ID: 1103357899

View in Genome Browser
Species Human (GRCh38)
Location 12:120335319-120335341
Sequence GACAAGCCACCCAGGCGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103357897_1103357899 -3 Left 1103357897 12:120335299-120335321 CCAGGGCACACTGTGTGGGCGAC No data
Right 1103357899 12:120335319-120335341 GACAAGCCACCCAGGCGCCGAGG No data
1103357892_1103357899 19 Left 1103357892 12:120335277-120335299 CCTTTGACTGCATGTCTCACATC 0: 22
1: 1439
2: 2036
3: 1537
4: 1044
Right 1103357899 12:120335319-120335341 GACAAGCCACCCAGGCGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103357899 Original CRISPR GACAAGCCACCCAGGCGCCG AGG Intergenic
No off target data available for this crispr