ID: 1103359096

View in Genome Browser
Species Human (GRCh38)
Location 12:120342973-120342995
Sequence TGCCCCCAACTCCCCGGGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 337}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103359096_1103359111 19 Left 1103359096 12:120342973-120342995 CCGGGCCCGGGGAGTTGGGGGCA 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1103359111 12:120343015-120343037 CGCTGCAGGGGAGGGGGCGGCGG 0: 1
1: 0
2: 11
3: 147
4: 1241
1103359096_1103359102 5 Left 1103359096 12:120342973-120342995 CCGGGCCCGGGGAGTTGGGGGCA 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1103359102 12:120343001-120343023 TAGCGGGTCCGAGTCGCTGCAGG 0: 1
1: 0
2: 0
3: 0
4: 21
1103359096_1103359104 7 Left 1103359096 12:120342973-120342995 CCGGGCCCGGGGAGTTGGGGGCA 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1103359104 12:120343003-120343025 GCGGGTCCGAGTCGCTGCAGGGG 0: 1
1: 0
2: 0
3: 3
4: 71
1103359096_1103359106 11 Left 1103359096 12:120342973-120342995 CCGGGCCCGGGGAGTTGGGGGCA 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1103359106 12:120343007-120343029 GTCCGAGTCGCTGCAGGGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 114
1103359096_1103359109 13 Left 1103359096 12:120342973-120342995 CCGGGCCCGGGGAGTTGGGGGCA 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1103359109 12:120343009-120343031 CCGAGTCGCTGCAGGGGAGGGGG 0: 1
1: 0
2: 1
3: 20
4: 206
1103359096_1103359103 6 Left 1103359096 12:120342973-120342995 CCGGGCCCGGGGAGTTGGGGGCA 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1103359103 12:120343002-120343024 AGCGGGTCCGAGTCGCTGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 43
1103359096_1103359107 12 Left 1103359096 12:120342973-120342995 CCGGGCCCGGGGAGTTGGGGGCA 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1103359107 12:120343008-120343030 TCCGAGTCGCTGCAGGGGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 116
1103359096_1103359112 25 Left 1103359096 12:120342973-120342995 CCGGGCCCGGGGAGTTGGGGGCA 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1103359112 12:120343021-120343043 AGGGGAGGGGGCGGCGGCTGCGG 0: 1
1: 0
2: 28
3: 297
4: 2594
1103359096_1103359110 16 Left 1103359096 12:120342973-120342995 CCGGGCCCGGGGAGTTGGGGGCA 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1103359110 12:120343012-120343034 AGTCGCTGCAGGGGAGGGGGCGG 0: 1
1: 0
2: 1
3: 58
4: 616
1103359096_1103359105 10 Left 1103359096 12:120342973-120342995 CCGGGCCCGGGGAGTTGGGGGCA 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1103359105 12:120343006-120343028 GGTCCGAGTCGCTGCAGGGGAGG 0: 1
1: 0
2: 1
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103359096 Original CRISPR TGCCCCCAACTCCCCGGGCC CGG (reversed) Exonic
900105743 1:980340-980362 TGGCCCCAACTCCTCCTGCCCGG + Exonic
900156134 1:1204000-1204022 TGCTCCCACCTCCCCGCACCAGG + Intronic
900191830 1:1355384-1355406 TGCCCCCGACCCCGCGGCCCCGG + Intronic
900295380 1:1946623-1946645 TGCCTCCAACTCCGCTGGCTGGG - Intronic
900475204 1:2873206-2873228 CCTCCCCAACTCCCTGGGCCTGG + Intergenic
900640532 1:3686097-3686119 TGCCACCAACACCCAGGGACAGG - Intronic
900866908 1:5275408-5275430 TGCCTCCACCTCCCCGGGCAGGG - Intergenic
901064561 1:6488754-6488776 GGCCCCCAACTCCCTGGGGAGGG + Intronic
901639947 1:10688079-10688101 TGCCACCTCCTCCCCGGGCCTGG - Intronic
902690750 1:18108958-18108980 TGCTCACAACTCCCCAGCCCCGG - Intronic
902768171 1:18630593-18630615 AGCCCCCAACTCGCCGGGATCGG + Intergenic
903678800 1:25083391-25083413 TGCCCCCAACTCCCCATCACTGG + Intergenic
903951550 1:26998650-26998672 TTCCCCCATCGCCCCTGGCCAGG - Intronic
904296215 1:29521349-29521371 TGCTCCCAGCTCCCAGGGCTTGG - Intergenic
904470000 1:30730281-30730303 TGCCCTCACCTGCCCAGGCCTGG + Intergenic
905468785 1:38176020-38176042 TGCCCCCATCACCCAGGGCATGG - Intergenic
905481309 1:38263970-38263992 TGCTGCCACCTCCCCTGGCCTGG - Intergenic
906240021 1:44237069-44237091 TTCTCACAAGTCCCCGGGCCAGG - Intronic
906356917 1:45115231-45115253 TGCCCCCCACCTCCCGGGCGAGG + Intronic
907828917 1:58045411-58045433 TGACCCCAACTCCGCGAGCGGGG + Intronic
912564133 1:110573024-110573046 AGCACCCAAGTCCCCTGGCCTGG - Intergenic
914953936 1:152144863-152144885 TGCCCCCAACCTCCCGGACGGGG + Intergenic
915145475 1:153793879-153793901 TGTCCCCTCCTCCCAGGGCCAGG - Intergenic
915168771 1:153963434-153963456 TGCCCAGGCCTCCCCGGGCCCGG - Exonic
915310263 1:155002853-155002875 GGGCCCCAAGCCCCCGGGCCTGG + Exonic
915735342 1:158081028-158081050 GCCCCCCAGCTCCCCAGGCCAGG + Intronic
917406393 1:174711733-174711755 TGCCCCCTACTCCGGGGGCCTGG + Intronic
918818859 1:189225938-189225960 TGCCCCCAACCTCCCGGACGGGG - Intergenic
919796711 1:201325361-201325383 TGCCCCCGAGTCCCCCAGCCAGG - Intronic
920308046 1:205031443-205031465 TGACCCCAACCTCCCTGGCCAGG + Intergenic
922417122 1:225431697-225431719 TGCCCCCTGCTCCACGCGCCCGG + Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1063160761 10:3416421-3416443 GGCTCCCAACTCCCACGGCCAGG - Intergenic
1063623316 10:7667518-7667540 TCCCCCCACCTCCCCAGTCCCGG + Intergenic
1064387606 10:14911176-14911198 TGCCCAGAACTCACCGTGCCAGG + Intronic
1065189861 10:23199129-23199151 TTCCCCAAACTCCGCAGGCCGGG + Intergenic
1069823670 10:71242490-71242512 TGCCCCCCTCTCCCTGGGCAGGG + Intronic
1070693293 10:78543319-78543341 TGCCCCCAACCCCGCAGCCCTGG - Intergenic
1071076445 10:81759243-81759265 TGTGCCTAACTCCCAGGGCCAGG - Intergenic
1073467536 10:103703022-103703044 GGCCCCTAACTCCCCAGCCCTGG + Intronic
1075538358 10:123290652-123290674 TTCCCTCATCTCCCTGGGCCTGG - Intergenic
1075693866 10:124419232-124419254 GGCCCCCCACTGCGCGGGCCGGG + Intergenic
1075999902 10:126905884-126905906 TACCCCCAACTCCCCGGCCCCGG + Intronic
1076692836 10:132232522-132232544 TGCCCTCAGCCCCCCAGGCCTGG - Intronic
1076707579 10:132310042-132310064 CATCCCCAACTGCCCGGGCCGGG - Intronic
1076909073 10:133378532-133378554 TGCGCTCAACTTCCCGGGCGAGG + Intergenic
1077014154 11:392604-392626 TGCCCCGCACGCGCCGGGCCAGG + Intronic
1077054073 11:581820-581842 TGCCCCCACCTTGCCGGCCCTGG + Intronic
1077152547 11:1078678-1078700 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152569 11:1078746-1078768 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152590 11:1078811-1078833 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152624 11:1078913-1078935 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152657 11:1079012-1079034 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152669 11:1079046-1079068 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152681 11:1079080-1079102 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152693 11:1079114-1079136 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152714 11:1079179-1079201 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152736 11:1079247-1079269 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152796 11:1079445-1079467 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152818 11:1079510-1079532 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152841 11:1079575-1079597 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152853 11:1079609-1079631 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152903 11:1079776-1079798 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152925 11:1079841-1079863 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152955 11:1079940-1079962 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152994 11:1080073-1080095 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153016 11:1080138-1080160 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153119 11:1080457-1080479 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153281 11:1080931-1080953 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153311 11:1081027-1081049 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153356 11:1081157-1081179 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153386 11:1081253-1081275 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153452 11:1081445-1081467 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153486 11:1081541-1081563 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077234584 11:1473846-1473868 TGCCCCCAGCACCCCGGGGATGG + Intronic
1077315389 11:1917385-1917407 TGCTCCCCACTCCCTGGGCTTGG + Intergenic
1077372878 11:2191943-2191965 TGACCCCTCCTCCCCGAGCCTGG + Intergenic
1077551903 11:3204186-3204208 TGCCTGCAGCTCCCTGGGCCCGG - Intergenic
1077680792 11:4237986-4238008 CGCCCCCAACTTCCCGGACAGGG - Intergenic
1078364377 11:10694009-10694031 TGCCCCCGAATCCCCAGGACAGG - Intergenic
1080878580 11:36298691-36298713 GGCCCCCAACTCCCGGGCCATGG - Intronic
1082005128 11:47414993-47415015 TGCTCCCCACCTCCCGGGCCTGG - Intronic
1082065134 11:47893141-47893163 TGCCCCCAACCTCCCGGACGGGG - Intergenic
1083427241 11:62594542-62594564 TGCCCCCCAGTCCCCGGTTCTGG + Exonic
1083595993 11:63918468-63918490 TGCCCGCCACACCTCGGGCCAGG + Intergenic
1083710112 11:64542781-64542803 AGCCCCCAACGCCTCAGGCCAGG - Intergenic
1084028500 11:66467203-66467225 GGCCCCGCACGCCCCGGGCCCGG - Intronic
1084667536 11:70584513-70584535 TGCCCCCATCACCCCAGGGCTGG + Intronic
1084758272 11:71252424-71252446 CGCCCCCGACTCGCCGAGCCAGG - Intronic
1084954868 11:72685806-72685828 GGCTCCCAGCTCCCAGGGCCAGG + Intronic
1084957970 11:72701640-72701662 GGCACCCACCTTCCCGGGCCCGG + Exonic
1085462459 11:76702323-76702345 TGCCCCCAACTCCCCACTCCTGG + Intergenic
1085708946 11:78811993-78812015 TGACCCCACCTCCCCAAGCCAGG - Intronic
1085772848 11:79340302-79340324 TGACCCCACCTCCCTGGGCTGGG - Intronic
1086675421 11:89601132-89601154 TTCCCCCACCTCCTCGGCCCTGG + Intergenic
1089366695 11:117924952-117924974 TGCCCCCCACCCCCAGGGCGAGG - Intronic
1089680748 11:120117646-120117668 TGCCCCCAACCCCAGGGGACAGG + Intronic
1089760797 11:120721655-120721677 TGCCCTAATCACCCCGGGCCAGG - Intronic
1090064330 11:123490218-123490240 TGGCCCCAACCCCTCTGGCCGGG - Intergenic
1090198726 11:124839262-124839284 CTCCCCCACCTCCCCGGGCTGGG + Intergenic
1091191315 11:133697769-133697791 TGGGCCCCACTCCCAGGGCCAGG - Intergenic
1091603982 12:1935032-1935054 TGCTCCCCACTGCCCGGGCCTGG - Intergenic
1091799457 12:3315711-3315733 TGCTCCCAGCCCCCCGGGTCAGG - Intergenic
1092062595 12:5563608-5563630 GGCCGCCACCTCCCCAGGCCGGG - Intronic
1092384700 12:8027062-8027084 TGCCCCCTACTCCACCGGCGCGG - Intergenic
1093927838 12:24926320-24926342 TGCCCCCAACTTCCCAGACGGGG - Intronic
1094657953 12:32439126-32439148 CACCCCCAACTCCCAGTGCCTGG + Intronic
1095810768 12:46371928-46371950 AACCCCCAGCTCCCGGGGCCCGG - Intronic
1095944236 12:47745119-47745141 TGCCCCCTCCTCCCCTGCCCAGG + Intronic
1101606197 12:106248543-106248565 TGACTCCCACTCCCGGGGCCAGG - Intronic
1103321900 12:120097015-120097037 TGCCCCCTCCTCCCCGGCCAAGG - Exonic
1103359096 12:120342973-120342995 TGCCCCCAACTCCCCGGGCCCGG - Exonic
1103459168 12:121090080-121090102 CAACCCCAACTCACCGGGCCCGG + Intergenic
1103944403 12:124518061-124518083 TGCGCCCACCTCCCCCGGCCGGG + Intronic
1104014352 12:124952357-124952379 TGCCCCAAGCTACCCGGGCAGGG + Intronic
1104062800 12:125282299-125282321 TGCCCCCGCCTTCCCCGGCCTGG + Intronic
1104551588 12:129761970-129761992 TGCTCACAACACCTCGGGCCTGG + Intronic
1105347772 13:19589595-19589617 TGCTCCCAGCTCCCTGTGCCTGG + Intergenic
1106335366 13:28778416-28778438 AGGCCCCAGCTCCCTGGGCCAGG - Intergenic
1106568508 13:30906688-30906710 CGCCGCCGGCTCCCCGGGCCTGG - Exonic
1112585547 13:100715842-100715864 TGCCCCCATCTCCCAGGACCAGG + Intergenic
1112595643 13:100804704-100804726 TGCCCTCATCACCCAGGGCCAGG + Intergenic
1114265206 14:21069680-21069702 TCCCTCCATCTCCTCGGGCCTGG - Intronic
1118320471 14:64749513-64749535 AGCCCCCCACCTCCCGGGCCAGG + Exonic
1119745420 14:77040364-77040386 TTCCCACAATTCTCCGGGCCTGG - Intergenic
1120826581 14:88961659-88961681 TACCCCCAACTGCCCCAGCCTGG - Intergenic
1121104532 14:91271862-91271884 TGCCCCCCAATCCCCAGGCCTGG + Exonic
1123495198 15:20816957-20816979 TGGCCCCTCCGCCCCGGGCCAGG - Intergenic
1123551690 15:21386050-21386072 TGGCCCCTCCGCCCCGGGCCAGG - Intergenic
1123718066 15:23044055-23044077 TCCCCCCAGCACCCCTGGCCAGG - Intergenic
1123718944 15:23047120-23047142 TCCCCCCAGCACCCCTGGCCAGG - Intergenic
1123719158 15:23047863-23047885 TCCCCCCAGCACCCCTGGCCAGG - Intergenic
1125747966 15:42010130-42010152 TGGCCCCCCCACCCCGGGCCTGG + Intronic
1126997578 15:54462565-54462587 AGCCCCTCACTCCCCGGGGCCGG - Intronic
1127439167 15:58988411-58988433 GCCCTCCAACTCCCCGGGTCCGG - Intronic
1128374337 15:67065123-67065145 GGGCCCCAACTTCCTGGGCCCGG + Intronic
1128945077 15:71814270-71814292 TGGTCCCCACTCCCGGGGCCTGG - Intronic
1129851344 15:78795669-78795691 TGCCCCCAACAACCCAGCCCAGG + Intronic
1131049778 15:89339181-89339203 TGTCCCTAACTCCCTGAGCCAGG - Intergenic
1131090179 15:89618613-89618635 TGCCCCCAACACACAGTGCCTGG + Intronic
1131090748 15:89623169-89623191 TGCCCCCAACACACAGTGCCTGG + Intronic
1131587375 15:93710447-93710469 TGCCATCCACTCCCCTGGCCTGG + Intergenic
1132016366 15:98320824-98320846 GGCCCCCACCTCCCCACGCCTGG - Intergenic
1132414809 15:101612565-101612587 TGACCCCTGCTCCCCGGGGCAGG + Intergenic
1202960032 15_KI270727v1_random:113292-113314 TGGCCCCTCCGCCCCGGGCCAGG - Intergenic
1132607670 16:800311-800333 GGGCGCCAACACCCCGGGCCTGG - Intronic
1132838268 16:1965440-1965462 TTCCCCCAACCCCGCGGTCCTGG - Intergenic
1132977989 16:2720016-2720038 AGCCCCCTACTCCCTGGGACAGG - Intronic
1133201378 16:4206581-4206603 TGAAGCCACCTCCCCGGGCCGGG + Intronic
1134024878 16:10946022-10946044 TGCCCCCAAATCCTGGGTCCTGG - Intronic
1134537814 16:15040743-15040765 TCCCCCCAGCACCCCAGGCCCGG - Intronic
1134584296 16:15396925-15396947 TGTCCCCCACACCCCAGGCCCGG - Intronic
1136191992 16:28622391-28622413 TGTCCCCCACACCCCAGGCCCGG + Intronic
1136261734 16:29082085-29082107 TTCTCCCACCTCCCCGGCCCCGG - Intergenic
1136635761 16:31521909-31521931 TGCCCCCAAATCCTCCAGCCTGG + Intergenic
1136666864 16:31819762-31819784 TGCCCCAAAGTCCCCCAGCCAGG - Intergenic
1136750226 16:32628888-32628910 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1137339591 16:47587898-47587920 TGCCCCTTACTCCTCTGGCCTGG + Intronic
1137926343 16:52546113-52546135 TTCCCCCCACTCCCCTGTCCAGG + Intronic
1139511298 16:67430068-67430090 TGGCACCAACTCCCAGTGCCTGG + Intergenic
1139513195 16:67438870-67438892 TTCCCCCCACCCCCCTGGCCAGG - Exonic
1139546669 16:67652964-67652986 CGCCGCCACCTCCCCGGGCTCGG + Intronic
1140760286 16:78103141-78103163 TGCACCCGAGTCCCCTGGCCAGG - Intronic
1141428271 16:83957402-83957424 TGCCCTCCCCTCCTCGGGCCTGG - Intronic
1142049948 16:87951640-87951662 CGCCGCCAACCGCCCGGGCCGGG + Intronic
1142279476 16:89140251-89140273 TGCAGCCACCTCCCCTGGCCAGG + Intronic
1203052357 16_KI270728v1_random:888093-888115 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1142472786 17:172498-172520 TGCCCCCAAATTCCCTGCCCCGG - Intronic
1143127987 17:4656759-4656781 AGCCCCTCACTGCCCGGGCCGGG + Intergenic
1144788398 17:17844350-17844372 TTGCCCCAACTCTCCGGGCTGGG + Intronic
1145815073 17:27789455-27789477 TCCCCCCAACACCCCGGGTCTGG + Intronic
1147335917 17:39726946-39726968 TGCCCCCAGCGCCCGGGGCAGGG - Exonic
1148127050 17:45242319-45242341 TGCCCCCAAACCCCCGTCCCAGG + Exonic
1149710922 17:58741442-58741464 TGTCCCCAACCCCCAGGGCACGG + Intergenic
1150209786 17:63435660-63435682 TCCTTCCAACACCCCGGGCCTGG - Intronic
1150437309 17:65164138-65164160 AGCCCCCAACTCTCAGGGGCTGG + Intronic
1150653499 17:67024838-67024860 TGCCCCCCACCTCCCCGGCCAGG + Exonic
1151782810 17:76258542-76258564 GGCCCCCAGCTGCCCAGGCCAGG - Intergenic
1152184154 17:78843662-78843684 GGCCGCCACCTGCCCGGGCCTGG - Intergenic
1152353397 17:79795442-79795464 TGGCCTCCACTTCCCGGGCCCGG - Exonic
1152436485 17:80279309-80279331 GGCCCCCACCTGCCTGGGCCTGG - Intronic
1152729045 17:81960985-81961007 TGCCCCCGACACCCCCGGCCCGG - Exonic
1152805436 17:82353679-82353701 TCCCCCCATCACCCAGGGCCAGG - Intergenic
1156310783 18:35919689-35919711 AGCCCCCATCACCCCTGGCCTGG - Intergenic
1156526640 18:37774254-37774276 TGCCCCCCACTCCCTGCCCCTGG - Intergenic
1157742593 18:50106665-50106687 TGCTTCCAACTCCCGAGGCCTGG + Intronic
1158546834 18:58404354-58404376 TGCCCCCAACTGCCCAGGCTGGG - Intergenic
1160168385 18:76532402-76532424 TGCCCAGAACTCCCCTGCCCAGG - Intergenic
1160441879 18:78899390-78899412 GGCCCCCATCTCCCTGAGCCTGG + Intergenic
1161029745 19:2052086-2052108 TGCTCCCCAGGCCCCGGGCCTGG + Intergenic
1161104595 19:2437053-2437075 CCCCCCCCACTCCCTGGGCCTGG + Intronic
1161401369 19:4067310-4067332 TGCCCCCGACGCCCGGGGCGTGG + Intergenic
1161587914 19:5115379-5115401 TCCCCCCAACCCCCAAGGCCAGG + Intronic
1161723516 19:5916066-5916088 GGCCTCCACCTCCCCGGGCGAGG - Exonic
1162481609 19:10929889-10929911 TGTCCCCAACTCCCGGACCCAGG - Exonic
1162967895 19:14164586-14164608 GCCCCCCACCTCCCCTGGCCCGG + Intronic
1163504920 19:17699965-17699987 TGCCCCCAACTGCACTGGCAGGG + Intergenic
1165013889 19:32866959-32866981 TGCTCCCAACTGCCTGGGACTGG + Intronic
1165340940 19:35211782-35211804 TGCCCCCCACTCCCAGCCCCTGG - Intergenic
1165482235 19:36071488-36071510 AGTCCCCATATCCCCGGGCCAGG + Intronic
1165838606 19:38773677-38773699 TCCCCCCATCACCCAGGGCCCGG + Intergenic
1166136126 19:40778260-40778282 TCCTTCCTACTCCCCGGGCCCGG - Exonic
1166435281 19:42762307-42762329 TGCCCCCAGCTCCACAGTCCAGG + Intronic
1166452546 19:42914510-42914532 TGCCCCCAGCTCCACAGTCCAGG + Intronic
1167466509 19:49653277-49653299 TGCCCGCTCCTCCCCGGACCAGG - Exonic
1168106462 19:54168489-54168511 TAACCCCCACTCCCAGGGCCTGG - Exonic
1168403049 19:56097102-56097124 AGCCCCCAGCTCCACGGCCCAGG + Intronic
924962585 2:46939-46961 TCCCCCCACCTCCCCCGGGCAGG + Intergenic
926501753 2:13663155-13663177 TGCCCCCATCTCCCCTCCCCAGG - Intergenic
927103401 2:19805035-19805057 TGCCCCCAACTGCCAAAGCCTGG - Intergenic
932307840 2:70716456-70716478 TGCCCCCTACACCCCCGCCCTGG + Intronic
932621401 2:73266495-73266517 CGCCCCCACCTCCACGGCCCAGG + Exonic
933720130 2:85392427-85392449 TGCCCCCCACTCCCCAGCTCAGG - Intergenic
935237429 2:101150860-101150882 GGCCTCCAGCTCACCGGGCCAGG + Intronic
935332267 2:101985844-101985866 TACCCTCATCACCCCGGGCCAGG - Intergenic
937114892 2:119397884-119397906 CTCCCCCAACTCCCCTTGCCTGG - Intergenic
937540442 2:122945149-122945171 TTCCCCCAACTCCCAGGCTCTGG - Intergenic
944310216 2:198224843-198224865 TGCCCCCATCCCCCAGGGGCTGG + Intronic
947860467 2:233354423-233354445 CGCCCCCACCGCCCCCGGCCCGG + Intergenic
948223814 2:236293441-236293463 TGCCCCAGACTCACCTGGCCTGG - Intergenic
948869041 2:240789200-240789222 TGCCCCCGCCTCCCCCGACCCGG + Intronic
948909522 2:240996150-240996172 AACCCCCAGCTCCCCGGGCCCGG + Intergenic
1168852426 20:985802-985824 TGCCCCCAACTCCCAAGCCCAGG + Intronic
1168894400 20:1313460-1313482 TGCCACCATCTGGCCGGGCCCGG + Exonic
1169197845 20:3692961-3692983 TGTCCCCAACACCCTGCGCCTGG - Exonic
1169198137 20:3694251-3694273 GGCCTCCAACACCCTGGGCCAGG - Exonic
1169199518 20:3701441-3701463 TGGTCCCAACTCCCTGCGCCTGG - Exonic
1170562765 20:17570567-17570589 CGCCCCCCACTCCCCGGCCTCGG - Intronic
1172474289 20:35226169-35226191 TTCCCCCACCACCCCGGCCCAGG + Intergenic
1172656122 20:36539579-36539601 TGCCCCCTTCTCCCCGCCCCTGG - Intergenic
1173633221 20:44532005-44532027 CGGCCCCAACGCTCCGGGCCTGG + Intronic
1175032809 20:55972335-55972357 TGCCACCAACTCCCCAGGTTAGG + Intergenic
1175197046 20:57251291-57251313 TGCCCCCACCTCCCCGACTCAGG - Intronic
1175429322 20:58891119-58891141 CGCCCCCCACCCCCCGGGCTCGG - Intronic
1175837457 20:62005182-62005204 TGCCATCAAATGCCCGGGCCAGG + Intronic
1175908357 20:62392850-62392872 TGCCCCACACGCCCCGAGCCAGG + Intronic
1176308312 21:5135888-5135910 TGCCCACCACTCACCGGTCCTGG - Intronic
1176382784 21:6121398-6121420 TGCCCCCACCACGCCTGGCCAGG + Exonic
1178977232 21:37230715-37230737 TGCCCCGAACTCCCGGGAGCCGG - Intronic
1179511935 21:41879144-41879166 TGCCCCCCGCCCCCCGCGCCCGG - Intronic
1179740685 21:43416841-43416863 TGCCCCCACCACGCCTGGCCAGG - Exonic
1179801749 21:43814538-43814560 TGCTCCCAGCTCCCTCGGCCTGG + Intergenic
1179848748 21:44126144-44126166 TGCCCACCACTCACCGGTCCTGG + Intronic
1180609367 22:17085520-17085542 TTCCCCGAACTCCGCGGCCCGGG - Intronic
1181044534 22:20208272-20208294 TGGCCCCACCTGCCAGGGCCTGG - Intergenic
1181147397 22:20858692-20858714 CGCCTCCGCCTCCCCGGGCCGGG + Exonic
1181779303 22:25181233-25181255 TGACCCCAACTCCCCTATCCAGG - Intronic
1182485407 22:30635961-30635983 AGCCCGCGACCCCCCGGGCCGGG + Exonic
1182829567 22:33294103-33294125 TGGCCCCTACTCCTCGGGCAGGG + Intronic
1183723343 22:39574819-39574841 TGCCCTCCCCTTCCCGGGCCTGG - Intronic
1184406953 22:44305761-44305783 TGCCCCCAACCCCCCGAGTCTGG + Intronic
1184451693 22:44586320-44586342 AGCCACCCACTCCCAGGGCCAGG + Intergenic
1185179376 22:49350299-49350321 AGCCCTCATCGCCCCGGGCCAGG - Intergenic
1185208948 22:49555836-49555858 TGCCCACCACTCCCCAGCCCAGG + Intronic
950427901 3:12934567-12934589 TGGCACCAACTCCCCTGGGCTGG - Intronic
952275240 3:31870230-31870252 AGCCCCTCACTGCCCGGGCCGGG - Intronic
952382679 3:32817226-32817248 TGCCCCCGCCTCGCCTGGCCTGG - Intergenic
953391180 3:42534759-42534781 TGCCCCCAGCCCTCCTGGCCTGG - Intronic
954320253 3:49827760-49827782 TGCCTCTTACTCCCCGTGCCAGG + Intergenic
954327705 3:49872634-49872656 TGCCCCCAACTCCCAGCTCTAGG + Intergenic
954567036 3:51607972-51607994 TGCCCCCCACCTCCCGGGCGGGG + Intronic
954629412 3:52039982-52040004 TGCCCCCACCCAGCCGGGCCCGG - Intergenic
954682432 3:52352958-52352980 TGCCCCCAAACACCTGGGCCTGG - Intronic
955194096 3:56788720-56788742 TGCTCCCTACTCCTCTGGCCAGG + Intronic
955356756 3:58238078-58238100 TGCCCCCACCTCCCGCTGCCTGG + Intronic
960577512 3:119242734-119242756 TGCCCCCCACCTCCCGGACCAGG - Intergenic
960577547 3:119242816-119242838 TGCCCCCCACTTGCCGGGCGGGG - Intergenic
961171801 3:124802514-124802536 GCCCCTCAACTCCCCGTGCCAGG + Intronic
962292034 3:134145405-134145427 TGCCCTCCACTCCCCTGACCTGG - Intronic
963223443 3:142836331-142836353 TGCTCCAAACCCCCCTGGCCTGG + Intronic
964771103 3:160225358-160225380 CGCGCCCAACCGCCCGGGCCGGG - Intergenic
966919641 3:184603169-184603191 CTCCCCCAACACCCCGTGCCTGG + Intronic
968551555 4:1226164-1226186 TGACCCCTACTCCCCGCTCCCGG + Intronic
968556826 4:1249752-1249774 AGCCCTGAACTTCCCGGGCCGGG - Intronic
968656212 4:1779512-1779534 TGCCCCCTTCTCCCCACGCCAGG - Intergenic
968705281 4:2074764-2074786 TGCCCCCAGTTCTCCAGGCCAGG - Intronic
968875425 4:3264652-3264674 TCTCCCCAACTCCCCAGCCCCGG + Intronic
968910767 4:3476032-3476054 TGCCCCCACCTGCCCCAGCCTGG + Intronic
969166629 4:5321804-5321826 TGCCCCCAACTGCCTCTGCCTGG + Intronic
969391140 4:6892162-6892184 TGCCCCCAAATTCCCCAGCCTGG + Intergenic
969645802 4:8428220-8428242 AGCCCCCACACCCCCGGGCCTGG + Intronic
972938469 4:44168006-44168028 TGCCCCCCACCTCCCGGACCGGG - Intergenic
973855821 4:55008996-55009018 ACCCCCCAACTCCCCAAGCCAGG + Intergenic
978795787 4:112706151-112706173 TTCTCCCACCTCCCCGGCCCCGG + Intergenic
978954555 4:114598553-114598575 CGCCTCCAGCTCCCCGGGCTGGG - Exonic
979161294 4:117464643-117464665 TGCCCCCCACTCCCCCCACCCGG + Intergenic
981268643 4:142818209-142818231 TCCCCCCTACTCCCCTGCCCTGG + Intronic
982440125 4:155424980-155425002 TGCCCCCAACCTCCCGGACGGGG + Intergenic
985775111 5:1837411-1837433 TGTCCCCCACTGCCTGGGCCTGG + Intergenic
987035079 5:14011542-14011564 TGCCGCCAACCCCGCGAGCCAGG + Intergenic
989663433 5:43824509-43824531 TGCCCCCCACTTCCCGGACAGGG + Intergenic
990557557 5:56951614-56951636 TGCCCCCGGCCCACCGGGCCCGG - Intronic
994774293 5:104024757-104024779 TGCACACATCGCCCCGGGCCAGG + Intergenic
1000977730 5:167783321-167783343 TGCCCCTCACTGCCCAGGCCTGG - Intronic
1002026901 5:176401889-176401911 TGCCCTCACCGCCCCTGGCCTGG + Intronic
1002060151 5:176621064-176621086 TGCTCCCACCTCCTGGGGCCTGG + Intronic
1002103925 5:176870587-176870609 AGCCCCCACCTCCCCAGGGCTGG - Intronic
1002803590 6:550698-550720 TCCCCTCCAGTCCCCGGGCCTGG + Intronic
1004424340 6:15497337-15497359 TGCCACCAACGCCCAGGACCTGG - Intronic
1004660517 6:17706036-17706058 TTCCCCCAACTCTCTGGGTCAGG - Intronic
1004986880 6:21092415-21092437 TGCCCCCCACTCCCCTCGACAGG + Intronic
1005040554 6:21596155-21596177 ATCCCCCACCTTCCCGGGCCGGG + Exonic
1006303201 6:33204854-33204876 TGCCCTCTCCTCCCCGTGCCCGG + Intronic
1006429153 6:33984503-33984525 TTCCCCCAGCGCCCCTGGCCTGG - Intergenic
1007773307 6:44208470-44208492 TACCCCCAACTCCCTGGCCCTGG + Intergenic
1008405329 6:51112640-51112662 TGCCCCCAATGCCCTGGCCCTGG - Intergenic
1013530711 6:111017269-111017291 TGCCCCCAACCTCCCGGACGGGG + Intronic
1016462816 6:144296129-144296151 GCTCCCCAACTCCCAGGGCCTGG + Intronic
1016547451 6:145240381-145240403 TGCCCCCAACCCCCCAACCCCGG + Intergenic
1018046300 6:159969233-159969255 GGCCCCCATCGCGCCGGGCCCGG - Exonic
1018099097 6:160420639-160420661 AACTCCCAACTCCCCGGCCCTGG - Intronic
1018742961 6:166744382-166744404 CCCCTCCGACTCCCCGGGCCCGG - Intronic
1019437372 7:1028921-1028943 TGCCCCCATCTCCCCTGCCCAGG + Intronic
1019998831 7:4743023-4743045 GCCCCCCACCTTCCCGGGCCCGG + Intronic
1020254433 7:6494812-6494834 TCTCCCCTACTCCCAGGGCCTGG - Intergenic
1022112600 7:27240556-27240578 TGCCCCCATCTCCTGGGGGCTGG - Intergenic
1026626994 7:72003379-72003401 TGTCCCCAACTCCCGGGCCATGG + Intronic
1029599419 7:101555051-101555073 TGCTGCCAACTCCCAGGGCTGGG + Intronic
1030315263 7:108107681-108107703 TGTCTCCCACTCCCTGGGCCTGG + Exonic
1034449399 7:151129331-151129353 TGCCCCCCACTGCCCCGCCCCGG + Intronic
1035168690 7:157006107-157006129 TGTCCCCAACGACCCAGGCCGGG + Intronic
1035266396 7:157692288-157692310 ACCCCCCACCTCCCCAGGCCAGG + Intronic
1036220115 8:6914417-6914439 TGCCCGCAGCTCCCTGCGCCCGG + Intergenic
1036707364 8:11055596-11055618 TGCCCCCAAATCCACGTCCCAGG + Intronic
1037580125 8:20240058-20240080 TGCCCCAAGCTCCCTTGGCCTGG - Intergenic
1039800469 8:40950245-40950267 GCCCCCCATCTCCCTGGGCCAGG + Intergenic
1043968077 8:86501590-86501612 AGCCTCTACCTCCCCGGGCCCGG - Intronic
1044709109 8:95038462-95038484 TAGCCCCAGCTACCCGGGCCTGG - Intronic
1045036035 8:98177136-98177158 TGCTCCCCACTCCCTGTGCCTGG + Intergenic
1049212082 8:141391592-141391614 TGACCCCAAGTACCCGGGCCAGG + Intergenic
1049256147 8:141615004-141615026 TGCCCCCACCTCACCTGCCCAGG - Intergenic
1049369074 8:142254904-142254926 TGCCTGCCACTCCCTGGGCCAGG + Intronic
1049385537 8:142341263-142341285 TGCACCCACCCCCCCAGGCCTGG + Intronic
1049412763 8:142480837-142480859 TGCCCCCATGTCTCTGGGCCAGG + Intronic
1049792082 8:144476770-144476792 TGCCCCCCACACCCCCGGTCGGG + Intergenic
1050085478 9:1960432-1960454 TTCCACCAAGTCCCCAGGCCTGG - Intergenic
1050362560 9:4844591-4844613 GGCCTCCAACCCCCAGGGCCAGG + Exonic
1053625418 9:39865939-39865961 TTCCCCCAACTCCCAGGCCCTGG + Intergenic
1053879444 9:42577281-42577303 TTCCCCCAACTCCCAGGCCCTGG - Intergenic
1053893214 9:42717056-42717078 TTCCCCCAACTCCCAGGCCCTGG + Intergenic
1054218470 9:62384750-62384772 TTCCCCCAACTCCCAGGCCCTGG - Intergenic
1054232246 9:62524416-62524438 TTCCCCCAACTCCCAGGCCCTGG + Intergenic
1054991272 9:71329759-71329781 TACCCCCAAATCCTAGGGCCAGG - Intronic
1056444982 9:86656786-86656808 TGCTTCAAAATCCCCGGGCCTGG + Intergenic
1057757178 9:97847945-97847967 GCCCCCCCACCCCCCGGGCCTGG - Intergenic
1059394806 9:114027713-114027735 TGCCTCCACCTGCCTGGGCCAGG + Intronic
1060670814 9:125467703-125467725 TGCCCCCAGCTCCCGGGGCTGGG + Intronic
1060968505 9:127724707-127724729 GACCCCCAACTCCCAGTGCCCGG - Intronic
1061135248 9:128729965-128729987 TGCGCCCACTTCCCAGGGCCGGG + Exonic
1061158942 9:128882327-128882349 TGCCCCGGGCGCCCCGGGCCGGG - Intronic
1062187638 9:135227180-135227202 TGCCTCCTCCTCCCTGGGCCTGG + Intergenic
1062551691 9:137090422-137090444 TGCCTCCAGCTCCCCAGCCCAGG - Intronic
1203775679 EBV:71893-71915 TGCCCCCGGCTCCACGGCCCCGG + Intergenic
1187067373 X:15854481-15854503 GGCCCCCACATCCCCGGGCGCGG + Intronic
1189387751 X:40551218-40551240 TGCCCTGCTCTCCCCGGGCCAGG - Intergenic
1192148075 X:68694941-68694963 TACCCCCAAGTCCCAGGGCCTGG + Intronic
1192324846 X:70123251-70123273 TGCCCCCCACTTCCCGGACGGGG - Intergenic
1195298210 X:103500784-103500806 TGCGCACAACCCCGCGGGCCTGG - Exonic
1199878545 X:151954623-151954645 TTCCCCCAACTCCCTTGGCAAGG + Exonic
1200086882 X:153611416-153611438 ACCCCCCACCCCCCCGGGCCGGG + Intergenic
1200145837 X:153926259-153926281 CGCCCCCAAGTCCCGGCGCCGGG - Exonic
1200952867 Y:8918071-8918093 TGCCCCCCACTTCCCGGACGGGG + Intergenic
1201282135 Y:12351369-12351391 TGCCCCACACTCCCCTGGCATGG - Intergenic