ID: 1103350145

View in Genome Browser
Species Human (GRCh38)
Location 12:120278286-120278308
Sequence GACGCCCCTCACCTCCCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 16028
Summary {0: 44, 1: 1461, 2: 5129, 3: 5108, 4: 4286}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103350142_1103350145 0 Left 1103350142 12:120278263-120278285 CCCAGACGGGGGAGCCGGGCAGA No data
Right 1103350145 12:120278286-120278308 GACGCCCCTCACCTCCCAGACGG 0: 44
1: 1461
2: 5129
3: 5108
4: 4286
1103350141_1103350145 3 Left 1103350141 12:120278260-120278282 CCTCCCAGACGGGGGAGCCGGGC No data
Right 1103350145 12:120278286-120278308 GACGCCCCTCACCTCCCAGACGG 0: 44
1: 1461
2: 5129
3: 5108
4: 4286
1103350136_1103350145 8 Left 1103350136 12:120278255-120278277 CCCCACCTCCCAGACGGGGGAGC No data
Right 1103350145 12:120278286-120278308 GACGCCCCTCACCTCCCAGACGG 0: 44
1: 1461
2: 5129
3: 5108
4: 4286
1103350131_1103350145 23 Left 1103350131 12:120278240-120278262 CCAGGCAGAGGTGCTCCCCACCT 0: 33
1: 258
2: 1614
3: 11674
4: 9599
Right 1103350145 12:120278286-120278308 GACGCCCCTCACCTCCCAGACGG 0: 44
1: 1461
2: 5129
3: 5108
4: 4286
1103350138_1103350145 6 Left 1103350138 12:120278257-120278279 CCACCTCCCAGACGGGGGAGCCG No data
Right 1103350145 12:120278286-120278308 GACGCCCCTCACCTCCCAGACGG 0: 44
1: 1461
2: 5129
3: 5108
4: 4286
1103350137_1103350145 7 Left 1103350137 12:120278256-120278278 CCCACCTCCCAGACGGGGGAGCC No data
Right 1103350145 12:120278286-120278308 GACGCCCCTCACCTCCCAGACGG 0: 44
1: 1461
2: 5129
3: 5108
4: 4286
1103350143_1103350145 -1 Left 1103350143 12:120278264-120278286 CCAGACGGGGGAGCCGGGCAGAG No data
Right 1103350145 12:120278286-120278308 GACGCCCCTCACCTCCCAGACGG 0: 44
1: 1461
2: 5129
3: 5108
4: 4286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103350145 Original CRISPR GACGCCCCTCACCTCCCAGA CGG Intergenic
Too many off-targets to display for this crispr