ID: 1103350152

View in Genome Browser
Species Human (GRCh38)
Location 12:120278295-120278317
Sequence CACCTCCCAGACGGGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 18919
Summary {0: 101, 1: 1063, 2: 3749, 3: 4729, 4: 9277}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103350137_1103350152 16 Left 1103350137 12:120278256-120278278 CCCACCTCCCAGACGGGGGAGCC No data
Right 1103350152 12:120278295-120278317 CACCTCCCAGACGGGGTGGCTGG 0: 101
1: 1063
2: 3749
3: 4729
4: 9277
1103350136_1103350152 17 Left 1103350136 12:120278255-120278277 CCCCACCTCCCAGACGGGGGAGC No data
Right 1103350152 12:120278295-120278317 CACCTCCCAGACGGGGTGGCTGG 0: 101
1: 1063
2: 3749
3: 4729
4: 9277
1103350138_1103350152 15 Left 1103350138 12:120278257-120278279 CCACCTCCCAGACGGGGGAGCCG No data
Right 1103350152 12:120278295-120278317 CACCTCCCAGACGGGGTGGCTGG 0: 101
1: 1063
2: 3749
3: 4729
4: 9277
1103350144_1103350152 -5 Left 1103350144 12:120278277-120278299 CCGGGCAGAGACGCCCCTCACCT 0: 52
1: 3728
2: 5024
3: 5056
4: 8746
Right 1103350152 12:120278295-120278317 CACCTCCCAGACGGGGTGGCTGG 0: 101
1: 1063
2: 3749
3: 4729
4: 9277
1103350142_1103350152 9 Left 1103350142 12:120278263-120278285 CCCAGACGGGGGAGCCGGGCAGA No data
Right 1103350152 12:120278295-120278317 CACCTCCCAGACGGGGTGGCTGG 0: 101
1: 1063
2: 3749
3: 4729
4: 9277
1103350143_1103350152 8 Left 1103350143 12:120278264-120278286 CCAGACGGGGGAGCCGGGCAGAG No data
Right 1103350152 12:120278295-120278317 CACCTCCCAGACGGGGTGGCTGG 0: 101
1: 1063
2: 3749
3: 4729
4: 9277
1103350141_1103350152 12 Left 1103350141 12:120278260-120278282 CCTCCCAGACGGGGGAGCCGGGC No data
Right 1103350152 12:120278295-120278317 CACCTCCCAGACGGGGTGGCTGG 0: 101
1: 1063
2: 3749
3: 4729
4: 9277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103350152 Original CRISPR CACCTCCCAGACGGGGTGGC TGG Intergenic
Too many off-targets to display for this crispr