ID: 1103350131

View in Genome Browser
Species Human (GRCh38)
Location 12:120278240-120278262
Sequence AGGTGGGGAGCACCTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 23178
Summary {0: 33, 1: 258, 2: 1614, 3: 11674, 4: 9599}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103350131_1103350139 -5 Left 1103350131 12:120278240-120278262 CCAGGCAGAGGTGCTCCCCACCT 0: 33
1: 258
2: 1614
3: 11674
4: 9599
Right 1103350139 12:120278258-120278280 CACCTCCCAGACGGGGGAGCCGG No data
1103350131_1103350145 23 Left 1103350131 12:120278240-120278262 CCAGGCAGAGGTGCTCCCCACCT 0: 33
1: 258
2: 1614
3: 11674
4: 9599
Right 1103350145 12:120278286-120278308 GACGCCCCTCACCTCCCAGACGG 0: 44
1: 1461
2: 5129
3: 5108
4: 4286
1103350131_1103350147 25 Left 1103350131 12:120278240-120278262 CCAGGCAGAGGTGCTCCCCACCT 0: 33
1: 258
2: 1614
3: 11674
4: 9599
Right 1103350147 12:120278288-120278310 CGCCCCTCACCTCCCAGACGGGG 0: 445
1: 3117
2: 4796
3: 4624
4: 5623
1103350131_1103350146 24 Left 1103350131 12:120278240-120278262 CCAGGCAGAGGTGCTCCCCACCT 0: 33
1: 258
2: 1614
3: 11674
4: 9599
Right 1103350146 12:120278287-120278309 ACGCCCCTCACCTCCCAGACGGG 0: 29
1: 1484
2: 4901
3: 5838
4: 5013
1103350131_1103350150 28 Left 1103350131 12:120278240-120278262 CCAGGCAGAGGTGCTCCCCACCT 0: 33
1: 258
2: 1614
3: 11674
4: 9599
Right 1103350150 12:120278291-120278313 CCCTCACCTCCCAGACGGGGTGG 0: 470
1: 2780
2: 5106
3: 6555
4: 7937
1103350131_1103350140 -4 Left 1103350131 12:120278240-120278262 CCAGGCAGAGGTGCTCCCCACCT 0: 33
1: 258
2: 1614
3: 11674
4: 9599
Right 1103350140 12:120278259-120278281 ACCTCCCAGACGGGGGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103350131 Original CRISPR AGGTGGGGAGCACCTCTGCC TGG (reversed) Intergenic
Too many off-targets to display for this crispr