ID: 1103357892

View in Genome Browser
Species Human (GRCh38)
Location 12:120335277-120335299
Sequence GATGTGAGACATGCAGTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103357892_1103357896 -5 Left 1103357892 12:120335277-120335299 CCTTTGACTGCATGTCTCACATC No data
Right 1103357896 12:120335295-120335317 ACATCCAGGGCACACTGTGTGGG No data
1103357892_1103357899 19 Left 1103357892 12:120335277-120335299 CCTTTGACTGCATGTCTCACATC No data
Right 1103357899 12:120335319-120335341 GACAAGCCACCCAGGCGCCGAGG No data
1103357892_1103357895 -6 Left 1103357892 12:120335277-120335299 CCTTTGACTGCATGTCTCACATC No data
Right 1103357895 12:120335294-120335316 CACATCCAGGGCACACTGTGTGG No data
1103357892_1103357898 11 Left 1103357892 12:120335277-120335299 CCTTTGACTGCATGTCTCACATC No data
Right 1103357898 12:120335311-120335333 GTGTGGGCGACAAGCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103357892 Original CRISPR GATGTGAGACATGCAGTCAA AGG (reversed) Intergenic