ID: 1103347261

View in Genome Browser
Species Human (GRCh38)
Location 12:120259602-120259624
Sequence GGCCTTGGATGCTGGGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 326}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103347261_1103347270 9 Left 1103347261 12:120259602-120259624 CCACTGGCCCAGCATCCAAGGCC 0: 1
1: 0
2: 3
3: 32
4: 326
Right 1103347270 12:120259634-120259656 AGGCCAGCCCTGAGCACCACTGG 0: 1
1: 0
2: 2
3: 38
4: 297
1103347261_1103347272 14 Left 1103347261 12:120259602-120259624 CCACTGGCCCAGCATCCAAGGCC 0: 1
1: 0
2: 3
3: 32
4: 326
Right 1103347272 12:120259639-120259661 AGCCCTGAGCACCACTGGTTAGG 0: 1
1: 0
2: 1
3: 16
4: 137
1103347261_1103347275 21 Left 1103347261 12:120259602-120259624 CCACTGGCCCAGCATCCAAGGCC 0: 1
1: 0
2: 3
3: 32
4: 326
Right 1103347275 12:120259646-120259668 AGCACCACTGGTTAGGCAATCGG 0: 1
1: 0
2: 0
3: 8
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103347261 Original CRISPR GGCCTTGGATGCTGGGCCAG TGG (reversed) Intronic