ID: 1103350147

View in Genome Browser
Species Human (GRCh38)
Location 12:120278288-120278310
Sequence CGCCCCTCACCTCCCAGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 18605
Summary {0: 445, 1: 3117, 2: 4796, 3: 4624, 4: 5623}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103350131_1103350147 25 Left 1103350131 12:120278240-120278262 CCAGGCAGAGGTGCTCCCCACCT 0: 33
1: 258
2: 1614
3: 11674
4: 9599
Right 1103350147 12:120278288-120278310 CGCCCCTCACCTCCCAGACGGGG 0: 445
1: 3117
2: 4796
3: 4624
4: 5623
1103350136_1103350147 10 Left 1103350136 12:120278255-120278277 CCCCACCTCCCAGACGGGGGAGC No data
Right 1103350147 12:120278288-120278310 CGCCCCTCACCTCCCAGACGGGG 0: 445
1: 3117
2: 4796
3: 4624
4: 5623
1103350137_1103350147 9 Left 1103350137 12:120278256-120278278 CCCACCTCCCAGACGGGGGAGCC No data
Right 1103350147 12:120278288-120278310 CGCCCCTCACCTCCCAGACGGGG 0: 445
1: 3117
2: 4796
3: 4624
4: 5623
1103350143_1103350147 1 Left 1103350143 12:120278264-120278286 CCAGACGGGGGAGCCGGGCAGAG No data
Right 1103350147 12:120278288-120278310 CGCCCCTCACCTCCCAGACGGGG 0: 445
1: 3117
2: 4796
3: 4624
4: 5623
1103350141_1103350147 5 Left 1103350141 12:120278260-120278282 CCTCCCAGACGGGGGAGCCGGGC No data
Right 1103350147 12:120278288-120278310 CGCCCCTCACCTCCCAGACGGGG 0: 445
1: 3117
2: 4796
3: 4624
4: 5623
1103350142_1103350147 2 Left 1103350142 12:120278263-120278285 CCCAGACGGGGGAGCCGGGCAGA No data
Right 1103350147 12:120278288-120278310 CGCCCCTCACCTCCCAGACGGGG 0: 445
1: 3117
2: 4796
3: 4624
4: 5623
1103350138_1103350147 8 Left 1103350138 12:120278257-120278279 CCACCTCCCAGACGGGGGAGCCG No data
Right 1103350147 12:120278288-120278310 CGCCCCTCACCTCCCAGACGGGG 0: 445
1: 3117
2: 4796
3: 4624
4: 5623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103350147 Original CRISPR CGCCCCTCACCTCCCAGACG GGG Intergenic
Too many off-targets to display for this crispr