ID: 1103350139

View in Genome Browser
Species Human (GRCh38)
Location 12:120278258-120278280
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103350125_1103350139 17 Left 1103350125 12:120278218-120278240 CCACCTCCCAGATGAAGGGCGGC 0: 12
1: 32
2: 72
3: 273
4: 1296
Right 1103350139 12:120278258-120278280 CACCTCCCAGACGGGGGAGCCGG No data
1103350119_1103350139 21 Left 1103350119 12:120278214-120278236 CCCCCCACCTCCCAGATGAAGGG No data
Right 1103350139 12:120278258-120278280 CACCTCCCAGACGGGGGAGCCGG No data
1103350126_1103350139 14 Left 1103350126 12:120278221-120278243 CCTCCCAGATGAAGGGCGGCCAG 0: 3
1: 21
2: 70
3: 94
4: 196
Right 1103350139 12:120278258-120278280 CACCTCCCAGACGGGGGAGCCGG No data
1103350131_1103350139 -5 Left 1103350131 12:120278240-120278262 CCAGGCAGAGGTGCTCCCCACCT 0: 33
1: 258
2: 1614
3: 11674
4: 9599
Right 1103350139 12:120278258-120278280 CACCTCCCAGACGGGGGAGCCGG No data
1103350121_1103350139 20 Left 1103350121 12:120278215-120278237 CCCCCACCTCCCAGATGAAGGGC No data
Right 1103350139 12:120278258-120278280 CACCTCCCAGACGGGGGAGCCGG No data
1103350129_1103350139 10 Left 1103350129 12:120278225-120278247 CCAGATGAAGGGCGGCCAGGCAG 0: 3
1: 202
2: 1223
3: 840
4: 585
Right 1103350139 12:120278258-120278280 CACCTCCCAGACGGGGGAGCCGG No data
1103350123_1103350139 18 Left 1103350123 12:120278217-120278239 CCCACCTCCCAGATGAAGGGCGG 0: 13
1: 31
2: 77
3: 263
4: 1214
Right 1103350139 12:120278258-120278280 CACCTCCCAGACGGGGGAGCCGG No data
1103350122_1103350139 19 Left 1103350122 12:120278216-120278238 CCCCACCTCCCAGATGAAGGGCG 0: 17
1: 56
2: 354
3: 1529
4: 1980
Right 1103350139 12:120278258-120278280 CACCTCCCAGACGGGGGAGCCGG No data
1103350128_1103350139 11 Left 1103350128 12:120278224-120278246 CCCAGATGAAGGGCGGCCAGGCA 0: 3
1: 203
2: 1201
3: 849
4: 580
Right 1103350139 12:120278258-120278280 CACCTCCCAGACGGGGGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103350139 Original CRISPR CACCTCCCAGACGGGGGAGC CGG Intergenic
No off target data available for this crispr