ID: 1103360973

View in Genome Browser
Species Human (GRCh38)
Location 12:120353371-120353393
Sequence CTGGGTAACCTGATGGGGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103360965_1103360973 6 Left 1103360965 12:120353342-120353364 CCGGCTGGCGTAGGTTGTGGCTT 0: 1
1: 0
2: 0
3: 2
4: 77
Right 1103360973 12:120353371-120353393 CTGGGTAACCTGATGGGGCAAGG 0: 1
1: 0
2: 0
3: 18
4: 155
1103360962_1103360973 17 Left 1103360962 12:120353331-120353353 CCTGTATAACTCCGGCTGGCGTA 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1103360973 12:120353371-120353393 CTGGGTAACCTGATGGGGCAAGG 0: 1
1: 0
2: 0
3: 18
4: 155
1103360959_1103360973 29 Left 1103360959 12:120353319-120353341 CCAGGGGCGAGGCCTGTATAACT 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1103360973 12:120353371-120353393 CTGGGTAACCTGATGGGGCAAGG 0: 1
1: 0
2: 0
3: 18
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103360973 Original CRISPR CTGGGTAACCTGATGGGGCA AGG Exonic
901753305 1:11425347-11425369 CTGGGTCTCCTGATAGGTCAGGG + Intergenic
902256967 1:15195834-15195856 CTGGGAATCCTGCTGGGTCAAGG - Intronic
902731132 1:18369602-18369624 CAGGGTGCCCTGATGGTGCAAGG - Intronic
902994887 1:20216632-20216654 CGGGGTCCCCAGATGGGGCAGGG + Intergenic
903274609 1:22212608-22212630 CTGGGCACCGGGATGGGGCAAGG + Intergenic
903278089 1:22234102-22234124 CTGGGGAAACTGGTGGGGGAGGG - Intergenic
906579857 1:46927488-46927510 CTGGCCACCCTGATGGGGTAGGG - Intergenic
906603868 1:47151411-47151433 CTGGCCACCCTGATGGGGCAGGG + Intergenic
907220697 1:52905118-52905140 CTGGGGGACCGGATGGGGGAGGG - Intronic
907694501 1:56708826-56708848 CTGTTGAACCTGATAGGGCAGGG + Exonic
912680580 1:111726545-111726567 CTGGGGAACCTGATGCTCCAGGG + Exonic
912713641 1:111966848-111966870 AAGGGTAAACTCATGGGGCATGG + Intronic
912921175 1:113868743-113868765 GTAGGGGACCTGATGGGGCATGG + Intronic
915467274 1:156104972-156104994 CTGGGTAGCCTGAGCGGGCCAGG + Intronic
918788084 1:188790443-188790465 CTGGGTAACATGATGAGACCCGG + Intergenic
918981113 1:191560559-191560581 CTGGGTAAAGTCATGGGACAAGG + Intergenic
919606226 1:199688105-199688127 CTGGCTAACCAGCTGGGGTAAGG - Intergenic
919733891 1:200932428-200932450 CTGGGCAACCTAATGGTTCAAGG + Intergenic
921761146 1:218916582-218916604 CTGGGTAACAGAATGAGGCAGGG + Intergenic
922724313 1:227915349-227915371 CTGTGTAGCCAGGTGGGGCAGGG + Intergenic
1065378759 10:25068044-25068066 CTGGGCAAGCTGATGGAGCCAGG - Intergenic
1067242662 10:44509299-44509321 CTGGGTGACCTGGTGGGGAGGGG + Intergenic
1069090392 10:64193422-64193444 CTGGGAAAAGTGATGGGTCATGG - Intergenic
1072874952 10:99162733-99162755 CTTGGTAAACTGAAGGGGCAGGG - Intronic
1075720838 10:124586403-124586425 CTGGATCACATGTTGGGGCAGGG - Intronic
1078079023 11:8190716-8190738 ATTGGTAACCTAATGGGGCACGG - Intergenic
1079302531 11:19290951-19290973 TTGGGTTACTTGCTGGGGCAGGG - Intergenic
1080540302 11:33258029-33258051 CTGGGGATGCGGATGGGGCACGG - Intronic
1082186273 11:49185675-49185697 CTGGGTAACCTGGTGTGAGAGGG + Exonic
1083431413 11:62615391-62615413 CTGGGTAACTTATTGGGGCTGGG - Exonic
1084272061 11:68034256-68034278 CTGGGTAGCCCGCTGGGGGAGGG - Intronic
1084737402 11:71114353-71114375 CTGGGTAAAATGATGGTGCGGGG + Intronic
1086680058 11:89659696-89659718 CTGGGTAACCTGGTGTGAGAGGG - Intergenic
1088574758 11:111259815-111259837 CTGGGTAATATGATGGGGACAGG - Intronic
1091814661 12:3428181-3428203 CTGGGAAACCTGCTGGGTTAAGG + Intronic
1092165682 12:6341166-6341188 CTGGGACACTGGATGGGGCAGGG - Intronic
1093416842 12:18929830-18929852 CTGGATACCCTGATAGGACAGGG + Intergenic
1096477652 12:51918084-51918106 CTGGGAAACAGGATGGGGCACGG + Intronic
1097063420 12:56302447-56302469 CTTGGGAACTTGAAGGGGCAAGG + Intronic
1101225639 12:102685645-102685667 CTGGGTAAACTGATTGTTCATGG + Intergenic
1102204762 12:111082887-111082909 CTGGGTAGCTTGGTGGGCCATGG + Intronic
1102780136 12:115557208-115557230 TTGGGTAGACTGATGGGGCTGGG - Intergenic
1103360973 12:120353371-120353393 CTGGGTAACCTGATGGGGCAAGG + Exonic
1103763355 12:123266403-123266425 CAGGGCAGCCTGGTGGGGCATGG + Intronic
1103959459 12:124599918-124599940 CTGAGAAGCCTGATGAGGCAGGG - Intergenic
1104724805 12:131069298-131069320 CTGAGTAACATGGTGGGTCACGG + Intronic
1104802504 12:131564186-131564208 CTGAGTAACATGGTGGGTCACGG - Intergenic
1119460126 14:74794947-74794969 CTGGGTCACCCCATGAGGCAAGG - Intronic
1121780508 14:96619016-96619038 CTGGGAAAGCTGATAGGTCATGG + Intergenic
1123479031 15:20614106-20614128 ATGGAGAAGCTGATGGGGCAGGG + Intergenic
1123638981 15:22386279-22386301 ATGGAGAAGCTGATGGGGCAGGG - Intergenic
1124625983 15:31307818-31307840 CTGGCTCACCTGAAGGGGCTAGG + Intergenic
1126430697 15:48580734-48580756 CTGGGTAGCCTGAAGTGACATGG - Intronic
1127844393 15:62856849-62856871 CTGGGTTCCCTGATGTGGTAAGG + Intergenic
1128352630 15:66901240-66901262 CTGGGGAACCAGAAGAGGCAGGG + Intergenic
1129616912 15:77105937-77105959 CTGGGTGATGTGATGGGGAAGGG + Exonic
1131261957 15:90892197-90892219 GTGGGGAATCAGATGGGGCAGGG - Intronic
1132467341 16:83401-83423 CTGGCTACGCTGACGGGGCAGGG + Intronic
1134439654 16:14291285-14291307 ATGGGAAACCTGACAGGGCAGGG - Intergenic
1135040236 16:19112765-19112787 CTGTGTAACCTTGTGGGGGAGGG + Intergenic
1135286907 16:21201337-21201359 CTGGGTAACCTGATAGTACAGGG + Intronic
1136050512 16:27646821-27646843 CTGGGTGACCTCATGGAGCAAGG - Intronic
1136506057 16:30704102-30704124 CTGGGGAACTGGATGAGGCAGGG - Exonic
1137441860 16:48504769-48504791 CTGCGGAAGCTGGTGGGGCAGGG + Intergenic
1139374401 16:66487780-66487802 CTAGGTGGGCTGATGGGGCATGG - Intronic
1139515918 16:67452324-67452346 CTGGGACACCTGAAGGGCCAGGG - Intronic
1142641925 17:1289353-1289375 ATGGGGAACCTGGTGGGGGATGG - Intronic
1143348262 17:6266462-6266484 CTCAGTCTCCTGATGGGGCAAGG - Intergenic
1143895273 17:10131113-10131135 CTGGGTAACCTGGAGGGGTCAGG - Intronic
1144438269 17:15260591-15260613 CTGGGAACCCAGATGGGGAAGGG + Intronic
1144825601 17:18104052-18104074 GAGGGTACCCTGGTGGGGCAAGG + Intronic
1145236914 17:21214647-21214669 CTCGGTGACCTTATGGGCCAAGG - Intergenic
1148225624 17:45896318-45896340 CTGGGCAACCTGGTGTGGCGTGG - Intronic
1148760734 17:49998465-49998487 GTGGGTCACCTGCAGGGGCAGGG + Intergenic
1148798250 17:50207848-50207870 CTGGGTAGGCTGATGGGAAAAGG + Intergenic
1149996907 17:61410412-61410434 GTGGGCAGCCTGTTGGGGCAGGG - Intergenic
1151326888 17:73385184-73385206 GTGGGTGACCTGCTGAGGCAAGG + Intronic
1151758713 17:76088915-76088937 CAGGGCATCCTGAGGGGGCAGGG + Exonic
1152643250 17:81457830-81457852 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152643321 17:81458010-81458032 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152935172 17:83132534-83132556 CTGGGGAACCTGGTGGGGCGGGG - Intergenic
1153988159 18:10371591-10371613 CTCGGGACCCTGCTGGGGCAGGG - Intergenic
1155120356 18:22813061-22813083 CTGTGTGACCTGATGGGCAAGGG - Intronic
1156479124 18:37425178-37425200 CTGGGCAACCTGAAGGTGCTCGG + Intronic
1159168840 18:64736592-64736614 CTGGGTAACTTGATGGCTCATGG - Intergenic
1160054272 18:75464646-75464668 CTGGGATGGCTGATGGGGCATGG - Intergenic
1161366815 19:3884770-3884792 CAGGGGAACCTCATGGGGCTCGG + Intronic
1162531099 19:11236919-11236941 CTGGGTGACCTGATCAGTCAGGG - Intronic
1163233061 19:16016704-16016726 CTGGGGATGCAGATGGGGCAGGG - Intergenic
1163661651 19:18581594-18581616 TTGGGTAGCCTGATGGCACAGGG - Intronic
1167331468 19:48859042-48859064 CTGTGTCTCCTGAGGGGGCAGGG + Exonic
925458485 2:4040075-4040097 CTGGGTAACCTAATGAGGAGAGG - Intergenic
932252885 2:70259470-70259492 CTGGCTACCATGATGGTGCAGGG + Exonic
934576739 2:95406650-95406672 CGGGGTAACCGGAAGGGGAAAGG + Intronic
934638958 2:96014818-96014840 CGGGGTAACCGGAAGGGGAAAGG + Intergenic
934794691 2:97090594-97090616 CGGGGTAACCAGAAGGGGAAAGG - Intronic
938386404 2:130870218-130870240 CAGGGTAGGCTGAAGGGGCAAGG + Intronic
939377778 2:141392086-141392108 CTGGTTAAGCTGATGAAGCAAGG + Intronic
939891902 2:147746516-147746538 CTGGGTTCCCTGATGGTACATGG - Intergenic
944929893 2:204506682-204506704 ATGGGTAACCTTTTGGGGTAAGG + Intergenic
947820066 2:233063288-233063310 CTGGGTGATCTGAGGGGCCATGG - Intronic
948201998 2:236136127-236136149 CAGGGAAGCCTGATGGGGCCAGG - Intergenic
1172482792 20:35280903-35280925 CTGGGAAAGCTGATTGGGCTGGG - Intronic
1172594695 20:36142683-36142705 CTGGGTGGCCTGATGGGGCTGGG + Intronic
1173932511 20:46832648-46832670 CTGGGTCATCTGCTGGGGCTGGG - Intergenic
1173999520 20:47364251-47364273 CTGGGAAACAGGACGGGGCACGG - Intergenic
1175326834 20:58135481-58135503 CTGGCTTACCTGAGGGGGCTTGG - Intergenic
1175641094 20:60631172-60631194 CTGGGCAATCTGAGTGGGCATGG - Intergenic
1178670615 21:34588279-34588301 GTGGGTAACTTGGTGGGCCATGG + Intronic
1179475650 21:41641879-41641901 CTGGGGAACCTGATAGGGTCTGG - Intergenic
1179821398 21:43939339-43939361 CTGGGAAACCTCCTGGGGCGCGG - Intronic
1179908177 21:44434902-44434924 CGGGGTCACCTGGTGGGGGAAGG - Intronic
1179995055 21:44970429-44970451 CTGGGTTACCTGTTGGTGCTCGG - Intronic
1180077053 21:45468287-45468309 CTGGGTGACCTGCTGGGGCGGGG - Exonic
1183345603 22:37305922-37305944 CTGGCCATCCAGATGGGGCAGGG + Intronic
1185013655 22:48331287-48331309 CTGGGTAGGCAGGTGGGGCAAGG - Intergenic
1185203134 22:49520761-49520783 CTTGCTACCCTTATGGGGCACGG - Intronic
949134994 3:553944-553966 CTGGGTATCCTGTTGGTCCAAGG - Intergenic
951907587 3:27720384-27720406 CTGGGGAACCCGCTGGGGCCTGG - Intronic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
962704241 3:138027860-138027882 CTGGGTAGGATGAGGGGGCAGGG + Intronic
962757015 3:138472714-138472736 CTGGGTGACTTGATGGGCCCTGG - Exonic
964791144 3:160453694-160453716 CTGGGTAACTTATTGGGGCTGGG + Intronic
968689040 4:1980678-1980700 CTGGGGACCCTGATGGGAGAAGG - Exonic
969154473 4:5198354-5198376 ATTTGTAATCTGATGGGGCATGG + Intronic
972836747 4:42880292-42880314 CTGTGGAACGTGAGGGGGCATGG - Intergenic
977290388 4:95159526-95159548 CAGGGAATCCTGATGGGGCGGGG + Intergenic
981026950 4:140086269-140086291 CAGGGGACGCTGATGGGGCAGGG - Intronic
982320549 4:154072688-154072710 CTGGGTGAGCTTTTGGGGCAGGG + Intergenic
985008713 4:185560531-185560553 CTGGGAGACCTGAAGGTGCAGGG - Intergenic
988823367 5:34910231-34910253 CTGGGTAACGAGATGGACCATGG - Intronic
989120332 5:37998349-37998371 CTGGGTATCCTTATCTGGCAGGG + Intergenic
990187399 5:53223061-53223083 TTGGGTATCCTGATGGCACAGGG + Intergenic
993870874 5:93252627-93252649 CTAGATAACCTCATGGGCCATGG + Intergenic
998552471 5:143090673-143090695 CTGGGTTAGCTGATGGGGGAGGG + Intronic
1001513609 5:172339767-172339789 CTGGGTCACCTCGTGGGGCAGGG + Exonic
1002636935 5:180613189-180613211 CGGGGTGACTTGATGGGGAAGGG - Intronic
1002943210 6:1735589-1735611 CTGGGTAAGCTGATGAGCGAGGG - Intronic
1003303770 6:4908263-4908285 CTGGTTAACCTGATGGGAAAGGG + Intronic
1007732216 6:43954198-43954220 CTGGGTCTCCTCATGGGGCAGGG + Intergenic
1008745781 6:54667925-54667947 CTGGGTGGGCTGATTGGGCAAGG + Intergenic
1009399705 6:63239808-63239830 CAGGGTCATCTGTTGGGGCAGGG + Intergenic
1015910450 6:138163492-138163514 CTGGGTAACATGATAAAGCAGGG + Intronic
1018042098 6:159933830-159933852 CAGGGGAAGCTGATGGGGAATGG + Intergenic
1019736005 7:2650007-2650029 CTGGGGAACCCGCTGGGACACGG - Intronic
1020116985 7:5481548-5481570 CTGGGTGACATGAGGGGGCTCGG - Exonic
1020564868 7:9782413-9782435 CTGAGTAATCTGAGAGGGCAAGG - Intergenic
1024208243 7:47182030-47182052 CTTGGGAAGCTGCTGGGGCATGG - Intergenic
1024554079 7:50588302-50588324 CTGGGAAATGGGATGGGGCAGGG + Intergenic
1024711386 7:52018961-52018983 CTGGGTAACCTGGTGCGCCCAGG - Intergenic
1026230401 7:68478255-68478277 ATGGGCAACCTGATGGTGTAAGG + Intergenic
1029350854 7:100011896-100011918 CTGGGGAACCTGCTGTGGGAAGG - Intergenic
1031986452 7:128167265-128167287 CTCGGGAACCTGCTGGGGGAGGG - Intergenic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1039850340 8:41359170-41359192 CTGGCTAACCTGATTTAGCAGGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044091708 8:88010608-88010630 CTTGGCAAGCTGATTGGGCAGGG - Intergenic
1044496251 8:92888086-92888108 CTGTGTAACCAGATGGGTCTGGG - Intronic
1044618640 8:94167384-94167406 CTGTGTCAGCTGATGGGGGAGGG - Intronic
1044935881 8:97293006-97293028 CTGGGTAACTTGTTGAGGCAGGG + Intergenic
1044939084 8:97322123-97322145 CAGGCTAAGCTGCTGGGGCAGGG + Intergenic
1050071014 9:1814158-1814180 CTGGATAATATGAGGGGGCAGGG + Intergenic
1050975504 9:11932667-11932689 GTGGGGCACATGATGGGGCAGGG + Intergenic
1056765658 9:89443127-89443149 CTAGGGGACCTGATGGGGCTGGG - Intronic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060484241 9:124037111-124037133 CTGGGGAACGTGATGAGGCCAGG + Intergenic
1061291675 9:129653888-129653910 CTGGGTGATTTGATGGGGCAGGG + Intergenic
1062389875 9:136329765-136329787 CTGGGTACCCTGAGGGGCCCTGG + Intronic
1062628961 9:137455143-137455165 CTGGCAGACCTGATGGGGGAAGG - Intronic
1185486028 X:482196-482218 CTGGGGAACCTGGCCGGGCATGG - Intergenic
1186707233 X:12154519-12154541 CTGGATAACCTGGAAGGGCAGGG - Intronic
1193475459 X:81959097-81959119 CTGGGCAGCCTGATGTAGCAGGG + Intergenic
1194480388 X:94414826-94414848 CATGGTAACCTGATGGCCCATGG + Intergenic
1195512004 X:105726706-105726728 CTGGGTTCTCTTATGGGGCAAGG - Intronic