ID: 1103350144

View in Genome Browser
Species Human (GRCh38)
Location 12:120278277-120278299
Sequence AGGTGAGGGGCGTCTCTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22606
Summary {0: 52, 1: 3728, 2: 5024, 3: 5056, 4: 8746}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103350144_1103350161 25 Left 1103350144 12:120278277-120278299 CCGGGCAGAGACGCCCCTCACCT 0: 52
1: 3728
2: 5024
3: 5056
4: 8746
Right 1103350161 12:120278325-120278347 CGCCCACTTCACAGACGGGGCGG No data
1103350144_1103350157 2 Left 1103350144 12:120278277-120278299 CCGGGCAGAGACGCCCCTCACCT 0: 52
1: 3728
2: 5024
3: 5056
4: 8746
Right 1103350157 12:120278302-120278324 CAGACGGGGTGGCTGGGCAGAGG 0: 29
1: 329
2: 1436
3: 2447
4: 5078
1103350144_1103350160 22 Left 1103350144 12:120278277-120278299 CCGGGCAGAGACGCCCCTCACCT 0: 52
1: 3728
2: 5024
3: 5056
4: 8746
Right 1103350160 12:120278322-120278344 AGGCGCCCACTTCACAGACGGGG No data
1103350144_1103350165 30 Left 1103350144 12:120278277-120278299 CCGGGCAGAGACGCCCCTCACCT 0: 52
1: 3728
2: 5024
3: 5056
4: 8746
Right 1103350165 12:120278330-120278352 ACTTCACAGACGGGGCGGCCGGG 0: 2
1: 984
2: 1706
3: 5000
4: 3782
1103350144_1103350158 20 Left 1103350144 12:120278277-120278299 CCGGGCAGAGACGCCCCTCACCT 0: 52
1: 3728
2: 5024
3: 5056
4: 8746
Right 1103350158 12:120278320-120278342 AGAGGCGCCCACTTCACAGACGG No data
1103350144_1103350152 -5 Left 1103350144 12:120278277-120278299 CCGGGCAGAGACGCCCCTCACCT 0: 52
1: 3728
2: 5024
3: 5056
4: 8746
Right 1103350152 12:120278295-120278317 CACCTCCCAGACGGGGTGGCTGG 0: 101
1: 1063
2: 3749
3: 4729
4: 9277
1103350144_1103350159 21 Left 1103350144 12:120278277-120278299 CCGGGCAGAGACGCCCCTCACCT 0: 52
1: 3728
2: 5024
3: 5056
4: 8746
Right 1103350159 12:120278321-120278343 GAGGCGCCCACTTCACAGACGGG No data
1103350144_1103350150 -9 Left 1103350144 12:120278277-120278299 CCGGGCAGAGACGCCCCTCACCT 0: 52
1: 3728
2: 5024
3: 5056
4: 8746
Right 1103350150 12:120278291-120278313 CCCTCACCTCCCAGACGGGGTGG 0: 470
1: 2780
2: 5106
3: 6555
4: 7937
1103350144_1103350164 29 Left 1103350144 12:120278277-120278299 CCGGGCAGAGACGCCCCTCACCT 0: 52
1: 3728
2: 5024
3: 5056
4: 8746
Right 1103350164 12:120278329-120278351 CACTTCACAGACGGGGCGGCCGG 0: 2
1: 1123
2: 2566
3: 7268
4: 3429
1103350144_1103350153 -4 Left 1103350144 12:120278277-120278299 CCGGGCAGAGACGCCCCTCACCT 0: 52
1: 3728
2: 5024
3: 5056
4: 8746
Right 1103350153 12:120278296-120278318 ACCTCCCAGACGGGGTGGCTGGG 0: 18
1: 115
2: 644
3: 1822
4: 3359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103350144 Original CRISPR AGGTGAGGGGCGTCTCTGCC CGG (reversed) Intergenic
Too many off-targets to display for this crispr