ID: 1103357897

View in Genome Browser
Species Human (GRCh38)
Location 12:120335299-120335321
Sequence GTCGCCCACACAGTGTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103357897_1103357899 -3 Left 1103357897 12:120335299-120335321 CCAGGGCACACTGTGTGGGCGAC No data
Right 1103357899 12:120335319-120335341 GACAAGCCACCCAGGCGCCGAGG No data
1103357897_1103357903 10 Left 1103357897 12:120335299-120335321 CCAGGGCACACTGTGTGGGCGAC No data
Right 1103357903 12:120335332-120335354 GGCGCCGAGGCAAGAGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103357897 Original CRISPR GTCGCCCACACAGTGTGCCC TGG (reversed) Intergenic