - Intronic
906770077 1:48475761-48475783 AAGAAGGGAAATGTGGGGTTGGG + Intergenic
907250070 1:53132198-53132220 TTGAAGGTAAATGAGGGGCAGGG + Intronic
907861522 1:58358179-58358201 GAGCAGGAAAATGTGGGGATAGG + Intronic
909000661 1:70213594-70213616 AAGCAGGTAATAGTAGAGCAGGG - Intronic
909461233 1:75916781-75916803 ACACAGGTAAATGTGTGCCATGG - Intergenic
910307855 1:85787258-85787280 ATGTAGGTAAATGTGTGCCATGG + Intronic
910600524 1:89027123-89027145 ACACAGGTAAATGTGTGCCATGG + Intergenic
910642528 1:89479375-89479397 ACACAGGTAAATGTGTGCCATGG - Intergenic
910764295 1:90765480-90765502 ACACAGGTAAATGTGTGCCATGG + Intergenic
910895587 1:92066221-92066243 AAGCAGTTGGATGTGGGGAAGGG + Intergenic
911570012 1:99509617-99509639 CATCAGGTTAAGGTGGGGCAGGG - Intergenic
912747085 1:112253915-112253937 AAGAAGGTAGATGTGGAGGAGGG + Intergenic
913089151 1:115464881-115464903 ACGTAGGTAAATGTGTGCCATGG - Intergenic
913167222 1:116199510-116199532 GAGCAGGTAAAGATGGGGAAGGG - Intergenic
914713959 1:150238876-150238898 AACCAAGTTAAGGTGGGGCACGG + Intergenic
915299776 1:154945316-154945338 ATGCAGGTAGAGGTAGGGCAGGG + Intronic
915488097 1:156236009-156236031 AAGGAGGGGAATGTGGGGTATGG + Intronic
915726514 1:158021948-158021970 AAAGAGGTAAATCTGGAGCAGGG + Intronic
916226406 1:162494049-162494071 AGGTAGGTAAATGTGTGCCATGG - Intergenic
916462940 1:165045771-165045793 AAGACGGTAAATGTGGCTCATGG + Intergenic
917594737 1:176517620-176517642 AAACAGGTGACTGTGAGGCAGGG + Intronic
918253750 1:182728933-182728955 ACACAGGTAAATGTGTGTCATGG - Intergenic
918256146 1:182749780-182749802 ACACAGGTAAATGTGTGCCATGG + Intergenic
918976212 1:191489819-191489841 ACACAGGTAAATGTGTGTCATGG + Intergenic
919734083 1:200934373-200934395 AAGAAGGTAAACTTGGGCCAGGG - Intergenic
919932307 1:202229309-202229331 AGGCAGGGAATAGTGGGGCAGGG - Intronic
920690976 1:208146065-208146087 AAGGAGAAAAAGGTGGGGCAGGG + Intronic
920786679 1:209049260-209049282 AACCAAATAAATGTGGGGAATGG - Intergenic
920828776 1:209447065-209447087 ACACAGGTAAATGTGTGCCATGG - Intergenic
921062031 1:211593334-211593356 AGGTAGGGAAATGTGGGGGATGG + Intergenic
921335898 1:214085917-214085939 AAGCAGTTAGATGTGGGGAGAGG - Intergenic
922237363 1:223732066-223732088 AAGGAGATAGGTGTGGGGCAGGG + Intronic
922644983 1:227276633-227276655 AAGGGGGGAAATGTGGGGAAAGG + Intronic
922919213 1:229287230-229287252 AAGAAAGTATATGTGAGGCATGG + Intronic
923636347 1:235701039-235701061 AAGCATTTAAATGGGGGTCAGGG + Intronic
924091208 1:240502919-240502941 AATAAGGTAACTGTGAGGCAAGG + Intronic
924667327 1:246086778-246086800 ATGTAGGTAAATGTGTGCCATGG + Intronic
924746994 1:246845026-246845048 AAGCAGAACAATGTGTGGCAGGG + Intronic
1063121700 10:3109327-3109349 AACCAGGTCCATGTGGGTCAGGG - Intronic
1063699216 10:8368488-8368510 ACACAGGTAAATGTGTGTCATGG - Intergenic
1063777422 10:9280081-9280103 ACACAGGTAAATGTGAGCCATGG + Intergenic
1064058795 10:12119763-12119785 ATGCAGGTAAATGTGTGCCACGG - Intronic
1064510038 10:16080269-16080291 ATATAGGTAAATGTGGGCCATGG + Intergenic
1065728482 10:28689566-28689588 AAGAATGTATATGTTGGGCAGGG + Intergenic
1065800788 10:29349961-29349983 GTGCAGGTAAATGTGTGCCATGG - Intergenic
1066546010 10:36501485-36501507 AAGCAGATATATAAGGGGCAAGG - Intergenic
1067058374 10:43065275-43065297 GGGCAGGTAAGGGTGGGGCAGGG - Intergenic
1068001404 10:51338348-51338370 ACGTAGGTAAATGTGTGCCATGG - Intronic
1068655739 10:59574563-59574585 AAGCAGGTCAGTGTGGGAGAGGG + Intergenic
1069131002 10:64702548-64702570 ACGTAGGTAAATGTGTGCCATGG - Intergenic
1070217784 10:74404664-74404686 AAGCAGCAAAATTTGGGGAATGG - Intronic
1070394335 10:75998915-75998937 AACCAGGGAACTGTGGGGCTGGG + Intronic
1070530293 10:77331093-77331115 TGGCAGGTACATGGGGGGCAGGG - Intronic
1070793154 10:79201687-79201709 AAGCAGGTGGGTGTGGGGCAAGG + Exonic
1070869358 10:79736609-79736631 ACGTAGGTAAATGTGTGCCACGG + Intergenic
1071066905 10:81646609-81646631 AAGTAGGTAGATGTGGGGATGGG - Intergenic
1071176646 10:82933960-82933982 AAGGAGGTAAATGGGGGTCTGGG + Intronic
1071636277 10:87258815-87258837 ACGTAGGTAAATGTGTGCCACGG + Intergenic
1071658964 10:87479136-87479158 ACGTAGGTAAATGTGTGCCACGG - Intergenic
1072224781 10:93358881-93358903 ACACAGGTAAATGTGTGCCATGG - Intronic
1072300907 10:94061089-94061111 GAGGAGGAAACTGTGGGGCAAGG + Intronic
1072657943 10:97343684-97343706 AAGAAAGAAAATGTGGGGCTAGG + Intergenic
1073874855 10:107910702-107910724 AAGCAGGCAAATGTTGGTAATGG - Intergenic
1074442051 10:113486605-113486627 ATGCAGGCAACTGTGGGGCTAGG - Intergenic
1074462520 10:113651389-113651411 ACGTAGGTAAATGTGTGCCATGG + Intronic
1076442266 10:130488106-130488128 AAGGGGGCAAATGAGGGGCAAGG - Intergenic
1076524634 10:131104248-131104270 AAGCAGGTAACTGGGTGGGAAGG - Exonic
1077428926 11:2505113-2505135 ACGTAGGTAAATGTGTGCCACGG + Intronic
1077460693 11:2707906-2707928 AAGAAGCCAAATGTGGGCCAAGG - Intronic
1078051678 11:7970508-7970530 AAGCAGTTGAGTTTGGGGCAAGG + Intronic
1078354712 11:10625180-10625202 ACAGAGGGAAATGTGGGGCAGGG - Intronic
1078549830 11:12272356-12272378 AAGCATGTAAGAGTGAGGCATGG - Intergenic
1080055242 11:27900133-27900155 ACACAGGTAAATGTGTGCCATGG - Intergenic
1080384267 11:31801433-31801455 AAGGAGACAAATGTGGAGCAGGG + Intronic
1080946717 11:36981986-36982008 CAGAAGGTAAATGTGGGGTGAGG - Intergenic
1081578243 11:44333179-44333201 ACACAGGTAAATGTGTGCCATGG + Intergenic
1082991027 11:59207252-59207274 AAGAAGGTATAGGTGGGGAAGGG + Exonic
1084149347 11:67280951-67280973 GAGCAGGTAAATATGTGGCAAGG + Intronic
1085016741 11:73178830-73178852 AAGGAGGTAGGTATGGGGCAAGG - Intergenic
1085624734 11:78063416-78063438 AAACAGCTTGATGTGGGGCAAGG - Intronic
1085695086 11:78697287-78697309 AAGCAGCAAGATGTGGTGCAGGG + Intronic
1085948736 11:81304154-81304176 AAATAGGTAAATGTGTGCCATGG + Intergenic
1086773349 11:90797080-90797102 AAGCAGTTAACAGTGGGGTAGGG - Intergenic
1086956918 11:92942853-92942875 AAGAAGGTAAATGTGGCAGATGG + Intergenic
1087122314 11:94588007-94588029 AAGTAGGTAAAAGTGTGCCATGG + Intronic
1087148890 11:94840044-94840066 AAGAAAATAAATTTGGGGCAGGG - Intronic
1087730870 11:101777331-101777353 ACGTAGGTAAATGTGTGCCATGG - Intronic
1087968242 11:104446693-104446715 AAATAGGTAAATGTGTGCCATGG + Intergenic
1088646856 11:111924358-111924380 AAACAGGTAACTTTGGGGCTGGG + Exonic
1089772797 11:120815470-120815492 AAGGAGGTGAGTGTGAGGCAGGG + Exonic
1090081745 11:123618278-123618300 AAACAGGCAAGTGTGGGGAAGGG - Intronic
1090407233 11:126483988-126484010 CAGCAGGTACATGTGGTGCCTGG + Intronic
1091231705 11:133991890-133991912 ACGCAGGTAAAGGTGTGCCATGG - Intergenic
1091386839 12:101292-101314 ATGTAGGTAGATGTGGGGCAGGG + Intronic
1091793830 12:3286257-3286279 GAGGAGGAAAGTGTGGGGCACGG - Exonic
1092074649 12:5663109-5663131 AGGCAGGCATGTGTGGGGCATGG - Intronic
1092548859 12:9475533-9475555 AAATAGGTAAATGTGTGCCATGG - Intergenic
1093628753 12:21383442-21383464 AGGCAGGTGAGTGTGGGGTATGG - Intronic
1094206494 12:27845644-27845666 ACGTAGGTAAATGTGTGCCACGG + Intergenic
1094207543 12:27856469-27856491 ACACAGGTAAATGTGTGCCATGG + Intergenic
1094504142 12:31046932-31046954 AAATAGGTAAATGTGTGCCATGG + Intergenic
1094560606 12:31549594-31549616 ACACAGGTAAATGTGTGCCATGG + Intronic
1096443287 12:51664777-51664799 ACATAGGTAAATGTGGGCCATGG + Intronic
1096559896 12:52428601-52428623 AAGCAGGTAAAGATTTGGCAGGG - Exonic
1096929368 12:55188650-55188672 AAACAGGTAAACGTGTGCCATGG - Intergenic
1097226952 12:57482797-57482819 AAGATGGTAAATATGGGGCCGGG + Intronic
1097495331 12:60324733-60324755 GAGGAGGTAAATGTGGGGAGTGG - Intergenic
1098454181 12:70653432-70653454 AAGCAGTTACATGTGGGGTGTGG + Intronic
1098507460 12:71270671-71270693 ACACAGGTAAATGTGTGCCATGG + Intronic
1099346413 12:81505713-81505735 AAGCTGGTACATGTGGCTCAGGG - Intronic
1100804730 12:98270459-98270481 ACGTAGGTAAATGTGTGCCATGG - Intergenic
1101075324 12:101123366-101123388 ACACAGGTAAATGTGTGCCACGG + Intronic
1103085874 12:118061372-118061394 AACCAGATAAAAATGGGGCAGGG + Intronic
1103160427 12:118724813-118724835 AAGGAGGTGACTGTGGGGCTGGG - Intergenic
1103342740 12:120229811-120229833 AAGCAGGTAAATGTGGGGCATGG + Intronic
1103905011 12:124322633-124322655 GGGCAGGTAAATGAGGGGGAGGG + Intergenic
1103932415 12:124457739-124457761 AAACAGGAACATGTGGCGCAGGG + Intronic
1104517862 12:129444510-129444532 ACGTAGGTAAATGTGTGCCATGG + Intronic
1104690375 12:130821154-130821176 AAGGAAGCAAATGTGAGGCAGGG + Intronic
1105959433 13:25316811-25316833 AAGCAGGAAGATGTGGGGAGGGG - Intronic
1108701869 13:52950612-52950634 AAACAGGAAAAGGAGGGGCATGG - Intergenic
1109635861 13:65115033-65115055 ACACAGGTAAATGTGTGTCATGG - Intergenic
1110063319 13:71068608-71068630 ACACAGGTAAATGTGTGCCATGG + Intergenic
1110478304 13:75943893-75943915 ACGTAGGTAAATGTGTGCCATGG - Intergenic
1112032832 13:95473319-95473341 ACACAGGTAAATGTGTGCCATGG - Intronic
1112048493 13:95621418-95621440 GAGCAGGTAGATTTGGGTCAGGG + Intronic
1112463898 13:99626280-99626302 GAGCAGGTAATTGTGGAGTATGG + Intronic
1112716674 13:102194328-102194350 ACACAGGTAAATGTGTGCCATGG + Intronic
1112861234 13:103831236-103831258 CAGAAGGGAAATGTGGGGTAGGG - Intergenic
1113485636 13:110650568-110650590 CAGCAGGTAACTGTGCAGCATGG + Intronic
1113887867 13:113670527-113670549 AAGCAGGTGAGAATGGGGCATGG - Intronic
1115059216 14:29169565-29169587 GAGCAGGTAAGCGTGGGGCCTGG - Intergenic
1115321853 14:32089283-32089305 AAGCAGGTATTTGTGGGAGAGGG + Intronic
1115529977 14:34318126-34318148 ATGCAGGTATATGTTGGGCTTGG - Intronic
1115731944 14:36279496-36279518 AAACAGTTAAAAGTGGTGCATGG - Intergenic
1115882473 14:37935226-37935248 ACACAGGTAAATGTGTGCCATGG + Intronic
1116041425 14:39690894-39690916 ACGTAGGTAAATGTGTGTCATGG + Intergenic
1116219610 14:42066387-42066409 ATGTAGGTAAATGTGTGCCATGG + Intergenic
1116229190 14:42194204-42194226 AATAAAGTTAATGTGGGGCATGG + Intergenic
1116355158 14:43919147-43919169 AAAAAGGTAAATGTGTGTCATGG + Intergenic
1116373212 14:44162640-44162662 GAGTGGGTAAACGTGGGGCAGGG - Intergenic
1116732530 14:48642524-48642546 AGGCAGGTAAATGAGGAGTATGG + Intergenic
1116911513 14:50471066-50471088 ACACAGGTAAATGTGTGCCATGG + Intronic
1117889548 14:60404246-60404268 ATGTAGGTAAATGTGTGCCATGG + Intronic
1118409129 14:65458371-65458393 AAGAGGGTAAAGGTTGGGCATGG + Intronic
1118593116 14:67416069-67416091 ACACAGGTAAATGTGTGCCATGG - Intergenic
1118736196 14:68703377-68703399 AGGCAGGTAAACATGGGGCAGGG - Intronic
1119201254 14:72754527-72754549 CTGCAGGTAAATGTGGCACATGG + Intronic
1119678363 14:76573282-76573304 AAGCAAGAAACTGTGGGGAATGG + Intergenic
1121011119 14:90520858-90520880 AAGGAGGTGAGGGTGGGGCAAGG - Intergenic
1121174070 14:91877387-91877409 AAGCAGGTAAGAGTGGGGCTGGG - Intronic
1121182864 14:91942580-91942602 ACATAGGTAAATGTGGGCCATGG - Intronic
1121430041 14:93880071-93880093 AAGCATTTAAATGTGCGGCTGGG - Intergenic
1122594717 14:102881678-102881700 ACACAGGTAAATGTGTGCCATGG - Intronic
1123102357 14:105813335-105813357 ACGCAGGTAAACGTGTGCCATGG + Intergenic
1126670247 15:51109792-51109814 AAGCAGGTAGATGGGAGTCAAGG + Intergenic
1126981007 15:54243031-54243053 ACACAGGTAAATGTGTGCCATGG + Intronic
1127070386 15:55282948-55282970 AAGTCAGTAAATGTGGGGTAGGG - Intronic
1127419441 15:58790810-58790832 AAGCAGGAAAAAATGGAGCAAGG + Intronic
1128098757 15:64980300-64980322 ATGCACGTAAATGCTGGGCATGG + Intronic
1128142142 15:65309766-65309788 AAGCAGGAAAATGAGGCGAAGGG + Intergenic
1128522847 15:68386902-68386924 AAGCAGGGAGAGGTGGGACAGGG + Intronic
1129693935 15:77730004-77730026 GAGCAGGTAAATGTGGGGGACGG - Intronic
1130399243 15:83533736-83533758 AAGGAGGGGAAAGTGGGGCAGGG + Intronic
1130739705 15:86585949-86585971 AAGCAGTGGAATGTGGAGCATGG - Intronic
1130784220 15:87077978-87078000 ACGTAGGTAAATGTGTGCCATGG + Intergenic
1130954739 15:88619721-88619743 TGGGAGGTAAATCTGGGGCAAGG - Intergenic
1131008696 15:88999559-88999581 AAGCAGTTGAGTTTGGGGCAAGG + Intergenic
1131622736 15:94084340-94084362 AAGCAGATGAAGGTGTGGCAGGG + Intergenic
1131859970 15:96642372-96642394 ACACAGGTAAATGTGTGCCATGG + Intergenic
1132288632 15:100684049-100684071 GTGCAGGTAAATGTGTGTCACGG + Intergenic
1132457840 16:33892-33914 AAGGGGGTCAAAGTGGGGCATGG + Intergenic
1132652593 16:1028390-1028412 AAGCAGGAGAGTGTGGGGCGTGG - Intergenic
1133563791 16:6973830-6973852 AAACAGGTAAACGTGTGCCATGG + Intronic
1135949335 16:26898634-26898656 ATGCAGCTAAATGTGTGCCATGG + Intergenic
1136999512 16:35216757-35216779 GAGCAGGTCACTGTGGGGAAGGG + Intergenic
1137003438 16:35251249-35251271 GAGCAGGTCACTGTGGGGAAGGG - Intergenic
1137345706 16:47656893-47656915 AACCAAGTATATTTGGGGCATGG - Intronic
1137392456 16:48092746-48092768 AAGCAGGTTGATGTGGGAGAGGG + Intronic
1138035335 16:53599607-53599629 AAGCTGGTATCTGTGTGGCAAGG + Intronic
1138424447 16:56921406-56921428 ACGTAGGTAAATGTGTGCCATGG - Intergenic
1138459719 16:57141063-57141085 AAGGGGAAAAATGTGGGGCAGGG + Intronic
1138546284 16:57721839-57721861 AAGGGTGGAAATGTGGGGCATGG - Intronic
1138948589 16:61882818-61882840 ACATAGGTAAATGTGTGGCATGG - Intronic
1138967335 16:62100417-62100439 AAGAAGGTATATATGGGGCAGGG + Intergenic
1139657447 16:68397603-68397625 GAGGAGGCAGATGTGGGGCATGG - Intronic
1140572448 16:76124053-76124075 ATGCAGGAAAATGTGGGCAAGGG + Intergenic
1141023664 16:80522515-80522537 ATGTAGGTAAATGTGTGTCATGG - Intergenic
1142943536 17:3404488-3404510 ACATAGGTAAATGTGGGCCATGG + Intergenic
1142946059 17:3428204-3428226 ACACAGGTAAATGTGTGCCATGG - Intergenic
1143387700 17:6541770-6541792 ATGCAGGGAAGTGTAGGGCAAGG - Intronic
1143645830 17:8229419-8229441 AGCCAGGTAGATGTGGGGCAGGG + Exonic
1143991853 17:10971394-10971416 ACACAGGTAAATGTGTGTCATGG - Intergenic
1144364127 17:14525739-14525761 AAGGAAGTCAATGTGGGGTAAGG - Intergenic
1144384376 17:14736084-14736106 ATGCAGGTAACTGAGGGGCCAGG - Intergenic
1145142612 17:20457327-20457349 AACTAGGTAAATGTGTGCCACGG + Intronic
1145275399 17:21426364-21426386 CAGCAGGGAAGTGTGGAGCAGGG - Intergenic
1145313251 17:21712258-21712280 CAGCAGGGAAGTGTGGAGCAGGG - Intergenic
1145833605 17:27937219-27937241 CACCAGGCACATGTGGGGCAAGG - Intergenic
1146676799 17:34779291-34779313 AAGCAGGGAAATGAGAGGCCTGG + Intergenic
1147298959 17:39508614-39508636 ACGTAGGTAAATGTGTGCCATGG - Intronic
1148744557 17:49911144-49911166 GAGAAGGGAAATGTGGAGCAGGG + Intergenic
1149337504 17:55651360-55651382 AAGCAGACAAATTTGAGGCATGG + Intergenic
1150246189 17:63677267-63677289 AAGGAGGTAAGTGAGGTGCACGG - Intronic
1151012531 17:70516978-70517000 ACACAGGTAAATGTGTGCCATGG - Intergenic
1151150472 17:72081343-72081365 ACATAGGTAAATGTGTGGCATGG - Intergenic
1151437413 17:74106465-74106487 ATGTAGGTAAATGTGTGCCATGG - Intergenic
1151680412 17:75620015-75620037 AAGAAGGTAAGTGTGGGGCACGG + Intergenic
1152883626 17:82834814-82834836 ACACAGGTAAATGTGTGCCATGG - Intronic
1153142737 18:1993461-1993483 TAGCAGAAAAGTGTGGGGCAGGG + Intergenic
1153749145 18:8211255-8211277 AAGGGGTGAAATGTGGGGCATGG + Intronic
1153754443 18:8265717-8265739 CAGAAGGCAAATGTGGGTCATGG + Intronic
1154198632 18:12284115-12284137 AAGTAGGAAAATGTGTTGCAAGG - Intergenic
1156241605 18:35259917-35259939 ACGTAGGTAAATGTGTGCCATGG + Intronic
1156321183 18:36024449-36024471 AAGCAGATAACTGTTGGGCCGGG - Intronic
1156859967 18:41824543-41824565 CAGCAGGTAAATGTTGGGAGGGG - Intergenic
1157048004 18:44125764-44125786 GAGGAGGTGGATGTGGGGCACGG + Intergenic
1157251397 18:46099033-46099055 ACACAGGTAAATGTGTGCCATGG - Intronic
1158087402 18:53668414-53668436 AAACGGGTAAATGTGTGCCATGG - Intergenic
1158668202 18:59451747-59451769 ACACAGGTAAATGTGTGCCATGG - Intronic
1159190305 18:65033036-65033058 ACACAGGTAAATGTGTGCCATGG + Intergenic
1159812953 18:73038905-73038927 ACACAGGTAAATGTGTGCCATGG + Intergenic
1160011732 18:75111237-75111259 AAGCTGGTAAAGGTGCGGCTGGG + Intergenic
1160081734 18:75734294-75734316 ACACAGGTAAATGTGTGTCACGG + Intergenic
1160425043 18:78773656-78773678 AAGGAGGTAAATTTGGAGCTGGG - Intergenic
1161585619 19:5103877-5103899 AAGGAGGTGAAGATGGGGCACGG + Intronic
1161760293 19:6166213-6166235 AAGCAGAAAAATGTCTGGCAGGG + Intronic
1162405079 19:10468492-10468514 AAGCAGCTAGAAGTGGGGCGGGG - Exonic
1163045316 19:14637262-14637284 AGGCTGGAAAATGTGGGTCAGGG - Intronic
1163067189 19:14806433-14806455 ACACAGGTAAATGTGTGCCATGG + Intronic
1163227314 19:15973398-15973420 ACACAGGTAAATGTGTGTCATGG + Intergenic
1164921450 19:32091531-32091553 AACCAGGTAAATGATGGGGAGGG + Intergenic
1165044196 19:33091689-33091711 ACACAGGTAAATGTGTGTCATGG - Intronic
1165647729 19:37457368-37457390 AAGCCAGTAAATTTTGGGCAAGG - Intronic
1167608099 19:50492513-50492535 AATCAGGAAAAGGTGGGGCTGGG + Intergenic
1168435248 19:56311721-56311743 ACACAGGTAAATGTGTGCCATGG + Intronic
925219570 2:2127133-2127155 ACGCAGGTAAACTTGGGCCATGG + Intronic
926483717 2:13429973-13429995 ACACAGGTAAATGTGTGCCATGG - Intergenic
926499878 2:13641140-13641162 CAGCAGGCCAAGGTGGGGCAAGG - Intergenic
926563762 2:14446351-14446373 AAGAAGGAGAAAGTGGGGCAAGG + Intergenic
926764523 2:16312628-16312650 AAGCAGGGGAAAGTGGGTCATGG + Intergenic
928115940 2:28545288-28545310 CAGCAGGGACATGGGGGGCAGGG + Intronic
930146483 2:48012158-48012180 AAGCATATAAATGTGTGGAAGGG - Intergenic
930249632 2:49021033-49021055 AAATAGGTAAATGTGTGTCATGG - Intronic
931209592 2:60179790-60179812 AAGAAGGTATCTGTGTGGCAAGG + Intergenic
931252514 2:60545954-60545976 TAGCAGGTAAATGAGAAGCAAGG - Exonic
933550018 2:83764734-83764756 ACACAGGTAAATGTGTGCCATGG + Intergenic
933821742 2:86118868-86118890 AAACAGGTAAAGGTGAGGGAAGG - Intronic
934934188 2:98452641-98452663 AAGCTGGCGAATGGGGGGCAGGG - Intronic
935338873 2:102042066-102042088 AAGGAGGTGAATCTGGGGTAAGG + Intergenic
935491645 2:103728412-103728434 ATGTAGGTAAATGTGTGCCACGG + Intergenic
935821622 2:106898598-106898620 ACACAGGTAAATGTGTGCCATGG + Intergenic
936487123 2:112935457-112935479 AAATAGGTATATGTGGGCCATGG - Intergenic
936494104 2:113002890-113002912 AAACAGGTCAATCTGGGGCTTGG + Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
936854340 2:116938356-116938378 ACACAGGCAAATGTGGGCCATGG + Intergenic
938773356 2:134519939-134519961 GAGCAGATGAATGTGGGGGAGGG + Intronic
938921178 2:135996508-135996530 GAGCAGGTGAACGTGGTGCAAGG - Intergenic
938996303 2:136682463-136682485 AAATAGGTAAATGTGTGTCATGG - Intergenic
939267276 2:139890497-139890519 AAGAATGTAAATGTGGGCCTGGG - Intergenic
940545517 2:155078634-155078656 ACACAGGTAAATGTGTGCCATGG - Intergenic
940767762 2:157808383-157808405 TAGCAAGGAAATGGGGGGCAGGG + Intronic
940801506 2:158137800-158137822 AAGGAGGTGAATTTGGGGCTTGG - Intergenic
940962023 2:159797197-159797219 ACGCAGTGAAATCTGGGGCAAGG + Intronic
941203344 2:162541784-162541806 ACACAGGTAAATGTGTGCCATGG - Intronic
942295978 2:174517632-174517654 AAACAGGTGGCTGTGGGGCATGG - Intergenic
942662569 2:178281893-178281915 ACACAGGTAAATGTGTGCCACGG - Intronic
942677321 2:178441456-178441478 AAGCAGCTAAAAATGGGGTAGGG + Intronic
942883923 2:180899176-180899198 AACCAGATAAATGTGGAGCAGGG + Intergenic
943337117 2:186629490-186629512 GAGTGGGAAAATGTGGGGCAGGG - Intronic
943537549 2:189171380-189171402 AAGCAGATACATGAGAGGCAAGG + Intronic
945139813 2:206672978-206673000 ACGTAGGTAAATGTGTGTCATGG + Intronic
945808578 2:214520212-214520234 AAGCAAGTATATATGGGGAATGG - Intronic
945913712 2:215680413-215680435 ACGTAGGTAAACGTGGGGCATGG - Intergenic
947081998 2:226409478-226409500 GAGAAGGTAAAGGTGGGGCTGGG - Intergenic
947095959 2:226567206-226567228 AATCAGGAATATGTGGAGCATGG + Intergenic
947471812 2:230407933-230407955 ACACAGGTAAATGTGTGCCATGG - Intergenic
948039379 2:234887426-234887448 CCGCAGATAAAAGTGGGGCAAGG - Intergenic
948726391 2:239936574-239936596 AAGGATGCAAGTGTGGGGCAGGG + Intronic
1169608468 20:7350943-7350965 CAGCAGATAAGTGTGGGGAAAGG + Intergenic
1169841921 20:9948018-9948040 CAGGAGGTAAATCTGGGCCAGGG + Intergenic
1169985623 20:11440763-11440785 AAGCATGTGAATTTAGGGCATGG + Intergenic
1171964304 20:31517634-31517656 GAGCAGGAGAAGGTGGGGCAGGG + Intronic
1172516042 20:35534272-35534294 ACGTAGGTAAATGTGTGCCATGG + Intergenic
1172601212 20:36184530-36184552 AAGCAGGTTCATCTGGGACATGG + Intronic
1172741766 20:37174253-37174275 AAGAAGGTAACTGTGGGGCCAGG - Intronic
1173452092 20:43173753-43173775 AAGCAGGTAATTCTGAGGGAAGG - Intronic
1173884308 20:46443953-46443975 AAGGAGTTAGATGTGGGGCAGGG - Intergenic
1174708668 20:52682844-52682866 AAGCAGTTGCAGGTGGGGCATGG + Intergenic
1174973362 20:55303747-55303769 ACACAGGTAAATGTGTGCCATGG + Intergenic
1175410328 20:58763397-58763419 CAGCAGCTCAATGTGGTGCATGG + Intergenic
1175520538 20:59599902-59599924 GAGAAGGGACATGTGGGGCAAGG - Intronic
1176667254 21:9699086-9699108 AAGCTGGAAAGTGTGGGGCTGGG - Intergenic
1177267769 21:18806709-18806731 AAGAAGGCAACTGTGGGGCAAGG - Intergenic
1177752170 21:25298014-25298036 ACGCAGGTAAACATGTGGCATGG - Intergenic
1179071409 21:38074769-38074791 ACGTAGGTAAATGTGTGCCATGG - Intronic
1179575640 21:42306736-42306758 ACGCAGGTAAACCTGTGGCAGGG + Intergenic
1180616949 22:17134629-17134651 CAGCAAGTATATGTGGGTCATGG + Intergenic
1180862553 22:19094135-19094157 AAGCATGAAAAGGTGGGGCACGG + Intronic
1181149119 22:20870138-20870160 AAGCAAGTAGAGGTAGGGCAGGG + Intronic
1181759897 22:25051095-25051117 AAGCAGGCAAGAGTGGGGCAGGG - Intronic
1182262287 22:29082563-29082585 AAGCTGGTGAATGAGGGGCTAGG - Intronic
1182387807 22:29961179-29961201 AAGCATATAAATTTGGGGGAAGG - Intronic
1183122266 22:35739175-35739197 AAACAGGTACCTTTGGGGCATGG - Intronic
1184158959 22:42686743-42686765 AGGCAGCTGAATGAGGGGCATGG - Intergenic
1184403269 22:44286136-44286158 ATGTAGGCAAAGGTGGGGCAGGG - Intronic
1185040049 22:48499294-48499316 AAGCAGGAAGATGAGGGGAAAGG - Intronic
1185168540 22:49277262-49277284 ACACAGGTAAATGTGTGCCATGG + Intergenic
949319412 3:2792020-2792042 ACACAGGTAAATGTGTGCCACGG - Intronic
950373711 3:12552699-12552721 AAAGATTTAAATGTGGGGCATGG - Intronic
951165143 3:19476544-19476566 AAGCGGGTCACTGGGGGGCATGG + Intronic
951628074 3:24688588-24688610 ATACAGCTAAATGAGGGGCAGGG + Intergenic
951648477 3:24921043-24921065 AAGCAGGTAAAAGCAGGTCAAGG + Intergenic
953198706 3:40757191-40757213 AAACTGGAAAATGTGGGGCTTGG - Intergenic
953548229 3:43880377-43880399 AAGCTGTGAAATGTGAGGCAGGG - Intergenic
957111883 3:75972390-75972412 AAGAAGGGAACAGTGGGGCAGGG + Intronic
957184078 3:76919127-76919149 ACACAGGTAAATGTGTGCCATGG - Intronic
958677368 3:97282927-97282949 ACACAGGTAAATGTGTGTCATGG - Intronic
958836259 3:99148419-99148441 AAGAAGGGAAATGTGGGGTTGGG + Intergenic
959221409 3:103525414-103525436 AAGCAGGCAAATTTTGAGCATGG - Intergenic
959299408 3:104578670-104578692 CAGCAGGGAAATGTGGGGGTTGG - Intergenic
959360831 3:105389635-105389657 AAATAGGTAAATGTGTGGCATGG + Intronic
959712977 3:109403242-109403264 AATCAGGTTTACGTGGGGCAAGG - Intergenic
959831026 3:110862557-110862579 TAGCAGGGCACTGTGGGGCATGG - Intergenic
960297202 3:115958892-115958914 AAGCCGGTAGACGTGGGGCCAGG + Intronic
960375012 3:116890109-116890131 AAGCAAGTAAAGTGGGGGCATGG - Intronic
962649165 3:137471318-137471340 AAGCAGGCAAGTGTGGGACAGGG - Intergenic
962989945 3:140568849-140568871 TAGCAGGTAAAGGTGGCCCATGG + Exonic
964912628 3:161801010-161801032 AAGAAGGGAAATGTGGGGTGGGG - Intergenic
965078354 3:164005676-164005698 ATATAGGTAAATGTGTGGCATGG - Intergenic
965187951 3:165489184-165489206 AAGAAGGGCAATGTGGGGCCGGG - Intergenic
965240321 3:166188731-166188753 AAATAGGTAAATGTATGGCATGG - Intergenic
965961289 3:174431319-174431341 GTGTAGGTAGATGTGGGGCATGG - Intergenic
967336523 3:188350446-188350468 AAGCAGGCAAATATCAGGCATGG + Intronic
969176192 4:5400717-5400739 GAGCAGGTAAAGGAGGGCCATGG - Intronic
970157591 4:13157154-13157176 AAATAGGTAAATGTGTGCCATGG + Intergenic
970212250 4:13721735-13721757 ATACAGGTAAATGTGTGCCATGG - Intergenic
970321154 4:14876875-14876897 ACACAGGTAAATGTGTGTCATGG - Intergenic
970626294 4:17887785-17887807 AAGGAGCTAAAGGTGGAGCAGGG + Intronic
970882776 4:20951135-20951157 ATGCATGTATAGGTGGGGCAGGG - Intronic
970902470 4:21175720-21175742 AAGCAGGAAAGAGTGGGCCAGGG + Intronic
972721679 4:41705705-41705727 ACACAGGTAAATGTGTGCCATGG - Intergenic
972843611 4:42960896-42960918 ATGTAGGTAAATGTGTGCCATGG + Intronic
972861397 4:43173332-43173354 ACGTAGGTAAATGTGTGGCATGG - Intergenic
973229404 4:47824610-47824632 AAGAAGGTGAACCTGGGGCATGG - Intronic
974157939 4:58098959-58098981 ACCCAGGAAAATGTGGGGCCAGG + Intergenic
974485114 4:62494460-62494482 CAGAAGGTAAATGTGGGGTAGGG + Intergenic
974673331 4:65058720-65058742 AAGCAGGCAAGTGTGGGACCTGG - Intergenic
974803822 4:66854868-66854890 ACGCAGGGAATAGTGGGGCAGGG - Intergenic
975475722 4:74821209-74821231 AAGGAGTTAGATGTGGGGCAAGG + Intergenic
975495722 4:75034241-75034263 AATGAGGTACATTTGGGGCAGGG - Intronic
976316715 4:83666556-83666578 GAGCAGGTAAAAGTGGTTCAGGG + Intergenic
976687062 4:87825749-87825771 ACGCAGGTAAATGTGTGTCATGG + Intronic
977193002 4:94023631-94023653 ACACAGGTAAATGTGTGCCATGG - Intergenic
977578317 4:98698241-98698263 ACATAGGTAAATGTGGGCCATGG + Intergenic
979788074 4:124741969-124741991 AGGCAGGGAAGTGAGGGGCATGG + Intergenic
979791929 4:124794535-124794557 ACGCAGGTAAATATGTGCCATGG - Intergenic
979929102 4:126608015-126608037 ATACAGGTAAATGTAGGCCAGGG - Intergenic
980075357 4:128288007-128288029 GAGCAGGGAAGTGTGGGGCGAGG - Exonic
980148322 4:129016223-129016245 ACACAGGTAAATGTGTGCCATGG + Intronic
980183416 4:129430732-129430754 AAATAGGAAAATGTGAGGCAGGG - Intergenic
980191488 4:129530450-129530472 AAGCAGGTTTTTGTGGGACAAGG - Intergenic
980664050 4:135905350-135905372 ATGTAGGTAAATGTGTGTCATGG + Intergenic
982533497 4:156578263-156578285 AAAAAAGTAAATGTGGGACACGG - Intergenic
984202317 4:176739689-176739711 ACGTAGGTAAATGTGTGCCATGG - Intronic
985407755 4:189653248-189653270 AAGCTGGAAAGTGTGGGGCTGGG + Intergenic
986182835 5:5409563-5409585 GAGCAGGTGGATGTGGGGCAGGG - Intergenic
986642224 5:9883316-9883338 ACACAGGTAAATGTGTGCCATGG - Intergenic
986673334 5:10162524-10162546 CAGCAGCTAAATGTGGAACAAGG + Intergenic
986793659 5:11188548-11188570 AAACAGGTAAATGTGTGCCATGG - Intronic
986844058 5:11732800-11732822 GAGCAGGTAAAAGGAGGGCAGGG - Intronic
987189213 5:15456850-15456872 ACACAGGTAAATGTGTGCCATGG + Intergenic
987230511 5:15889076-15889098 AAGCAGAAAAAAGTGGGGCGGGG + Intronic
987404648 5:17512400-17512422 AAGCTGGTAAGTATGGGGCTGGG - Intergenic
987457147 5:18162070-18162092 ACATAGGTAAATGTGTGGCATGG + Intergenic
988920922 5:35941605-35941627 ACACAGGTAAATGTGTGCCATGG - Intergenic
990159604 5:52923112-52923134 AAGGAGTTAGATGTGGGGCAGGG + Intronic
991172083 5:63639807-63639829 ATACAGGTAAATGTGTGCCATGG - Intergenic
991373541 5:65941639-65941661 AAACATGTAAATGTGTGACAAGG + Intronic
992652531 5:78874089-78874111 AAGCAAGAAAGTGTGGGACAAGG + Intronic
993810595 5:92470964-92470986 GGGCAGGTAGAAGTGGGGCAGGG + Intergenic
994028924 5:95118115-95118137 ACACAGGTAAATGTGTGCCATGG - Intronic
995175309 5:109169544-109169566 AAGAATGTAAATGGGAGGCAAGG + Intronic
995335422 5:110992985-110993007 ACGCAGGTAAACGTGTGCCATGG - Intergenic
995907978 5:117149492-117149514 AAGCAGGGAGGGGTGGGGCAAGG - Intergenic
995931875 5:117455692-117455714 AAGCAGGAAACTCTTGGGCACGG + Intergenic
996064102 5:119062903-119062925 AAGTAGGTAGAGGTTGGGCATGG + Intronic
996578795 5:125006913-125006935 AAGGAAGTGAATTTGGGGCATGG - Intergenic
996801456 5:127408066-127408088 AGAAAGGTAAATGTGGGTCAAGG + Intronic
997531685 5:134585313-134585335 CAGCTGATAAATGTAGGGCAGGG + Intergenic
998359706 5:141574079-141574101 CACCAGGTAAAGGAGGGGCAGGG + Exonic
998840611 5:146249851-146249873 ACGTAGGTAAATGTGTGCCATGG + Intronic
999939257 5:156522676-156522698 AAGTAGGTAAATGTGTGCCATGG - Intronic
1000405985 5:160889046-160889068 AAGCATGTAAATGATGGGCTTGG - Intergenic
1000472132 5:161656593-161656615 ACACAGGTAAATGTGTGCCATGG - Intronic
1000557058 5:162739235-162739257 ACGTAGGTAAATGTGTGCCATGG + Intergenic
1002128931 5:177067517-177067539 AAGCAAGGAAATGAAGGGCAGGG + Intronic
1002804209 6:556645-556667 AATCTGGAAAATGTGGGGCTTGG - Intronic
1003892449 6:10575661-10575683 CATCAGTTAAAGGTGGGGCAAGG - Intronic
1004150398 6:13114111-13114133 AGGCTGGGAAATGGGGGGCAGGG - Intronic
1004239807 6:13910367-13910389 ACACAGGTAAATGTGTGCCATGG - Intergenic
1004800850 6:19145526-19145548 AAGCAGGTCAGTGTGGGAGAGGG - Intergenic
1005151789 6:22760072-22760094 ACGTAGGTAAATGTGTGCCATGG + Intergenic
1005400435 6:25427230-25427252 ACCCAGGTAAATGTGTGCCATGG + Intronic
1005924264 6:30428985-30429007 ACGTAGGTAAATGTGTGCCATGG - Intergenic
1006623127 6:35381071-35381093 GAGCAGGAAAATGAGGTGCACGG - Intronic
1007446996 6:41914422-41914444 AAACAGGTACATGAGTGGCATGG + Intronic
1007617932 6:43193072-43193094 GAGCAGGTAAAGGAGGCGCAGGG - Exonic
1008376752 6:50800980-50801002 ACATAGGTAAATGTGGGCCATGG + Intergenic
1008819756 6:55617091-55617113 ACACAGGTAAATGTGTGCCATGG + Intergenic
1011727543 6:90225705-90225727 ACATAGGTAAATGTGTGGCATGG - Intronic
1011750093 6:90446914-90446936 AAGGAAGAAAATGTGGGCCAAGG + Intergenic
1013426351 6:110016312-110016334 AAGCAGGTGAGAGTGGAGCAAGG - Intergenic
1013484265 6:110580885-110580907 AAGTAGGTAAACGTGTGCCATGG - Intergenic
1014326590 6:120003995-120004017 AAATAGGTAAATGTGGTTCATGG - Intergenic
1014580023 6:123125886-123125908 ACACAGGTAAATGTGTGCCATGG + Intergenic
1016274275 6:142330285-142330307 ACACAGGTAAATTTGGGTCACGG - Intronic
1016847278 6:148580967-148580989 ACACAGGTAAATGTGTGCCATGG + Intergenic
1017088840 6:150740369-150740391 AAGCAGGTAAGGCTGGGCCAGGG - Intronic
1017235071 6:152110623-152110645 ATGTAGGTAAATGTGTGTCATGG - Intronic
1018963423 6:168465040-168465062 AAGAAGGTCTGTGTGGGGCAAGG - Intronic
1020033595 7:4950391-4950413 AAGAAGGTGAATGTGGGGCTGGG - Intronic
1020545473 7:9523875-9523897 ACGTAGGTAAACGTGGGCCATGG + Intergenic
1020712346 7:11623599-11623621 AAGTAAGTAAATGTGGGGGTGGG + Intronic
1021072427 7:16257281-16257303 AAGCAAGTAAATGTGGAGAGAGG + Intronic
1021869196 7:24986852-24986874 AAGCAGATCAATGTGGAGAAAGG - Intergenic
1022234981 7:28452686-28452708 AAGCAGCAAGGTGTGGGGCAGGG + Intronic
1023971209 7:44992490-44992512 AAGTGGGGAAATGTGGGGAAAGG - Intergenic
1024202649 7:47122382-47122404 CAGCAGGGACATTTGGGGCAGGG - Intergenic
1024974529 7:55100960-55100982 CACCAGGTAAAGGTGAGGCAGGG - Intronic
1025606744 7:63044862-63044884 TAGTAGGTACCTGTGGGGCATGG + Intergenic
1025754473 7:64323822-64323844 ACACAGGTAAATGTGTGTCATGG - Intronic
1025800968 7:64785261-64785283 AAGGGGGGAAATGTGGGGAAGGG + Intergenic
1026320725 7:69265719-69265741 GAGCAGGTAAGGGTGGGGCAGGG - Intergenic
1027544548 7:79510917-79510939 ACACAGGTAAATGTGTGCCATGG + Intergenic
1028809054 7:95062759-95062781 AAGCAGAAAAAAGTGGGGCAGGG - Intronic
1030511630 7:110489927-110489949 ACACAGGTAAATGTGTGCCATGG - Intergenic
1031201903 7:118699139-118699161 AAGCAGGTAAATGTGGTCTTAGG - Intergenic
1031226348 7:119042468-119042490 ACACAGGTAAATGTGTGCCATGG - Intergenic
1031410660 7:121436993-121437015 TACCAGGAACATGTGGGGCAAGG + Intergenic
1032750051 7:134830456-134830478 ACACAGGTAAATGTGTGTCACGG + Intronic
1033798601 7:144875740-144875762 ACACAGGTAAATGTGTGTCATGG + Intergenic
1035713514 8:1736935-1736957 AAACAGGTATATGTGGCTCATGG + Intergenic
1035856004 8:2977160-2977182 ACGCAGGGAAATGTGTGCCATGG + Intronic
1035910875 8:3565018-3565040 ACACAGGTAAATGTGTGCCATGG - Intronic
1036778186 8:11628106-11628128 CAGTAGGTACCTGTGGGGCATGG - Intergenic
1036932674 8:12971659-12971681 AAACAAGAAAATGGGGGGCAGGG + Intronic
1037115427 8:15220450-15220472 AAGCAGTTAGAAATGGGGCAAGG - Intronic
1037443379 8:18940309-18940331 GAGCAGGTTAAGGTGGGGCCTGG + Intronic
1037965906 8:23134104-23134126 AAGTAGGAAAATGTGTAGCAAGG - Intergenic
1038379497 8:27079309-27079331 AAGAAGGTGGAGGTGGGGCAGGG - Intergenic
1038442890 8:27584146-27584168 CAGCAGGTAAGTGAGGGGCGAGG - Intergenic
1038678248 8:29643276-29643298 ACACAGGTAAATGTGTGCCACGG + Intergenic
1040519356 8:48161736-48161758 AAATAGGTAAATGTGTGCCATGG + Intergenic
1040912392 8:52532443-52532465 AAGCCAGAAAATGTGGGGAAAGG + Intergenic
1041116443 8:54542401-54542423 ACACAGGTAAATGTGTGCCATGG + Intergenic
1041605433 8:59777647-59777669 AATCAGAAAAATGGGGGGCAGGG + Intergenic
1042436418 8:68771565-68771587 AAGAAGGAAAATTTGGGGTAAGG - Intronic
1042682490 8:71401225-71401247 ACACAGGTAAATGTGTGCCATGG - Intergenic
1042936324 8:74062290-74062312 ACACAGGTAAATGTGTGCCATGG + Intergenic
1043732547 8:83701732-83701754 ACACAGGTAAATGTGTGCCATGG - Intergenic
1043859591 8:85300385-85300407 ACACAGGTAAATGTGTGCCATGG - Intergenic
1044204632 8:89478533-89478555 AAGAAGGAAAATGTGGGAGAAGG + Intergenic
1044447019 8:92290796-92290818 ACACAGGTAAATGTGTGCCATGG + Intergenic
1045195962 8:99930818-99930840 AAGCAGATATATGTGTGCCATGG + Intergenic
1045264970 8:100611321-100611343 AAGCAGGTAATGGTGGGAAATGG - Intronic
1045716683 8:105055343-105055365 ACAGAGGTAAATGTGGGTCATGG + Intronic
1045978403 8:108155410-108155432 ACACAGGTAAATGTGTGCCATGG - Intergenic
1046499067 8:115052417-115052439 AAACAGGTAAACGTGTGTCATGG - Intergenic
1046836637 8:118809121-118809143 AAGGTGGAAAATGTGGGGGATGG - Intergenic
1046890227 8:119414750-119414772 ACACAGGTAAATGTGTGTCATGG + Intergenic
1046983641 8:120363516-120363538 ACACAGGTAAATGTGTGCCATGG - Intronic
1047899264 8:129402199-129402221 ACACAGGTAAATGTGTGCCATGG - Intergenic
1048064045 8:130949719-130949741 AAGGAGGAAAACCTGGGGCAAGG - Intronic
1048248138 8:132831744-132831766 ACACAGGTAAATGTGTGCCATGG + Intronic
1048948197 8:139470299-139470321 AATCAAATAAATGTGGAGCAAGG - Intergenic
1048983854 8:139719648-139719670 AAGCAAGTAGATGTTAGGCAAGG + Intergenic
1049354895 8:142182693-142182715 TAGCAGGGGAGTGTGGGGCAAGG + Intergenic
1049474420 8:142790168-142790190 AAGCAGGTGGGTGTCGGGCAAGG + Intergenic
1050043699 9:1521578-1521600 ATGCAGGCTACTGTGGGGCATGG + Intergenic
1050080274 9:1908595-1908617 ACACAGGTAAACGTGGGCCATGG - Intergenic
1051488508 9:17635031-17635053 ATGTAGGTAAATGTGTGTCATGG + Intronic
1052200296 9:25769974-25769996 ATGTAGGTAAATGTGTGCCATGG - Intergenic
1052212848 9:25927874-25927896 AAGGAGAGAAATGTGGGACAAGG + Intergenic
1052236830 9:26220798-26220820 AATTTGGTAAATATGGGGCAGGG - Intergenic
1053073648 9:35115542-35115564 GAGGAGGTACATGAGGGGCAGGG - Intronic
1054974401 9:71125257-71125279 ACACAGGTAAATGTGTGCCATGG + Intronic
1055294449 9:74820060-74820082 ACACAGGTAAATGTGTGCCATGG + Intronic
1055638890 9:78304047-78304069 AACCAGGTGGATGTTGGGCAGGG - Intronic
1055737815 9:79351278-79351300 ACACAGGTAAACGTGTGGCATGG + Intergenic
1055998862 9:82193248-82193270 AAGCAGTTGAGTTTGGGGCAAGG - Intergenic
1056166945 9:83948651-83948673 AAGGGGGGAAATGTGGGGAAAGG + Intronic
1056290457 9:85138131-85138153 AATTAAGTAAATGTGGGGCTTGG - Intergenic
1056472262 9:86917593-86917615 AAGCAGAAAAATGTGGTGCCAGG + Intergenic
1057747298 9:97762418-97762440 AAGGAGGTAACTGGGGGCCAAGG + Intergenic
1060231197 9:121826877-121826899 GAGCAGGGACCTGTGGGGCAGGG + Intronic
1060355173 9:122899967-122899989 AAGCACATAAGTGTGGGGCTTGG + Intronic
1060567708 9:124608195-124608217 ACACAGGTAAATGTGTGCCATGG + Intronic
1062387704 9:136319737-136319759 ACACAGGTAAATGTGTGCCATGG + Intergenic
1203658843 Un_KI270753v1:22674-22696 AAGCTGGAAAGTGTGGGGCTGGG + Intergenic
1185885024 X:3774914-3774936 AAGAAGTCAAAGGTGGGGCACGG + Intergenic
1186301055 X:8200308-8200330 AAGTAGGTAAACGTGTGCCATGG + Intergenic
1186708998 X:12173293-12173315 CAGCAGATACATTTGGGGCATGG + Intronic
1187225469 X:17372220-17372242 AAGAATGTAACTGTGGGGCGTGG + Intergenic
1187414849 X:19084406-19084428 ACACAGGTAAATGTGTGCCATGG - Intronic
1188270089 X:28128440-28128462 ACACAGGTAAATGTGTGCCATGG + Intergenic
1188645381 X:32560493-32560515 ATGGAGGTAAATGTGTGCCACGG + Intronic
1189125470 X:38441285-38441307 AAGCAGTGAAATGTGGTTCATGG + Intronic
1189521387 X:41772411-41772433 AAACTGGTAAATGTCTGGCAAGG + Intronic
1189651405 X:43193575-43193597 AAGCAGTTAAATGAGGCACAAGG - Intergenic
1189825163 X:44910935-44910957 AAAGGGGTAAATGTGGGGAAAGG - Intronic
1190539197 X:51459683-51459705 AAGCAGCTAAATCAGAGGCAAGG + Intergenic
1190586036 X:51943313-51943335 ACGTAGGTAAATGTGTGCCATGG - Intergenic
1190912136 X:54782509-54782531 ATATAGGTAAATGTGGGTCATGG - Intronic
1191866276 X:65706395-65706417 AGGCAAGTATAAGTGGGGCAGGG - Intronic
1193094682 X:77533721-77533743 ATGCAGGTAAATGTGTGCCATGG - Intronic
1193251244 X:79292879-79292901 ACACAGGTAAATGTGTGCCATGG - Intergenic
1193314614 X:80049597-80049619 ACACAGGTAAATGTGTGCCATGG + Intergenic
1193889946 X:87033088-87033110 AAGGGGGGAAATGTGGGGAAAGG - Intergenic
1194889372 X:99358297-99358319 ACACAGGTAAATGTGTGTCATGG - Intergenic
1196231581 X:113229928-113229950 ACACAGGTAAATGTGTGTCATGG + Intergenic
1197736324 X:129851527-129851549 AAGGAGGTAAAGGCGGGGAAAGG + Intergenic
1197905424 X:131419791-131419813 ACACAGGTAAATGTGTGCCATGG - Intergenic
1198195298 X:134354683-134354705 ACACAGGTAAATGTGTGTCATGG + Intergenic
1198992630 X:142532895-142532917 AAGCAGGAAAATGTAGGTAAGGG - Intergenic
1199718796 X:150526979-150527001 AGGGAGGGAAATGTGGGTCAAGG + Intergenic
1200384677 X:155878854-155878876 ATACAGGTAAATGTGTGCCATGG - Intergenic
1200784225 Y:7245313-7245335 AGTCAGGAACATGTGGGGCATGG - Intergenic
1201352186 Y:13055906-13055928 ATGTAGGTAAATGTGTGCCATGG + Intergenic