ID: 1103350150

View in Genome Browser
Species Human (GRCh38)
Location 12:120278291-120278313
Sequence CCCTCACCTCCCAGACGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22848
Summary {0: 470, 1: 2780, 2: 5106, 3: 6555, 4: 7937}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103350144_1103350150 -9 Left 1103350144 12:120278277-120278299 CCGGGCAGAGACGCCCCTCACCT 0: 52
1: 3728
2: 5024
3: 5056
4: 8746
Right 1103350150 12:120278291-120278313 CCCTCACCTCCCAGACGGGGTGG 0: 470
1: 2780
2: 5106
3: 6555
4: 7937
1103350142_1103350150 5 Left 1103350142 12:120278263-120278285 CCCAGACGGGGGAGCCGGGCAGA No data
Right 1103350150 12:120278291-120278313 CCCTCACCTCCCAGACGGGGTGG 0: 470
1: 2780
2: 5106
3: 6555
4: 7937
1103350137_1103350150 12 Left 1103350137 12:120278256-120278278 CCCACCTCCCAGACGGGGGAGCC No data
Right 1103350150 12:120278291-120278313 CCCTCACCTCCCAGACGGGGTGG 0: 470
1: 2780
2: 5106
3: 6555
4: 7937
1103350138_1103350150 11 Left 1103350138 12:120278257-120278279 CCACCTCCCAGACGGGGGAGCCG No data
Right 1103350150 12:120278291-120278313 CCCTCACCTCCCAGACGGGGTGG 0: 470
1: 2780
2: 5106
3: 6555
4: 7937
1103350131_1103350150 28 Left 1103350131 12:120278240-120278262 CCAGGCAGAGGTGCTCCCCACCT 0: 33
1: 258
2: 1614
3: 11674
4: 9599
Right 1103350150 12:120278291-120278313 CCCTCACCTCCCAGACGGGGTGG 0: 470
1: 2780
2: 5106
3: 6555
4: 7937
1103350141_1103350150 8 Left 1103350141 12:120278260-120278282 CCTCCCAGACGGGGGAGCCGGGC No data
Right 1103350150 12:120278291-120278313 CCCTCACCTCCCAGACGGGGTGG 0: 470
1: 2780
2: 5106
3: 6555
4: 7937
1103350136_1103350150 13 Left 1103350136 12:120278255-120278277 CCCCACCTCCCAGACGGGGGAGC No data
Right 1103350150 12:120278291-120278313 CCCTCACCTCCCAGACGGGGTGG 0: 470
1: 2780
2: 5106
3: 6555
4: 7937
1103350143_1103350150 4 Left 1103350143 12:120278264-120278286 CCAGACGGGGGAGCCGGGCAGAG No data
Right 1103350150 12:120278291-120278313 CCCTCACCTCCCAGACGGGGTGG 0: 470
1: 2780
2: 5106
3: 6555
4: 7937

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103350150 Original CRISPR CCCTCACCTCCCAGACGGGG TGG Intergenic
Too many off-targets to display for this crispr