ID: 1103360807

View in Genome Browser
Species Human (GRCh38)
Location 12:120352553-120352575
Sequence CTCAATAATCTCATGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103360807_1103360815 30 Left 1103360807 12:120352553-120352575 CCTTCCCCCATGAGATTATTGAG 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1103360815 12:120352606-120352628 CTCCAAGCTGAACAGCCCTGAGG 0: 1
1: 0
2: 4
3: 22
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103360807 Original CRISPR CTCAATAATCTCATGGGGGA AGG (reversed) Intronic
903406472 1:23101346-23101368 CACAATAACCTTATGGGGCAAGG + Intronic
904798599 1:33076597-33076619 CTGCATAATTTCATGGTGGAAGG + Intronic
908463574 1:64369667-64369689 CTCTCTTATCTCATGGGGAAAGG + Intergenic
911341220 1:96641078-96641100 CTCATCAATCTCATGAAGGAAGG - Intergenic
911573658 1:99549041-99549063 CTTAATAATCTCTTGGCTGATGG - Intergenic
921331607 1:214044111-214044133 CTCAATACTCTCATTGGGTAGGG + Intergenic
922800877 1:228364298-228364320 CCCTCTCATCTCATGGGGGAAGG - Intronic
923774760 1:236968331-236968353 CTCAATCATGTTCTGGGGGATGG + Intergenic
924291917 1:242545491-242545513 CTGAATAGTCTCTGGGGGGATGG + Intergenic
924503411 1:244657873-244657895 CTAGATAATCTCTTCGGGGAAGG - Intronic
1064383894 10:14873502-14873524 CTTAATAATCTAGTGGGGAAAGG - Intergenic
1068044136 10:51863666-51863688 CTCTACCATCTCATGGTGGAAGG - Intronic
1068928097 10:62560607-62560629 CTCAATATTCTCTTGGGGAGGGG - Intronic
1070514097 10:77187633-77187655 CTCAATAATATGAGGGGGCAGGG + Intronic
1072600145 10:96918239-96918261 CTCTATAATGACAGGGGGGATGG + Intronic
1073105075 10:101028055-101028077 CTAAATAATAACATGGGGCAGGG + Intronic
1073907801 10:108304086-108304108 CACAAGAATTTCATGGTGGAGGG + Intergenic
1076445020 10:130508579-130508601 CTCAATTCTCACGTGGGGGAAGG - Intergenic
1081550602 11:44108269-44108291 CTCAAGTATCTCCTGGGGGCTGG - Intronic
1085435494 11:76496256-76496278 CTCACTAAGCTTTTGGGGGAAGG - Exonic
1089852493 11:121512450-121512472 CTGAATAATCTCATTGAGGAAGG - Intronic
1091579703 12:1776660-1776682 CTCTAGAATCTGATGCGGGAGGG + Intronic
1094084742 12:26577028-26577050 CTGCATCATCCCATGGGGGAAGG - Intronic
1094332346 12:29308090-29308112 CTCAAAATTCACATGGGTGATGG + Intronic
1095578804 12:43771024-43771046 CTACATCATCTCATGGTGGAAGG - Intronic
1098130239 12:67342596-67342618 CTCAAAAAACACATGGGGAAGGG - Intergenic
1102610064 12:114104198-114104220 CACAATAGACTCATGGGGAAAGG - Intergenic
1103360807 12:120352553-120352575 CTCAATAATCTCATGGGGGAAGG - Intronic
1106297983 13:28435518-28435540 CTTTATAATCTGTTGGGGGAAGG - Intronic
1106601252 13:31188860-31188882 CCCAATAACCTCTGGGGGGATGG + Intergenic
1107573819 13:41695235-41695257 ATAAATAATCTCATGGGGAGTGG + Intronic
1110270004 13:73578980-73579002 CTCCATATTCTGATGGGGAATGG - Intergenic
1110998041 13:82138721-82138743 CTAAATCATCCCATGGTGGAGGG - Intergenic
1111711759 13:91824699-91824721 CTCAATAATATTAAGTGGGAAGG - Intronic
1114038171 14:18649093-18649115 CTCAAAATTCCCATGGGTGATGG + Intergenic
1114120444 14:19665949-19665971 CTCAAAATTCCCATGGGTGATGG - Intergenic
1114678749 14:24464795-24464817 TTCAATATCCTCATGGGAGAAGG + Intergenic
1116269135 14:42738346-42738368 CACAATGCTCTCATGGAGGAAGG + Intergenic
1118097597 14:62556000-62556022 ATCACTAATCCCATGGGTGAGGG - Intergenic
1119128009 14:72146078-72146100 CTCTATCATCTCATGGTGGAGGG + Intronic
1119365708 14:74089872-74089894 CTCAATCCTCTTATGGGAGAGGG + Intronic
1119705104 14:76778361-76778383 CCCAGGAATGTCATGGGGGAGGG + Intronic
1120264293 14:82229986-82230008 GGCAATGATTTCATGGGGGAAGG - Intergenic
1122350052 14:101083873-101083895 ATCAACAATCACATGGGGGTTGG + Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1124295220 15:28496153-28496175 CTCTATAACCTCAGTGGGGAAGG - Intergenic
1125584639 15:40811576-40811598 CTCAATAATCTTATGAGGCCAGG + Intronic
1126185367 15:45826104-45826126 CTGTATCATCTCATGGTGGAAGG - Intergenic
1133319280 16:4903011-4903033 CTCAGGAAACTGATGGGGGAAGG - Intronic
1133717696 16:8465332-8465354 TTCAAGAGTCTGATGGGGGATGG + Intergenic
1133752659 16:8736698-8736720 CCCAATAGTCCCATGAGGGAGGG + Intronic
1133768646 16:8855023-8855045 CTCAAGTATCTCCTGGAGGAAGG - Exonic
1135825431 16:25723132-25723154 CACAATTCCCTCATGGGGGAGGG - Intronic
1136098737 16:27977787-27977809 CAAAATAATCTCATGGTGGTGGG - Intronic
1139378756 16:66517039-66517061 CACAATGATCTCATGGGGGTGGG + Intronic
1140855633 16:78975482-78975504 CTCAAAAGGCTCCTGGGGGAGGG - Intronic
1141743149 16:85907746-85907768 CTCAAGATTCTCACTGGGGAAGG - Intronic
1143716125 17:8770960-8770982 CTCAATAAACTCATAGGCAAAGG - Intergenic
1147136926 17:38439627-38439649 CACAACAATCCCATGGGCGATGG + Intronic
1147876220 17:43622494-43622516 CTCTATACTCTCAGGGGAGAGGG + Intergenic
1158614406 18:58972962-58972984 CTCAAGGAGCTTATGGGGGAGGG + Intronic
1159765916 18:72488093-72488115 CTCAATAAAGTCATGGTGCATGG + Intergenic
1162438491 19:10678307-10678329 AGGAATAATCTCATGAGGGAGGG - Intronic
1166094399 19:40530280-40530302 CAGAACAATCTCATGAGGGATGG - Intronic
1167596887 19:50432651-50432673 CTCCAGAATCTCAGGGAGGAGGG - Intergenic
927121801 2:19971441-19971463 CTGCATAATTTCATGGTGGAAGG - Intronic
929904835 2:46036660-46036682 CTCAAAACTCTCAGAGGGGAGGG + Intronic
934720249 2:96569541-96569563 CTGAATGAACTGATGGGGGATGG + Intergenic
934979149 2:98825968-98825990 CACAATCATGTCATGAGGGAAGG + Intronic
935873088 2:107472730-107472752 CTCAGTAATGTCATTGGGAATGG + Intergenic
936144834 2:109973655-109973677 CTCAATTTTCTCATTGTGGAGGG + Intergenic
936181520 2:110271618-110271640 CTCAATTTTCTCATTGTGGAGGG + Intergenic
936199852 2:110397814-110397836 CTCAATTTTCTCATTGTGGAGGG - Intergenic
937316467 2:120934895-120934917 TTCATTAATCTCATGGTGAACGG - Intronic
938272787 2:129990007-129990029 CTCAAAATTCCCATGGGTGATGG - Intergenic
938443446 2:131356110-131356132 CTCAAAATTCCCATGGGTGATGG + Intergenic
938683670 2:133716459-133716481 CTAAATAGTCACATGGGGGTGGG + Intergenic
939815415 2:146890198-146890220 CTGAATCATAGCATGGGGGATGG - Intergenic
940188556 2:151014050-151014072 GTGAATATTCTCATGGGGGCAGG - Intronic
940471492 2:154105781-154105803 CTCAATATTCACATGGGGCTAGG - Intronic
945976714 2:216276838-216276860 CACAATCATCTGTTGGGGGAGGG + Intronic
1170796890 20:19555600-19555622 CTCAATTTTCTCAGTGGGGAAGG - Intronic
1172009928 20:31840877-31840899 CACAATAACATCATGGGGGTAGG + Intergenic
1172046216 20:32082191-32082213 ATGAATAACCTCATGGGGTAAGG - Intronic
1173907189 20:46637868-46637890 CTGAATCACCTCCTGGGGGATGG - Intronic
1177782584 21:25637017-25637039 CTCAATAGTCACATGAGGGTAGG - Intergenic
1180462296 22:15576134-15576156 CTCAAAATTCCCATGGGTGATGG + Intergenic
1183696498 22:39426692-39426714 CGCAGCAATCTCCTGGGGGAGGG - Exonic
1183751515 22:39723670-39723692 CTCCATCATCACATGGGGGCTGG - Intergenic
1184654333 22:45933545-45933567 CTCAGAAATCTCATGGGGGTAGG + Intronic
949639914 3:6024655-6024677 CTGTATCATCTCATGGTGGAAGG + Intergenic
950013304 3:9739115-9739137 CTCAAAGATCTCCTGCGGGATGG - Exonic
952313438 3:32211307-32211329 CTGCATCATCTCATGGTGGAAGG - Intergenic
953631469 3:44621610-44621632 CTCAGGGAACTCATGGGGGAAGG - Intronic
959769351 3:110073410-110073432 CTCACTTATCTCAAAGGGGATGG - Intergenic
960211515 3:114972968-114972990 ATAAATAATCTTATGGGGCAAGG + Intronic
960479411 3:118170737-118170759 CTCTCCAATGTCATGGGGGAAGG + Intergenic
963146570 3:142000927-142000949 CCCAATAAAGTCATGGGGGTGGG - Intronic
964749520 3:160041430-160041452 CTCAGTTAGCTCATGTGGGAAGG - Intergenic
968284909 3:197502825-197502847 CTGAACAATGTCCTGGGGGATGG + Intergenic
969105067 4:4801289-4801311 CTCAACAATCTCCTGGGGGAGGG + Intergenic
970923693 4:21425034-21425056 CAAAATAATATGATGGGGGAAGG + Intronic
971868981 4:32211195-32211217 CTCAATAATCTCTTTGGGTTGGG - Intergenic
972422507 4:38902230-38902252 CTCAATGATCTTATGAGGTAAGG - Intronic
975201632 4:71597098-71597120 CTTTATCATCTCATGGTGGAAGG - Intergenic
976633024 4:87258949-87258971 CTCCATCATCCCATGGTGGAAGG - Intergenic
977518018 4:98046553-98046575 CACCCTAATCTCCTGGGGGACGG - Intronic
980036967 4:127895819-127895841 CTCAAGAATCTGAGGTGGGAGGG + Intronic
983037462 4:162885423-162885445 CTGAATTAGCTCTTGGGGGAAGG - Intergenic
986493490 5:8317905-8317927 CGTAATACTCTGATGGGGGAGGG - Intergenic
995767644 5:115636319-115636341 GTCAAAAATCCCTTGGGGGAAGG + Intergenic
999846614 5:155488388-155488410 CTGTATAATCACATGGTGGAAGG - Intergenic
1000441826 5:161272603-161272625 CTCAATAATTTGCTGTGGGATGG - Intergenic
1000674924 5:164108891-164108913 CTAAATGAGCTCATGTGGGACGG - Intergenic
1001005210 5:168043854-168043876 CATAATAATCTCATTGGGGTTGG - Intronic
1006643167 6:35498653-35498675 CACTATAATCTCCTGGGGGCAGG + Intronic
1007162838 6:39806109-39806131 CTCAGCAATGTCATGGGGGAAGG + Intronic
1007213177 6:40213673-40213695 TTAAATAATCTCATTGGGGATGG - Intergenic
1007283125 6:40726849-40726871 GTTAATATTCTCATGGGAGAGGG - Intergenic
1009400652 6:63251455-63251477 CTGTATCATCTCATGGTGGAAGG - Intergenic
1013099085 6:106973393-106973415 CTCAATTCTTTGATGGGGGAGGG - Intronic
1013138258 6:107304130-107304152 CTGTATAATCTCAGTGGGGAAGG - Intronic
1016068061 6:139704372-139704394 CTAAATCTTCTCATTGGGGAAGG + Intergenic
1016239199 6:141908637-141908659 CTCAATAATCTCATACTGGTGGG - Intergenic
1017540021 6:155391569-155391591 CTCAATAAAGCTATGGGGGAGGG + Intergenic
1021499026 7:21308790-21308812 CACAATAATCTCATGAAGCAGGG + Intergenic
1024743559 7:52381865-52381887 CTCCAAAATCTGATGGGGGTTGG + Intergenic
1026383920 7:69826851-69826873 CTCAATAATTTGTTGGAGGAAGG - Intronic
1026616274 7:71907545-71907567 CTCCAAAATCACATAGGGGAAGG - Intronic
1027683744 7:81254873-81254895 CTGCATTATCTCATGGTGGAAGG + Intergenic
1028577845 7:92371922-92371944 CTCAAGACTCTCACTGGGGAAGG - Intronic
1033772057 7:144563873-144563895 CTAAATAATCTCAAGGAGAAGGG - Intronic
1034582287 7:152055280-152055302 CCAAATAATCTCCTGTGGGATGG + Intronic
1034685193 7:152965102-152965124 CAGAATACTCCCATGGGGGAGGG - Intergenic
1041810006 8:61897387-61897409 CTCAACAATCTAATGGGTGTAGG + Intergenic
1041995724 8:64054928-64054950 CACTATAAGCTCATGAGGGAAGG - Intergenic
1042831389 8:73033017-73033039 ATTAAAAATCTCAGGGGGGAGGG - Intronic
1044195105 8:89366955-89366977 CTTTATAATCTCATGGGGCATGG - Intergenic
1044933750 8:97274879-97274901 CTCAAGCTTCTCCTGGGGGATGG - Exonic
1045968166 8:108050066-108050088 TTCCATAATCTCATGCAGGAGGG + Intronic
1055768611 9:79692076-79692098 CTCAAAACTAACATGGGGGAGGG - Intronic
1061663704 9:132148007-132148029 CAAAACAATCCCATGGGGGAGGG + Intergenic
1062434947 9:136542857-136542879 CTCATTATTCTCATCAGGGATGG + Intronic
1187142375 X:16606342-16606364 CTCACTAATCTCATGGAGCTGGG + Intronic
1187170058 X:16842153-16842175 CTGAATAATATTATGGGGGGGGG - Exonic
1190002099 X:46698751-46698773 TTCAATAATTTCTTGGGGAAAGG + Intronic
1190096404 X:47484285-47484307 CTTTATAATCTTTTGGGGGAAGG - Exonic
1193431945 X:81418640-81418662 CTGCATAATCTCATGGCAGAAGG + Intergenic
1194399523 X:93426219-93426241 CTCAAAAATCTCATTGGGAATGG - Intergenic
1196727212 X:118906862-118906884 CTCTATTATCTCATGGCAGAAGG + Intergenic
1197770203 X:130084736-130084758 CTCAAACATCTCAAGGGGGAGGG - Intronic
1200896670 Y:8383153-8383175 CACAATAATCTTGTTGGGGATGG + Intergenic