ID: 1103350153

View in Genome Browser
Species Human (GRCh38)
Location 12:120278296-120278318
Sequence ACCTCCCAGACGGGGTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5958
Summary {0: 18, 1: 115, 2: 644, 3: 1822, 4: 3359}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103350137_1103350153 17 Left 1103350137 12:120278256-120278278 CCCACCTCCCAGACGGGGGAGCC No data
Right 1103350153 12:120278296-120278318 ACCTCCCAGACGGGGTGGCTGGG 0: 18
1: 115
2: 644
3: 1822
4: 3359
1103350143_1103350153 9 Left 1103350143 12:120278264-120278286 CCAGACGGGGGAGCCGGGCAGAG No data
Right 1103350153 12:120278296-120278318 ACCTCCCAGACGGGGTGGCTGGG 0: 18
1: 115
2: 644
3: 1822
4: 3359
1103350142_1103350153 10 Left 1103350142 12:120278263-120278285 CCCAGACGGGGGAGCCGGGCAGA No data
Right 1103350153 12:120278296-120278318 ACCTCCCAGACGGGGTGGCTGGG 0: 18
1: 115
2: 644
3: 1822
4: 3359
1103350141_1103350153 13 Left 1103350141 12:120278260-120278282 CCTCCCAGACGGGGGAGCCGGGC No data
Right 1103350153 12:120278296-120278318 ACCTCCCAGACGGGGTGGCTGGG 0: 18
1: 115
2: 644
3: 1822
4: 3359
1103350136_1103350153 18 Left 1103350136 12:120278255-120278277 CCCCACCTCCCAGACGGGGGAGC No data
Right 1103350153 12:120278296-120278318 ACCTCCCAGACGGGGTGGCTGGG 0: 18
1: 115
2: 644
3: 1822
4: 3359
1103350138_1103350153 16 Left 1103350138 12:120278257-120278279 CCACCTCCCAGACGGGGGAGCCG No data
Right 1103350153 12:120278296-120278318 ACCTCCCAGACGGGGTGGCTGGG 0: 18
1: 115
2: 644
3: 1822
4: 3359
1103350144_1103350153 -4 Left 1103350144 12:120278277-120278299 CCGGGCAGAGACGCCCCTCACCT 0: 52
1: 3728
2: 5024
3: 5056
4: 8746
Right 1103350153 12:120278296-120278318 ACCTCCCAGACGGGGTGGCTGGG 0: 18
1: 115
2: 644
3: 1822
4: 3359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103350153 Original CRISPR ACCTCCCAGACGGGGTGGCT GGG Intergenic
Too many off-targets to display for this crispr