ID: 1103363680

View in Genome Browser
Species Human (GRCh38)
Location 12:120368385-120368407
Sequence GGCGGCAGTGGAGAACGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103363680_1103363701 30 Left 1103363680 12:120368385-120368407 CCCGCGCGTTCTCCACTGCCGCC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1103363701 12:120368438-120368460 GAGCCTCCTGGCGCCCACCGGGG 0: 1
1: 0
2: 1
3: 16
4: 171
1103363680_1103363699 28 Left 1103363680 12:120368385-120368407 CCCGCGCGTTCTCCACTGCCGCC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1103363699 12:120368436-120368458 CTGAGCCTCCTGGCGCCCACCGG 0: 1
1: 0
2: 2
3: 25
4: 270
1103363680_1103363700 29 Left 1103363680 12:120368385-120368407 CCCGCGCGTTCTCCACTGCCGCC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1103363700 12:120368437-120368459 TGAGCCTCCTGGCGCCCACCGGG 0: 1
1: 0
2: 1
3: 19
4: 214
1103363680_1103363695 18 Left 1103363680 12:120368385-120368407 CCCGCGCGTTCTCCACTGCCGCC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1103363695 12:120368426-120368448 CCCGTTCCCGCTGAGCCTCCTGG 0: 1
1: 0
2: 0
3: 15
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103363680 Original CRISPR GGCGGCAGTGGAGAACGCGC GGG (reversed) Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
901109622 1:6784892-6784914 GGTGGCTGTGGGGGACGCGCCGG - Intergenic
901830368 1:11888455-11888477 AGAGGCAGTGGAGAAAGGGCTGG - Intergenic
903181295 1:21606208-21606230 GGTGGCAGTGGAGGAGGCACAGG + Intronic
903205998 1:21783003-21783025 GGCGGCGGTGCAGACCGCGGCGG - Exonic
903855550 1:26336080-26336102 GGCGGCAGGTGAGAACGTGGAGG - Exonic
905505595 1:38476605-38476627 TGCGGCGGTGGAGAGGGCGCGGG - Intergenic
908750236 1:67415212-67415234 GGCGGCAGGGGAGGACGAGGTGG - Exonic
910285302 1:85547114-85547136 GGCCGGAGTGGAGAACACCCTGG + Intronic
914491256 1:148151928-148151950 GGCGGCGGTGGAGATAGCGGCGG - Exonic
915701621 1:157802125-157802147 GGCTGCAGTGGAGGATGTGCTGG - Exonic
915927220 1:160031924-160031946 GGCGGCTGAGAAGACCGCGCGGG - Exonic
916890099 1:169106089-169106111 GGCGGCGGTGAGGGACGCGCAGG - Intronic
918114177 1:181482888-181482910 GGCGGCGGTGGCGAGCGCTCCGG + Intronic
918480649 1:184974039-184974061 GGCGGGAGCGGCGAAGGCGCCGG + Intronic
921277264 1:213532563-213532585 GGGTGCAGTGGAGAACGGGGAGG - Intergenic
923012161 1:230096461-230096483 GGCGGGAGGGGAGAACGAGATGG - Intronic
1064022792 10:11823319-11823341 GGCGGCAGTAGAGCGCGCGCGGG + Intronic
1065019886 10:21495317-21495339 GGGGGCAGTGGCGGACCCGCAGG - Exonic
1065637494 10:27745806-27745828 GGTGGCGGTGGTGAGCGCGCTGG - Exonic
1067080067 10:43207787-43207809 GGCTGGAGTGGAGAGCGCGTTGG - Intronic
1067203470 10:44194563-44194585 GGTGGCAGTGGAGAAGTCCCTGG - Intergenic
1067567020 10:47346721-47346743 GGAGGCAGAGGAGAAGGCCCAGG + Intergenic
1072918377 10:99554774-99554796 GGCTGCAGTGGAGAGCGGGTGGG + Intergenic
1073120838 10:101121858-101121880 GGCAGCAGTGGAGGATGTGCCGG + Intronic
1073444100 10:103570741-103570763 GGCGGCAGTGGTGAAAGAACTGG + Intronic
1075705051 10:124495471-124495493 GCAGGCAGTGGAGGACGCACAGG + Intronic
1076737604 10:132465765-132465787 GGAGGCCGTGGAGAACCAGCTGG + Intergenic
1077426423 11:2480934-2480956 GGGGGCAGTGTAGAAACCGCAGG + Intronic
1078069386 11:8098209-8098231 GGGGGCAGTGGTGAAGGGGCAGG + Intronic
1083635232 11:64117305-64117327 GGCGGCCGTGGTCAACGTGCGGG + Exonic
1083885972 11:65573720-65573742 GGCGGTAGGGGGGAAGGCGCAGG - Exonic
1084119312 11:67059735-67059757 GGGGGCTGTGGAGAAGGCCCTGG - Intronic
1084638763 11:70411787-70411809 GGCTGCTGTGGAGACCGCACAGG - Intronic
1089689915 11:120180836-120180858 GGGGGCACTGGAGAAGGCCCAGG - Intronic
1090833649 11:130438223-130438245 GGCGGCAGGGAGGAACGCGGTGG + Intergenic
1091741700 12:2964043-2964065 GGGGGCAGTGCAGAGGGCGCTGG + Intronic
1092727615 12:11500412-11500434 GGCGGCGGTGGGGAGCGCGAGGG - Intronic
1099955941 12:89352726-89352748 GGCGGCAGCGGAGGAGGAGCAGG + Exonic
1103363680 12:120368385-120368407 GGCGGCAGTGGAGAACGCGCGGG - Intronic
1103447782 12:121005491-121005513 GGAGCCAGTGGAGGGCGCGCTGG + Intronic
1103909586 12:124344907-124344929 GGAGCCAGTGGTGGACGCGCCGG + Exonic
1110483358 13:76009692-76009714 GGTGGCAGTGGAGGAAGGGCAGG - Intergenic
1113117121 13:106885405-106885427 GGGGACAGTGGAGCACGCACTGG - Intergenic
1113968319 13:114167304-114167326 GGTGTCAGTGGAGAAGGGGCCGG + Intergenic
1117523503 14:56574826-56574848 GGTGGCAGTGGAGACCACGTGGG + Intronic
1118774059 14:68962397-68962419 GGCGGCTGTGGAGGAGGTGCTGG - Intronic
1124448701 15:29764567-29764589 GGAGGCAGTGGAGAAAGAGTGGG + Intronic
1128527693 15:68423683-68423705 GACGGCTGTGGAGAAAGCTCTGG + Intronic
1128582147 15:68818112-68818134 GGCGGGGGTGCAGTACGCGCGGG - Intronic
1129235455 15:74221267-74221289 GGGGGCAGTGGAGCAGGGGCAGG + Intergenic
1130820357 15:87488670-87488692 TGCAGCAGTGGAGAACTGGCTGG - Intergenic
1132934495 16:2473910-2473932 GGCGGCCGGGGAGCAGGCGCGGG - Exonic
1133062553 16:3184028-3184050 GGCGTCAGTGGAGACCTCCCGGG - Intergenic
1133315945 16:4884172-4884194 GGCTGCACTGGAGAAGGCGGAGG - Exonic
1135597425 16:23754987-23755009 GGCGGGAGGAGAGAACGCGTGGG + Exonic
1136546577 16:30958165-30958187 GGGGGGGGTGCAGAACGCGCCGG + Intronic
1137617685 16:49856897-49856919 GGCGGAAGAGGAGGACGAGCAGG + Intronic
1140221598 16:73048079-73048101 GGCGGCAGAGGAGGAGGCGGCGG - Exonic
1142974591 17:3636063-3636085 GGCGGCGGTCGAGAGCGCGGTGG - Exonic
1144786826 17:17836772-17836794 GGCGGCTTTGGAGCAGGCGCTGG - Exonic
1145327082 17:21841950-21841972 GGCGGCAGGGGAGAAAGCCGGGG - Intergenic
1146401718 17:32504926-32504948 GTCGGCAGTGGAGAAGGAGCGGG - Intronic
1146793765 17:35767142-35767164 GATGGCAGTGGAGAAAGCTCTGG - Intronic
1152616811 17:81341663-81341685 GGCTCCAGTGGAGGACGCGGTGG + Intergenic
1160034398 18:75287186-75287208 GGCGGCCGTGCAGAGCGTGCAGG + Exonic
1160994438 19:1876153-1876175 TGCGGCAGTGGAGACGGCGGCGG - Intergenic
1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG + Intronic
1161767542 19:6215805-6215827 AGCGACAGTGGAGAACGTGCTGG - Intronic
1162496781 19:11027749-11027771 GGAGGCAGGAGAGAAGGCGCAGG - Intronic
1166304211 19:41928454-41928476 GGAGGAAGAGGAGAAGGCGCAGG - Intronic
1167648228 19:50717104-50717126 GGCGGCAGGGGAGGCCGTGCAGG - Intronic
925129546 2:1484702-1484724 GGCGGCTGTGGAGAACACGTTGG - Exonic
935354694 2:102187575-102187597 GGCGGCGGTGGGGACCGCGTGGG - Intronic
935590541 2:104843220-104843242 CGGGGCGGTGGAGAACCCGCGGG - Intergenic
937044966 2:118846470-118846492 GGCGGCAGTGGAGGCGGCGCGGG - Exonic
938537185 2:132256612-132256634 GGCGGCGGTGGGGAAGCCGCAGG - Intronic
942799692 2:179861267-179861289 GGCGGCGGTGGAGGTGGCGCGGG + Exonic
1168753137 20:297785-297807 GGCGGCGGTGGAGGGAGCGCCGG + Exonic
1169208143 20:3751457-3751479 GGGGGCAGAGGAGAAGGGGCGGG - Intronic
1169486702 20:6040775-6040797 GGCGGCAGTGGGGAGCGATCTGG + Exonic
1171976231 20:31596327-31596349 AGGGGCAGTGGAGAACACTCTGG + Intergenic
1174406518 20:50306554-50306576 GGCTGCAGTGGAGAATGGGCTGG + Intergenic
1175304070 20:57964062-57964084 AGCGGCAGTGGGGACGGCGCCGG - Intergenic
1180189335 21:46155079-46155101 GGCGGCAGTGGGGACCATGCTGG + Intronic
1180342444 22:11629107-11629129 GGCGGCGGTGGGGAAGCCGCGGG + Intergenic
1183739886 22:39663621-39663643 GGCAGCAGTGCAGACCACGCTGG - Intronic
1184760130 22:46538925-46538947 GGCGGCTGTGGAGAACCGGAAGG + Intergenic
956896596 3:73667144-73667166 GGTGGCAGTGGAGACAGGGCTGG + Intergenic
967924187 3:194633387-194633409 GGCGGCGGCGGCGAAGGCGCCGG + Exonic
968133599 3:196207325-196207347 AAGGGCAGTGGAGAAAGCGCGGG + Intronic
968178129 3:196568839-196568861 GGCGGGAGTGGTGGAGGCGCCGG + Exonic
969209032 4:5672204-5672226 GTGGGCAGAGGAGAACGAGCTGG + Intronic
970008016 4:11428817-11428839 GGCGGGCGGGGAGAAGGCGCAGG + Exonic
981081832 4:140644420-140644442 GGCGGCCATGGGGGACGCGCGGG + Intronic
981550395 4:145937002-145937024 GGGGGCAGGGGAGAAGGCGTGGG - Intronic
985532656 5:443162-443184 GCCGGAAGTGGACAGCGCGCGGG - Exonic
985537982 5:475177-475199 GGCGGCAGGGGAGACCTCGCCGG + Intronic
988707582 5:33740896-33740918 GGAGACAGTGGAGCACGAGCTGG - Intronic
993022330 5:82606057-82606079 GGTGGCAGTGGTGAAGGGGCTGG - Intergenic
994613661 5:102077610-102077632 GTCTGCAGTGGAGCACGGGCAGG + Intergenic
997158193 5:131580246-131580268 GGCAGCTGTGGAGGAGGCGCTGG - Intronic
997215187 5:132104083-132104105 TGCGGCAGTGGAGAAAGCTCTGG - Intergenic
998288120 5:140883714-140883736 GGACGCACAGGAGAACGCGCTGG + Exonic
998347349 5:141476443-141476465 GTTGGTAGTGGAGAACCCGCTGG + Exonic
1005976266 6:30802242-30802264 GGCAGGAGTGGAGGAGGCGCAGG + Intergenic
1015315155 6:131808406-131808428 GGCTGCGGAGGAGAGCGCGCGGG - Intronic
1021553706 7:21898855-21898877 GGAGGCAGTGGAGCACGTGACGG - Intronic
1022942385 7:35253555-35253577 CGCGGCAATGGAGAAGGCGTTGG + Exonic
1030243684 7:107359035-107359057 GGCTGCAGTGGAGAGCTGGCAGG + Intronic
1033033349 7:137847248-137847270 GGCGGCGGTGGAGAGGGTGCTGG - Intergenic
1033099827 7:138460554-138460576 GGTGGCGGTGGAGAAGGCGGTGG + Exonic
1034734110 7:153412917-153412939 GGCGGCAGTGCAGAAGGAGATGG + Intergenic
1044821887 8:96160728-96160750 GGCGGCGGCGCAGGACGCGCGGG + Exonic
1047966261 8:130049018-130049040 GGGGGCAGAGGAGAACACACTGG + Intergenic
1049765531 8:144353636-144353658 GGGGGCCGTGGAGAGGGCGCCGG - Intronic
1052852791 9:33387934-33387956 GGCCGCAGGAGAGAACACGCTGG + Intronic
1055977336 9:81968125-81968147 CACGGCAGTGGAGAAGGCTCAGG - Intergenic
1056719265 9:89059016-89059038 GGCGGTGGTGGAGAACGTGGTGG + Intronic
1056843087 9:90014502-90014524 GGCGTCAGTGTAGGACGGGCAGG - Intergenic
1058684108 9:107465763-107465785 GGGGGCACTGCAGACCGCGCGGG + Intergenic
1058715418 9:107718308-107718330 GGAGGCAGGGGAGAAGGTGCAGG - Intergenic
1058798903 9:108525735-108525757 GGGGGCAATGGAGAAAGCCCAGG + Intergenic
1062030616 9:134360298-134360320 GGCGGCAGGGCAGAGCGAGCAGG + Intronic
1200235077 X:154464216-154464238 GGCGGCGGCGGAGAACGAGGCGG + Exonic
1200811628 Y:7491434-7491456 GGCGGCAGAGGAGAAGGAGGAGG - Intergenic