ID: 1103361464

View in Genome Browser
Species Human (GRCh38)
Location 12:120356868-120356890
Sequence CAGAAAGAAGCCGCAGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 194}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103361459_1103361464 4 Left 1103361459 12:120356841-120356863 CCCTGCTAGTCCTGGGAGCAGTT 0: 1
1: 0
2: 1
3: 9
4: 109
Right 1103361464 12:120356868-120356890 CAGAAAGAAGCCGCAGGCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 194
1103361455_1103361464 13 Left 1103361455 12:120356832-120356854 CCACACAGCCCCTGCTAGTCCTG 0: 1
1: 0
2: 3
3: 32
4: 323
Right 1103361464 12:120356868-120356890 CAGAAAGAAGCCGCAGGCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 194
1103361454_1103361464 14 Left 1103361454 12:120356831-120356853 CCCACACAGCCCCTGCTAGTCCT 0: 1
1: 0
2: 4
3: 22
4: 216
Right 1103361464 12:120356868-120356890 CAGAAAGAAGCCGCAGGCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 194
1103361462_1103361464 -6 Left 1103361462 12:120356851-120356873 CCTGGGAGCAGTTCTGGCAGAAA 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1103361464 12:120356868-120356890 CAGAAAGAAGCCGCAGGCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 194
1103361458_1103361464 5 Left 1103361458 12:120356840-120356862 CCCCTGCTAGTCCTGGGAGCAGT 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1103361464 12:120356868-120356890 CAGAAAGAAGCCGCAGGCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 194
1103361460_1103361464 3 Left 1103361460 12:120356842-120356864 CCTGCTAGTCCTGGGAGCAGTTC 0: 1
1: 0
2: 0
3: 20
4: 99
Right 1103361464 12:120356868-120356890 CAGAAAGAAGCCGCAGGCGCAGG 0: 1
1: 0
2: 0
3: 15
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103361464 Original CRISPR CAGAAAGAAGCCGCAGGCGC AGG Intronic
900004980 1:39218-39240 CAGAAAGAGGCAGCAGGGGAAGG - Intergenic
900804465 1:4758288-4758310 GAGAAAGAAGCATCAGGGGCTGG + Intronic
901315334 1:8303566-8303588 CAGAAATAAGCCTCAGAGGCTGG + Intergenic
901680082 1:10908005-10908027 CCGAAAGTAGCCCCAGGCTCAGG + Intergenic
902076704 1:13792787-13792809 CAGAAAGGTGCCCCACGCGCTGG - Intronic
903436964 1:23357277-23357299 CAGAAAGCAGCTGCAGGGGCTGG + Intergenic
903884441 1:26532652-26532674 CAGGAAGCAGCCCCAGGAGCTGG - Intronic
904047182 1:27615779-27615801 CATCATGAAGCCGCAGACGCTGG - Exonic
904548703 1:31297279-31297301 AAGAAGGGAGCCGCAGGGGCTGG - Intronic
907123934 1:52032949-52032971 CAGAAAGCTGCCGGAGGCGAGGG + Exonic
907274994 1:53311978-53312000 TAGAAAGAAGCTGGAGGCGCTGG - Intronic
908801843 1:67888718-67888740 CTGAAAGAAGCTGCAGGCAAAGG + Intergenic
909846360 1:80399559-80399581 CAGACAGAAGCCTCAGCTGCAGG + Intergenic
912384607 1:109265041-109265063 CAGAGAGAAGCAGCAGCCACTGG - Intronic
912538586 1:110395458-110395480 AAGAATGAAGCCGCAGACCCTGG + Intergenic
915528273 1:156489272-156489294 ATGAAATAAGCAGCAGGCGCTGG + Intronic
917041420 1:170809988-170810010 TGGAAAGAAGCCTCAGGAGCAGG - Intergenic
921614610 1:217251487-217251509 CAGAGAAAAGCTGCAGGTGCTGG + Intergenic
922756939 1:228102096-228102118 CAGGAGGAAGCCGCGGGCGGAGG - Exonic
924464211 1:244285461-244285483 CAGAAAGAAGCCCCAAGGGCAGG - Intergenic
924877544 1:248121999-248122021 CAGAAAGAAGAGGAAGGTGCGGG - Intergenic
1063375546 10:5552258-5552280 CTGAAAGAAGCCGCTGCTGCGGG + Intergenic
1064002253 10:11673369-11673391 CAGAAAGCAGCCGAGGGAGCTGG - Intergenic
1064113750 10:12560148-12560170 CAGAACAAAGCCGCAGGAGCAGG - Intronic
1065530479 10:26665023-26665045 CAGTAAGAAGCAGCATGAGCTGG - Intergenic
1065590543 10:27257872-27257894 AAGAATGAAGCCGCAGACCCTGG - Intergenic
1069299716 10:66890897-66890919 CAGAGAGAAGGAGCAGGGGCAGG + Intronic
1072324151 10:94280101-94280123 CAGAAAGAAGAGGCAGGTGTGGG + Intronic
1072754232 10:98007926-98007948 AAGAAAGAAGCTGAAGGCTCAGG + Intronic
1074781203 10:116803554-116803576 CACACAGAAGCCCCAGGCGGTGG - Intergenic
1075316536 10:121457950-121457972 CAGAAACAGGCTGCAGGCGAAGG - Intergenic
1075940456 10:126387180-126387202 CAGAAAGAAGGCGGCGGCGGCGG + Intronic
1076639106 10:131901601-131901623 CAGGAGGCAGCCCCAGGCGCTGG - Intronic
1076887486 10:133269359-133269381 CAGGCAGAAGCCGCGGGCCCGGG - Intronic
1077154129 11:1083957-1083979 CAGCAGGAAGCAGCAGGGGCCGG - Intergenic
1077265617 11:1648017-1648039 CACAAAGCAGCAGCAGCCGCTGG + Intergenic
1077729460 11:4714073-4714095 CAGAAAGGAGCCTGAGGAGCTGG - Intronic
1079747430 11:24150797-24150819 CAGAAAGAGGACGCAGACCCTGG - Intergenic
1079959354 11:26903935-26903957 GAGATAGAAGCAGCAGGCACAGG + Intergenic
1084086994 11:66859382-66859404 CAGAAATAACACGCGGGCGCGGG - Intronic
1086209894 11:84307444-84307466 AAGAATGAAGCCGCAGGCCAAGG + Intronic
1086337189 11:85811336-85811358 CGGAGAGAAGCAGCAGGCGGGGG - Intergenic
1090456570 11:126855326-126855348 GAGAGAGAAGGCGCAGGAGCCGG - Intronic
1092180730 12:6445069-6445091 CAGAAAGGAGCCGCCTGGGCAGG + Exonic
1096191876 12:49624551-49624573 CAGAAAGAAGCAACAGGGGCCGG + Intronic
1097264070 12:57736053-57736075 CCGAGAGAAGCCACAGGCCCGGG + Intronic
1102285110 12:111649644-111649666 CTCAAAGAAGCCGAAGGCTCTGG + Intronic
1103325449 12:120117047-120117069 CGGAAAGAAGCCCAAGGTGCCGG + Intronic
1103361464 12:120356868-120356890 CAGAAAGAAGCCGCAGGCGCAGG + Intronic
1103436280 12:120929364-120929386 CAGACAGAAGTTGCAGGGGCGGG - Intergenic
1104557359 12:129813009-129813031 CGGAAAGAAGTGGAAGGCGCAGG - Intronic
1105019155 12:132804956-132804978 CAGCACGAAGCTGCAGGCGCAGG - Exonic
1110792230 13:79599361-79599383 AAGAATGAAGCCGCAGACCCTGG + Intergenic
1112692872 13:101916594-101916616 CCGCCAGAAGCGGCAGGCGCGGG - Intronic
1113925720 13:113940387-113940409 CAGACAGAAGACGCAGGTGCTGG + Intergenic
1117011970 14:51480177-51480199 AAGGAAGAAGCAGCAGGCCCTGG + Intergenic
1118320032 14:64747656-64747678 CAGGTAGAAGCCACAGGGGCAGG - Exonic
1121030851 14:90657431-90657453 CACTCAGAAGCCGCAGGCTCTGG - Intronic
1121369905 14:93347367-93347389 CAGACAGGGGCCGCTGGCGCGGG - Exonic
1121651120 14:95559519-95559541 GAGAAAGAAGCCACGGGGGCTGG - Intergenic
1122162250 14:99793185-99793207 GGGAAAGAGGCCGCAGGCGCGGG + Intronic
1202940188 14_KI270725v1_random:137952-137974 CAGCAAAAAGCCGCAGCGGCGGG + Intergenic
1124849579 15:33323440-33323462 CAGAAAGAATCCTCAGCCACTGG - Intronic
1125027683 15:35046962-35046984 TAGAAAGAATCCGAAGGGGCTGG + Intergenic
1125718977 15:41836118-41836140 CAGAAAGAAGGCCCGGGGGCAGG - Intronic
1126827936 15:52569765-52569787 CAGTAAGAAGCCGCAGGACTTGG - Intronic
1128061484 15:64738424-64738446 CCCAGGGAAGCCGCAGGCGCAGG + Intergenic
1129673816 15:77621759-77621781 CAGGCAGCAGCCGCAGGCACAGG - Intronic
1131368097 15:91856253-91856275 CAGAAAGCAGCTGGAGGCCCAGG + Intronic
1132448529 15:101951726-101951748 CAGAAAGAGGCAGCAGGGGAAGG + Intergenic
1137646841 16:50082623-50082645 CACAAAGAAGCCACTGGGGCTGG + Intronic
1138369751 16:56517348-56517370 CACAAGGAAGCCGCTGGGGCTGG - Intronic
1140078711 16:71724208-71724230 GAGAAAGAAGCAGGTGGCGCCGG + Intronic
1141640752 16:85339629-85339651 CAGAGAGAGGCGGCGGGCGCAGG + Intergenic
1142149178 16:88505241-88505263 CAGTAAGGAGCAGCAGGCTCAGG - Intronic
1142352046 16:89585002-89585024 CAACAGGGAGCCGCAGGCGCAGG + Intronic
1142560163 17:804972-804994 CAGAGAGAAGCGGCAGGGACAGG + Intronic
1142882054 17:2889505-2889527 CAGAAAGAGGGCTCAGCCGCCGG - Intronic
1142945417 17:3422334-3422356 CAGAAAGATACCGCAGGGGATGG - Intergenic
1144130145 17:12238908-12238930 AAGAATGAAGCCGCAGACCCTGG + Intergenic
1144769810 17:17753172-17753194 CAGACAGGAGCCCCAGGGGCTGG + Intronic
1144963843 17:19063081-19063103 CAGACACAAGCCACAGCCGCTGG - Intergenic
1144971315 17:19111461-19111483 CAGACACAAGCCACAGCCGCTGG + Intergenic
1144984115 17:19189182-19189204 CAGACACAAGCCACAGCCGCTGG - Intergenic
1145002635 17:19315887-19315909 CAGAAAGAAACCGCATACCCAGG + Intronic
1145239338 17:21230890-21230912 GAGAAAGAAGGCGCAGAAGCAGG - Intergenic
1145327189 17:21842355-21842377 CAGAAAAAAGCCGCGGCGGCGGG - Intergenic
1146185181 17:30720032-30720054 CATAAGGAAGCTGCAGGCCCCGG - Intergenic
1147896884 17:43757051-43757073 CAGAAAGCAGCCCCAGACGATGG - Intronic
1147919504 17:43907304-43907326 CAGAAAGAGGGCCCAGGGGCGGG + Intronic
1152447953 17:80356704-80356726 CAGAAGGAAAACCCAGGCGCTGG - Intronic
1152601513 17:81264571-81264593 CAGAGAGAAGCACCAGGGGCAGG + Intronic
1155399199 18:25419708-25419730 CACACAGAAGCAGCAGGGGCAGG - Intergenic
1155580179 18:27296163-27296185 CAGAATGAAGCAGCAAGTGCTGG - Intergenic
1159134950 18:64326540-64326562 CAGAAAGAGCCCGCAAGCCCAGG - Intergenic
1159535914 18:69714396-69714418 CAGAAAGAATCAGGAGGCCCAGG - Intronic
1160388979 18:78516014-78516036 CAGAAAGAAGCCGAAAGTGAGGG + Intergenic
1160636732 19:80827-80849 CAGAAAGAGGCAGCAGGGGAGGG - Intergenic
1161107816 19:2453352-2453374 CAGAGAGCAGCCTCAGGCTCAGG - Intronic
1161800514 19:6414903-6414925 CAGGAACAAGCAGCCGGCGCAGG + Intronic
1162389431 19:10380443-10380465 CAGGAAGAAGCCGCGGGGACTGG - Exonic
1162773502 19:12965012-12965034 CAGAAAAAAGCCTCAGGAGGAGG - Intergenic
1162973598 19:14195657-14195679 CATAAGGAAGCCGCAGGCCCTGG + Intronic
1164508906 19:28881865-28881887 CAGAGACAAGCCGCGGGTGCGGG - Intergenic
1164880941 19:31732336-31732358 CAAAAATTAGCCGCAGGCGGTGG + Intergenic
1167607051 19:50487047-50487069 TTGAGAGAAGCCACAGGCGCCGG - Exonic
1167747752 19:51362736-51362758 CAGGAAGTGGACGCAGGCGCTGG + Intronic
925423149 2:3727775-3727797 CAGAGCGAAGCAGCAGGCACAGG - Intronic
928082432 2:28323007-28323029 CAGTAAGAAGCGGCAGGCCAAGG + Intronic
929979976 2:46669163-46669185 CCAAAAGAAGCCACAGGCCCTGG + Intergenic
930621957 2:53652917-53652939 CAGAAATAAGCCTCAGAGGCTGG - Intronic
934503168 2:94874426-94874448 CAAAAAGAGGGCGCGGGCGCTGG + Intronic
934702458 2:96453116-96453138 CAAAAAGTGGCCCCAGGCGCAGG - Intergenic
934782260 2:96978468-96978490 CAGAAGGAAGCCACAGACACTGG - Intronic
935312677 2:101801081-101801103 CAGAAAGCAGCAGCAGCAGCTGG - Intronic
935945158 2:108279528-108279550 CACAAAGAAGCCAGAGGTGCAGG + Intergenic
936557352 2:113508290-113508312 CAGAAAGAAGCTGGAGGTGGGGG + Intergenic
938280553 2:130060883-130060905 AAGAAAGGAGCAGCAGGCTCAGG - Intergenic
940102323 2:150055420-150055442 GAGAGAGAAGCGGCAGGGGCGGG - Intergenic
942724744 2:178994228-178994250 CAGAAATTTGCCGCAGGGGCAGG - Intronic
943085620 2:183307349-183307371 GAGAAAGAAGCTGCAGGCAAGGG + Intergenic
944636441 2:201680093-201680115 TAGAAAGAAGCAGCAGTCCCAGG - Intronic
1169265746 20:4166511-4166533 CAGAAAGAAGCCAGAGAGGCTGG - Intronic
1169939861 20:10925391-10925413 CAGAAAGAAGACCCATGTGCTGG + Intergenic
1170693058 20:18632439-18632461 CAGAGAGAGGCCCCAGGCACAGG - Intronic
1170891027 20:20375501-20375523 CAGAAGGAAGCAGCAGGTCCTGG - Intergenic
1171810937 20:29743783-29743805 CAGAGAGAGGCGGCAGGCGGGGG + Intergenic
1174399878 20:50270243-50270265 CAGAACGCAGCAGCTGGCGCCGG + Intergenic
1175183297 20:57163357-57163379 CTGAGAGAAGCCTCAGGAGCTGG + Intergenic
1175216658 20:57394853-57394875 CAGAAAAGAGCTGCAGGCACTGG - Intronic
1175887911 20:62302817-62302839 CGGAAAAGAGCCGCCGGCGCGGG + Intronic
1176105630 20:63384526-63384548 CAGGAAGAAGCTGCAGCAGCTGG - Intergenic
1176221068 20:63969649-63969671 CAGGAAGACGGCGCCGGCGCGGG + Intronic
1178639336 21:34333609-34333631 AAGAGAGAAGCTGCAGGCGAGGG + Intergenic
1178948272 21:36966263-36966285 CAGAGAGAGGCCGGAGGTGCGGG - Intronic
1179906481 21:44425713-44425735 CAGGAAGAAGACGGAGGAGCCGG + Exonic
1180800206 22:18628218-18628240 CAGCAGGAAGCCACAGGGGCAGG + Intergenic
1180851439 22:19023782-19023804 CAGCAGGAAGCCACAGGGGCAGG + Intergenic
1181168091 22:20993983-20994005 CAGGAAGATCACGCAGGCGCGGG + Exonic
1181221510 22:21367048-21367070 CAGCAGGAAGCCACAGGGGCAGG - Intergenic
1181258961 22:21583626-21583648 CAGAAAGAAGCCACCTGCACTGG - Intronic
1182279218 22:29208407-29208429 CAGGAAGCAGCCCCAGGGGCAGG - Intronic
1182476735 22:30580653-30580675 CAGGAAGGAGCTGGAGGCGCAGG - Exonic
1183211874 22:36456040-36456062 CAGAAAGGAGCAGCAGGTGCAGG - Intergenic
1203238329 22_KI270732v1_random:30299-30321 CAGAAAAAAGCCGCGGCAGCGGG - Intergenic
954744373 3:52778746-52778768 CAGCAAGAAGCCTCAGACTCTGG - Intronic
955818589 3:62874053-62874075 CAGAGAGCAACCGCAGGGGCAGG - Intronic
956468395 3:69541440-69541462 GAGAAAGCAGCCGCAGGAGGAGG - Intronic
957546453 3:81644414-81644436 CAGAAAGGAACAGCAGGTGCAGG + Intronic
960510271 3:118541222-118541244 AAGAAAGAAGCAGGAGGGGCAGG + Intergenic
964089864 3:152862745-152862767 CAGAAAGAAGAAGCAGGGGAAGG - Intergenic
966881415 3:184353257-184353279 CAGACAGAAGCCTCAGGGGTAGG + Exonic
970441134 4:16082483-16082505 CAGAATGAAGCCTGGGGCGCCGG + Intronic
971195619 4:24470471-24470493 CTGAAGGAAGCCACCGGCGCCGG + Intergenic
971938784 4:33188589-33188611 CAGAAAGAAGGCCCTGGAGCAGG + Intergenic
974274516 4:59700761-59700783 GAGAAACAAGCAGCAGGAGCAGG - Intergenic
974992688 4:69114337-69114359 AAGAATGAAGCCGCAGACCCTGG + Intronic
978163735 4:105581168-105581190 CAGAAGGAAGCCACAGATGCTGG - Intronic
980550443 4:134328007-134328029 CAGGAAGGAGCTGGAGGCGCAGG + Intergenic
981092133 4:140742851-140742873 AAGAAAGAAGGTGCAGGGGCAGG + Intronic
981615494 4:146639669-146639691 CAGAAAGAAGCCGAGAGTGCAGG - Intronic
983159680 4:164396651-164396673 CAGATAGAAGAAGCAGGAGCAGG + Intergenic
983324941 4:166241883-166241905 CAGAAAGAAGGAGCAGACCCTGG - Intergenic
987058311 5:14217340-14217362 CAGAAAGAAGCTGCAGGTGTAGG - Intronic
987923821 5:24315488-24315510 AAGAATGAAGCCGCAGACCCTGG - Intergenic
989571845 5:42952594-42952616 AAGAAAGAAACCGCTGGCGCCGG + Intergenic
994083203 5:95731144-95731166 CACAAAGGAGCCGCCCGCGCGGG - Intronic
994149589 5:96432635-96432657 CAGAAGGAAGCCGCTGCAGCTGG - Intronic
997302493 5:132815415-132815437 CAGAAAGAAGCTGGAGGTGCAGG - Exonic
1000575458 5:162970130-162970152 GTGAAAGAAGCCACAGGGGCTGG + Intergenic
1001137476 5:169114676-169114698 AAGAAAGCAGCTGCAGGCACAGG - Intronic
1001638728 5:173230774-173230796 CAGAGAGACACCACAGGCGCTGG + Intergenic
1003954115 6:11146413-11146435 CAGAAAGAAGCCCAGGGCCCCGG + Intergenic
1004035283 6:11917425-11917447 GAGAAAGAAGCCACAGGGGCCGG + Intergenic
1007359246 6:41343227-41343249 TAGAAAGATGCTGCAGGCGCTGG - Intronic
1007631736 6:43276664-43276686 AAGAAAGCAGGCGGAGGCGCAGG - Intronic
1009684366 6:66936988-66937010 CAGAAAGCAGCGGCAGGGCCAGG + Intergenic
1009827370 6:68883787-68883809 AAGAATGAAGCCGCAGACCCTGG - Intronic
1011051058 6:83150085-83150107 AAGAAAGAAGCCACATGCGGTGG + Intronic
1012923641 6:105245290-105245312 CAGAAAGAACCCTCAGCTGCAGG - Intergenic
1013556144 6:111259317-111259339 CAGCAAGCAGGCGCATGCGCGGG - Intergenic
1014018858 6:116565486-116565508 CCGAAAGCAGCCGCAGGGCCAGG - Intergenic
1018056484 6:160056605-160056627 CAGAAAGAAGGGGCAGGGGTCGG - Intronic
1019475692 7:1243008-1243030 CAGAAAGAATCAGCAGAAGCCGG - Intergenic
1020274509 7:6616049-6616071 CAGAAAGAGCCAGGAGGCGCAGG - Exonic
1024775225 7:52777087-52777109 CAGAATAAAGCCACAGGTGCTGG - Intergenic
1028094387 7:86742233-86742255 TAGAAAGAAGCAGCAGGATCAGG + Intronic
1028125065 7:87103542-87103564 CAGAAAGAAGACGAAGTCACTGG - Intergenic
1030273760 7:107697585-107697607 CACAAAGAAGCGCCAGGCACTGG + Intronic
1033094023 7:138414079-138414101 CAGGAAGATTCAGCAGGCGCAGG - Intergenic
1033176955 7:139133696-139133718 AACCAAGAAGCCGCGGGCGCTGG + Intergenic
1035243855 7:157549993-157550015 CAGGAAGAAGCCGCAGCCATTGG + Intronic
1035759502 8:2059056-2059078 CAGAAATGGGCAGCAGGCGCGGG + Intronic
1038798186 8:30727676-30727698 CAGGCAGGAGCCGCAGCCGCAGG - Exonic
1039883051 8:41638701-41638723 CAGAAAGTAGCAGCAGGAGTGGG + Intergenic
1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG + Exonic
1049887675 9:39000-39022 CAGAAAGAGGCAGCAGGGGAGGG - Intergenic
1049895651 9:109009-109031 CAGAAAGAAGCTGGAGGTGGGGG - Intergenic
1051188732 9:14488024-14488046 CAGAAAGGAGCAGCAGGTTCAGG + Intergenic
1053738828 9:41119187-41119209 CAGAAAGAAGCTGGAGGTGGGGG - Intergenic
1054689516 9:68312128-68312150 CAGAAAGAAGCTGGAGGTGGGGG + Intergenic
1057142692 9:92737118-92737140 CTGAAATAAGCTGCAGGGGCAGG + Intronic
1058297964 9:103332639-103332661 CAGAAAGAAGGCGCAAGAACTGG - Intergenic
1058786684 9:108394817-108394839 AAGAATGAAGCCGCAGACCCTGG - Intergenic
1061070964 9:128310475-128310497 CAGAAAAAAGGGGCGGGCGCAGG + Intronic
1061693632 9:132355068-132355090 CAGAAAGCAGCGGCCGGGGCGGG - Intergenic
1185469373 X:373571-373593 CAGCACGAAGTCGCAGCCGCGGG + Intronic
1185641869 X:1592793-1592815 GAGAAAGAAGGCGCAGACGGGGG + Intronic
1187332894 X:18356357-18356379 CAGAAAGAGGCCGGACGCGGTGG + Intergenic
1202003064 Y:20184277-20184299 AAGAAAGAAGCTGCAGGCCTTGG + Intergenic