ID: 1103347261 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:120259602-120259624 |
Sequence | GGCCTTGGATGCTGGGCCAG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 362 | |||
Summary | {0: 1, 1: 0, 2: 3, 3: 32, 4: 326} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1103347261_1103347270 | 9 | Left | 1103347261 | 12:120259602-120259624 | CCACTGGCCCAGCATCCAAGGCC | 0: 1 1: 0 2: 3 3: 32 4: 326 |
||
Right | 1103347270 | 12:120259634-120259656 | AGGCCAGCCCTGAGCACCACTGG | 0: 1 1: 0 2: 2 3: 38 4: 297 |
||||
1103347261_1103347272 | 14 | Left | 1103347261 | 12:120259602-120259624 | CCACTGGCCCAGCATCCAAGGCC | 0: 1 1: 0 2: 3 3: 32 4: 326 |
||
Right | 1103347272 | 12:120259639-120259661 | AGCCCTGAGCACCACTGGTTAGG | 0: 1 1: 0 2: 1 3: 16 4: 137 |
||||
1103347261_1103347275 | 21 | Left | 1103347261 | 12:120259602-120259624 | CCACTGGCCCAGCATCCAAGGCC | 0: 1 1: 0 2: 3 3: 32 4: 326 |
||
Right | 1103347275 | 12:120259646-120259668 | AGCACCACTGGTTAGGCAATCGG | 0: 1 1: 0 2: 0 3: 8 4: 70 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1103347261 | Original CRISPR | GGCCTTGGATGCTGGGCCAG TGG (reversed) | Intronic | ||