ID: 1103350143

View in Genome Browser
Species Human (GRCh38)
Location 12:120278264-120278286
Sequence CTCTGCCCGGCTCCCCCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103350143_1103350145 -1 Left 1103350143 12:120278264-120278286 CCAGACGGGGGAGCCGGGCAGAG No data
Right 1103350145 12:120278286-120278308 GACGCCCCTCACCTCCCAGACGG 0: 44
1: 1461
2: 5129
3: 5108
4: 4286
1103350143_1103350153 9 Left 1103350143 12:120278264-120278286 CCAGACGGGGGAGCCGGGCAGAG No data
Right 1103350153 12:120278296-120278318 ACCTCCCAGACGGGGTGGCTGGG 0: 18
1: 115
2: 644
3: 1822
4: 3359
1103350143_1103350147 1 Left 1103350143 12:120278264-120278286 CCAGACGGGGGAGCCGGGCAGAG No data
Right 1103350147 12:120278288-120278310 CGCCCCTCACCTCCCAGACGGGG 0: 445
1: 3117
2: 4796
3: 4624
4: 5623
1103350143_1103350150 4 Left 1103350143 12:120278264-120278286 CCAGACGGGGGAGCCGGGCAGAG No data
Right 1103350150 12:120278291-120278313 CCCTCACCTCCCAGACGGGGTGG 0: 470
1: 2780
2: 5106
3: 6555
4: 7937
1103350143_1103350152 8 Left 1103350143 12:120278264-120278286 CCAGACGGGGGAGCCGGGCAGAG No data
Right 1103350152 12:120278295-120278317 CACCTCCCAGACGGGGTGGCTGG 0: 101
1: 1063
2: 3749
3: 4729
4: 9277
1103350143_1103350157 15 Left 1103350143 12:120278264-120278286 CCAGACGGGGGAGCCGGGCAGAG No data
Right 1103350157 12:120278302-120278324 CAGACGGGGTGGCTGGGCAGAGG 0: 29
1: 329
2: 1436
3: 2447
4: 5078
1103350143_1103350146 0 Left 1103350143 12:120278264-120278286 CCAGACGGGGGAGCCGGGCAGAG No data
Right 1103350146 12:120278287-120278309 ACGCCCCTCACCTCCCAGACGGG 0: 29
1: 1484
2: 4901
3: 5838
4: 5013

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103350143 Original CRISPR CTCTGCCCGGCTCCCCCGTC TGG (reversed) Intergenic
No off target data available for this crispr