ID: 1103363783

View in Genome Browser
Species Human (GRCh38)
Location 12:120368677-120368699
Sequence CCCTGCGCTCTCGGGGTCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 1, 2: 5, 3: 28, 4: 282}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103363773_1103363783 12 Left 1103363773 12:120368642-120368664 CCTCCACCCGCTGGGCCGGGTGC 0: 1
1: 0
2: 0
3: 21
4: 206
Right 1103363783 12:120368677-120368699 CCCTGCGCTCTCGGGGTCTCCGG 0: 1
1: 1
2: 5
3: 28
4: 282
1103363766_1103363783 25 Left 1103363766 12:120368629-120368651 CCTCATCTGCTCCCCTCCACCCG 0: 1
1: 0
2: 4
3: 59
4: 589
Right 1103363783 12:120368677-120368699 CCCTGCGCTCTCGGGGTCTCCGG 0: 1
1: 1
2: 5
3: 28
4: 282
1103363774_1103363783 9 Left 1103363774 12:120368645-120368667 CCACCCGCTGGGCCGGGTGCGCT 0: 1
1: 0
2: 0
3: 21
4: 148
Right 1103363783 12:120368677-120368699 CCCTGCGCTCTCGGGGTCTCCGG 0: 1
1: 1
2: 5
3: 28
4: 282
1103363776_1103363783 5 Left 1103363776 12:120368649-120368671 CCGCTGGGCCGGGTGCGCTCGCG 0: 1
1: 0
2: 0
3: 15
4: 161
Right 1103363783 12:120368677-120368699 CCCTGCGCTCTCGGGGTCTCCGG 0: 1
1: 1
2: 5
3: 28
4: 282
1103363771_1103363783 14 Left 1103363771 12:120368640-120368662 CCCCTCCACCCGCTGGGCCGGGT 0: 1
1: 0
2: 3
3: 54
4: 531
Right 1103363783 12:120368677-120368699 CCCTGCGCTCTCGGGGTCTCCGG 0: 1
1: 1
2: 5
3: 28
4: 282
1103363772_1103363783 13 Left 1103363772 12:120368641-120368663 CCCTCCACCCGCTGGGCCGGGTG 0: 1
1: 0
2: 0
3: 19
4: 167
Right 1103363783 12:120368677-120368699 CCCTGCGCTCTCGGGGTCTCCGG 0: 1
1: 1
2: 5
3: 28
4: 282
1103363765_1103363783 26 Left 1103363765 12:120368628-120368650 CCCTCATCTGCTCCCCTCCACCC 0: 1
1: 0
2: 8
3: 104
4: 936
Right 1103363783 12:120368677-120368699 CCCTGCGCTCTCGGGGTCTCCGG 0: 1
1: 1
2: 5
3: 28
4: 282
1103363778_1103363783 -3 Left 1103363778 12:120368657-120368679 CCGGGTGCGCTCGCGGATCGCCC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1103363783 12:120368677-120368699 CCCTGCGCTCTCGGGGTCTCCGG 0: 1
1: 1
2: 5
3: 28
4: 282
1103363775_1103363783 6 Left 1103363775 12:120368648-120368670 CCCGCTGGGCCGGGTGCGCTCGC 0: 1
1: 0
2: 3
3: 35
4: 304
Right 1103363783 12:120368677-120368699 CCCTGCGCTCTCGGGGTCTCCGG 0: 1
1: 1
2: 5
3: 28
4: 282
1103363764_1103363783 27 Left 1103363764 12:120368627-120368649 CCCCTCATCTGCTCCCCTCCACC 0: 1
1: 1
2: 8
3: 105
4: 1109
Right 1103363783 12:120368677-120368699 CCCTGCGCTCTCGGGGTCTCCGG 0: 1
1: 1
2: 5
3: 28
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103363783 Original CRISPR CCCTGCGCTCTCGGGGTCTC CGG Intronic
900316972 1:2061757-2061779 CACTGCCCACTCGGGGTCCCAGG + Intronic
900681611 1:3919862-3919884 CCCTGGGCTGTCTTGGTCTCTGG + Intergenic
901055786 1:6448160-6448182 GCCTGTGCTCTCGGAGGCTCCGG - Intronic
901669840 1:10849787-10849809 CCCTGGGCTCTGGGAGTCCCAGG - Intergenic
902488840 1:16765837-16765859 CCCTGCTCTCCCCGGGGCTCTGG - Intronic
903019681 1:20385371-20385393 CCCTGCCCTCTGGGGGTTTCAGG - Intergenic
903652551 1:24930482-24930504 CCCAGAGCTCTCGGGGGCCCTGG - Intronic
903750293 1:25617081-25617103 CCCTGCGCTGTCTGGGGCCCGGG + Intergenic
903882385 1:26520333-26520355 CCCAGCGCTCTGGGAGGCTCAGG + Intergenic
904365792 1:30010294-30010316 CCCTGCACTCTTGGGGGCCCAGG - Intergenic
904460941 1:30679511-30679533 CCCTGCACTCTTGGGGGCCCAGG + Intergenic
904591394 1:31617558-31617580 CCCTCCGCCCTGCGGGTCTCGGG + Intergenic
904954505 1:34271776-34271798 CCCTGGGCACTCGTGGTCTGTGG + Intergenic
905055371 1:35089060-35089082 CCCTGCGCTCTGGGAGGCTGAGG - Intronic
906051902 1:42881126-42881148 CCTTGCACTCTCGGGGGCCCAGG - Intergenic
907985245 1:59524040-59524062 CCCTACGCTCTCAGGGGCCCAGG + Intronic
909376479 1:74947938-74947960 CCCTGCCCTCCCAGGGACTCAGG + Intergenic
909907739 1:81220667-81220689 CCCTGCACTCTCAGGGGCACGGG + Intergenic
911052349 1:93681610-93681632 CGCTGGGCGCTCGGGCTCTCAGG + Intronic
911935256 1:103961163-103961185 CCCTGCGCTCTCAAGGGCCCAGG - Intergenic
912821424 1:112870959-112870981 CCCTGAGCTCTCAGTTTCTCTGG + Intergenic
913615583 1:120557213-120557235 GCCTGCTCCCTCGGGGGCTCTGG + Intergenic
914574692 1:148953689-148953711 GCCTGCTCCCTCGGGGGCTCTGG - Intronic
917838629 1:178959996-178960018 CCCTGTGCTCCTGGGGGCTCAGG + Intergenic
919249249 1:195030974-195030996 CCCTGTGCTCTCAGGGGCCCAGG - Intergenic
919253790 1:195096138-195096160 CCCTGCACTCTAGGGGGCCCAGG + Intergenic
922881804 1:228986602-228986624 CACTGCGCTCTCAGTGTCACAGG - Intergenic
923531596 1:234816687-234816709 CCCTGCTCTCCCCGGGGCTCTGG + Intergenic
923918062 1:238530623-238530645 CTCTGTGCTCTCGGGGACTCAGG - Intergenic
1065101385 10:22335695-22335717 CCCGGCCCTCCCCGGGTCTCGGG - Intergenic
1066188807 10:33036901-33036923 CCCTGCACTCTCGGGGGCCCAGG + Intergenic
1069249185 10:66246250-66246272 CCCTGCACTCTTGGGGTCCCAGG - Intronic
1070201284 10:74208179-74208201 CCCTGCACTCTCTGGGGCCCGGG - Intronic
1070401482 10:76056778-76056800 CCCTGTGCTCTTGGGGGCTTGGG - Intronic
1070912720 10:80132555-80132577 GCCTCAGCTCCCGGGGTCTCTGG + Intronic
1071060981 10:81570737-81570759 CCCTGCACTCTCAGGGGCCCAGG - Intergenic
1073424118 10:103445970-103445992 CCCTCCGATCTTGGAGTCTCTGG + Exonic
1073844976 10:107544729-107544751 CCCTGTGCTCTCAGGGGCCCAGG + Intergenic
1075007690 10:118842433-118842455 CCCTGCTCTCTTGGGGGCCCAGG + Intergenic
1075100429 10:119502670-119502692 CCTTGGGATCTCGGGATCTCGGG - Intronic
1075711826 10:124534710-124534732 CTATGCGCTCTCGGGGCTTCGGG + Intronic
1076290267 10:129340528-129340550 GCAGGGGCTCTCGGGGTCTCTGG - Intergenic
1076655252 10:132019530-132019552 CCCTGCACTCTTGGGGGCCCAGG - Intergenic
1076887954 10:133271160-133271182 CCATGGGCTCTGGGGGTCACTGG + Intronic
1077810044 11:5627730-5627752 TTCTGAGCTCTCAGGGTCTCTGG + Intronic
1077844786 11:6013013-6013035 TTCTGCGCTCTTGGGGGCTCAGG - Intergenic
1077938759 11:6817978-6818000 CCCTGCACTCTTGGGGGCCCAGG + Intergenic
1078085650 11:8231740-8231762 CCCTGCTCTCTCCAGGGCTCTGG + Intronic
1078498183 11:11841679-11841701 CCCTGCCTTCTCGGGCTCTTCGG - Intronic
1081831496 11:46119945-46119967 CCCGGCCCGCTCGGGGTCCCGGG + Intronic
1082838463 11:57668483-57668505 CCCTGCGCCCTCGGGCTCTGCGG + Intronic
1083332617 11:61906015-61906037 CCCTGTGCTCAAGGGGTTTCTGG - Intronic
1083487767 11:62994410-62994432 CCCTGCACTCTCTGGGGCTCAGG - Intronic
1083621208 11:64050254-64050276 CACTCATCTCTCGGGGTCTCAGG - Intronic
1083955262 11:65979327-65979349 CCCTGCTCTCTCCTGGCCTCGGG + Exonic
1084146964 11:67270115-67270137 CCCTTCACTCTCAGGGTCTGTGG + Intronic
1085212281 11:74791745-74791767 CCCTGTGCTCTTGGGGGCCCAGG - Intronic
1085363207 11:75911607-75911629 CTCTGCCCCCTCGGGGTCTGGGG + Intronic
1087638611 11:100731397-100731419 CCCTGCACTCTAGGAGTCTGAGG - Intronic
1088288088 11:108207728-108207750 CCCTGCACTCTCGGGGGCCAGGG - Intronic
1088328918 11:108629561-108629583 CCCTGCTCTCTCAGGGGCCCAGG - Intergenic
1090351976 11:126113587-126113609 CCCTGCACTCTCTGGGTTGCTGG + Intergenic
1091348048 11:134868500-134868522 CCCTCCCCTCTCAGTGTCTCGGG - Intergenic
1091460883 12:642907-642929 CCCTGCGCCCTCGCGCTCCCGGG + Intronic
1093281718 12:17203803-17203825 CCCTGCCCTCTTGGGGGCCCAGG + Intergenic
1095749782 12:45697346-45697368 CCCTGCACTCTCAGGGACCCGGG - Intergenic
1095946436 12:47756410-47756432 CTCTCCGCTCTCCGGGTCACTGG - Intronic
1096228384 12:49883676-49883698 CCCTGCTCCCTCAGGGTCTCAGG - Intronic
1096254100 12:50052433-50052455 CCTGGCTCTCTCGGTGTCTCAGG - Intergenic
1097130979 12:56810516-56810538 CCCTGCACTCTTGGGGGCCCAGG - Intergenic
1097450809 12:59734455-59734477 CCCTGCACTCTCTGGGGCCCAGG - Intronic
1101130840 12:101689752-101689774 CTCTGAGCTCTCTGGCTCTCAGG - Intergenic
1102245468 12:111353111-111353133 ACCTGCTCCCTCGGGTTCTCAGG - Intergenic
1102521149 12:113478039-113478061 CCCTGGACTTTTGGGGTCTCAGG + Intergenic
1102933971 12:116881668-116881690 TCCTGGGCTTTGGGGGTCTCGGG + Intergenic
1103173572 12:118843321-118843343 CCCTGTGCTCTCTGGGACTCAGG + Intergenic
1103363783 12:120368677-120368699 CCCTGCGCTCTCGGGGTCTCCGG + Intronic
1103748395 12:123141821-123141843 CCCTGTGATCTCAGGGTTTCAGG + Intronic
1103828955 12:123763254-123763276 CCCTGCCCTCTCAGTGTCCCTGG - Intronic
1103855202 12:123963263-123963285 TCCTGCTCTCTCTGGGTTTCTGG + Intronic
1104730723 12:131103935-131103957 CCCTGCGCTCCAGGAGGCTCCGG - Intronic
1104733601 12:131122496-131122518 CCCCGCGCTCTCTGGGGGTCTGG + Intronic
1105000571 12:132687586-132687608 CACTCCGCTCTCGGCGCCTCGGG + Exonic
1105401757 13:20102384-20102406 CCCTTTGCTCTCTGGCTCTCTGG - Intergenic
1107841037 13:44458624-44458646 CCCTGTGCTCTCGGGGACCCAGG + Intronic
1108249507 13:48550808-48550830 CCCTGTGCTCTTGGGGACCCAGG + Intergenic
1109687697 13:65843415-65843437 CCCTGCCCTCTCGGAGGCTTGGG + Intergenic
1111091396 13:83452467-83452489 CCCTGCGCTCTTGGGGGCCTGGG + Intergenic
1111141744 13:84127779-84127801 CCCTGCGCTCTTGGGGGCCCAGG - Intergenic
1113124822 13:106965714-106965736 CCCTTGGCTCTCTGGCTCTCAGG - Intergenic
1114280993 14:21192385-21192407 CCCTGCACTCTTGGGGACCCGGG + Intergenic
1116019204 14:39441061-39441083 CCCTGTGCTCTCTGGGGCCCAGG + Intergenic
1116961553 14:50973059-50973081 CCCTGCGCTCTTGGGGGCCTGGG + Intergenic
1118410184 14:65470275-65470297 CCGTGTGCTCTTGGGGGCTCAGG - Intronic
1125594112 15:40873576-40873598 CCTTGGGCTCTTGGAGTCTCAGG - Intronic
1126185859 15:45829845-45829867 CCCTGTGCTCTTGGGGGCGCTGG - Intergenic
1126325176 15:47468973-47468995 CCCTGAACTCTTGAGGTCTCTGG + Intronic
1126979721 15:54227702-54227724 CCCTGAGCTCTTGGGGGCCCGGG - Intronic
1127912717 15:63431399-63431421 CTCTGCTTTCTCGGGGTCTGTGG - Intergenic
1128059842 15:64728375-64728397 CCCTGCCCTCTGGTGGCCTCTGG + Intergenic
1128558089 15:68645305-68645327 CCCTGCGCTCTCGGTGACGATGG - Exonic
1129297201 15:74606162-74606184 CCCAGCGCTCCCAGGGCCTCTGG - Intronic
1131473317 15:92714771-92714793 CCTTGGGTCCTCGGGGTCTCTGG - Intronic
1131517741 15:93090039-93090061 CCCTGGGCTCCCGGAGCCTCTGG - Intergenic
1132591399 16:727851-727873 CCCGGCGCTCCCCGGGGCTCTGG + Intronic
1132661226 16:1062366-1062388 GGCTGGGCTCTCGGGGCCTCTGG + Intergenic
1132812597 16:1808704-1808726 CCCAGCCCTCCCGGGGTCACAGG + Exonic
1132978924 16:2724959-2724981 CCCTGTGCTCTCGGGGGGCCTGG + Intergenic
1133104853 16:3500855-3500877 CCCTCTGCCCTCGGCGTCTCAGG + Intergenic
1133227550 16:4349203-4349225 CCCAGCACTTTGGGGGTCTCAGG - Intronic
1134438865 16:14285743-14285765 CCCGGCGGGCTCGGGGGCTCGGG - Intergenic
1138878250 16:60979259-60979281 CCCTGCACTCTTGGGGGCCCAGG + Intergenic
1138998152 16:62477788-62477810 CCCTGTGCTCTCAGGGGATCAGG + Intergenic
1139088785 16:63618587-63618609 TCCTGTGCTCTCGGGGGCCCAGG - Intergenic
1139150877 16:64380999-64381021 CCCTGCACTCTTGGGGGCTCAGG + Intergenic
1139677279 16:68532669-68532691 ACGTGCTCTCTCGGGGTCTTTGG - Intronic
1142251929 16:88995989-88996011 CCCTGGGCTCCCCGGGTCTGCGG + Intergenic
1142421369 16:89972552-89972574 CCCTGCGCTCGCGGGGCCCTAGG + Intergenic
1142426683 16:90005376-90005398 CCCTCTGCTCTGGGGGTGTCTGG - Exonic
1142720019 17:1769856-1769878 CCCTGTGCTGTCGGGGTCTGGGG - Exonic
1143609976 17:8012585-8012607 CCCTCCGCTCTGGGAGGCTCCGG - Exonic
1144389889 17:14783994-14784016 CCCTCTGCTCTTGGGGACTCGGG + Intergenic
1144708963 17:17388038-17388060 CCCTGCTCTCTGGGGGATTCTGG + Intergenic
1144767854 17:17742681-17742703 CCCTTGGCTCTGGGGGACTCAGG - Intronic
1146923478 17:36728947-36728969 CCCTGAGCTCTGGGGGTTTATGG + Intergenic
1147132737 17:38418775-38418797 CCCAGTGCTCTGGGTGTCTCTGG + Intergenic
1147996703 17:44363596-44363618 CCCTGCGGGCTGGGGGGCTCCGG + Exonic
1148470271 17:47888922-47888944 CCCTCCACACTCAGGGTCTCTGG + Intergenic
1148899542 17:50865947-50865969 CCCTGGGCCCTCGGGAGCTCGGG - Intronic
1149169373 17:53791807-53791829 CCCTGCACTCTTGGGAGCTCAGG + Intergenic
1149935773 17:60805399-60805421 CTCTGACCTCTCAGGGTCTCTGG + Intronic
1152468098 17:80476837-80476859 CCCTGAGCTCTCGGAGCCTTCGG - Intronic
1152628121 17:81397571-81397593 CCCGGCGCCCTCCGGGGCTCGGG + Intronic
1152730090 17:81965899-81965921 CACTCCGCTCACGGGGCCTCAGG - Intergenic
1153052053 18:908800-908822 CCCTGTGCTCTCAGTTTCTCTGG - Intronic
1153428882 18:4993434-4993456 CCCTGCACTCTTGGGGGCCCTGG - Intergenic
1154087741 18:11323482-11323504 CCCTGGGCTCTCTGTGCCTCGGG + Intergenic
1157610285 18:48951437-48951459 CCCTGCGCTCCTGGGGGCCCAGG + Intergenic
1158787944 18:60739458-60739480 CCCTGTGCTCTTGGGGGCCCGGG + Intergenic
1159766998 18:72502902-72502924 CCCTGCACTCTTGGGGTCCTGGG - Intergenic
1160053232 18:75455888-75455910 CCCCGCGCTCGCGGGTTCCCGGG - Intergenic
1160452467 18:78974570-78974592 CCCTGCGCTCCCGGGAGCGCCGG - Intergenic
1161319210 19:3633286-3633308 CCCTGGGCTCTCTGGCTCTGAGG - Intronic
1161420617 19:4174440-4174462 CCCTGGGCTCCAGGGGCCTCTGG - Exonic
1161473683 19:4473275-4473297 AGCTGCGCTCTGGGGGTCTGGGG + Intronic
1161781711 19:6297497-6297519 CCCTGCACTCTTGGGGTCCCAGG + Intergenic
1162954565 19:14090937-14090959 CCCTGCGCTCTCGCTCACTCCGG + Intronic
1163648478 19:18503583-18503605 CCCTGAGCTCTGGGTGTCTGGGG - Intronic
1163723115 19:18907558-18907580 CCCTGGGCTCTCAGGGACTGAGG - Intronic
1164157004 19:22603093-22603115 CCCTGAGCTCTGGGGGGCTGGGG - Intergenic
1166288565 19:41847493-41847515 CTCTGTGCTCTGGGGGTCTCTGG - Exonic
1168353028 19:55687323-55687345 CCCTGCCCACTGAGGGTCTCAGG - Intronic
925515211 2:4674335-4674357 CTCTGCACTCTCGGGGGCCCAGG + Intergenic
926547106 2:14255514-14255536 CCCTGTGCTCTCGGGGACCCAGG - Intergenic
926554458 2:14341354-14341376 CCCTGTGCTCTTGGGGGCCCAGG + Intergenic
930336019 2:50046807-50046829 CCCTGCGTTCTGGGAGTCTAAGG - Intronic
932398090 2:71461959-71461981 CCCAGAGCTCACTGGGTCTCTGG - Intronic
932398358 2:71463369-71463391 CCCTGCACTCTCTGGGGCCCAGG - Intronic
933042493 2:77487263-77487285 CCCTGTGCTCTTGGGGACCCAGG + Intronic
934712845 2:96527244-96527266 CCCTGCTCTCTCGGGTTCTCAGG - Intergenic
934988186 2:98902267-98902289 CCCTGTGCTGAAGGGGTCTCCGG + Intronic
935738827 2:106128581-106128603 CCCTCGGCTCTCTGGTTCTCAGG + Intronic
936439884 2:112542331-112542353 CCCTGCGGTTTCGGTTTCTCGGG - Intronic
939017738 2:136920987-136921009 CCCTGGGCTCTCAGGGGCCCAGG - Intronic
939837588 2:147149989-147150011 CCCTGCGCTCTTGGGGGCCCAGG + Intergenic
940217442 2:151315347-151315369 CTGTGGGCTCTCTGGGTCTCCGG + Intergenic
940396373 2:153196535-153196557 CTCTGCACTCTCGGGGGCCCAGG - Intergenic
940398808 2:153222872-153222894 CCCTGCGCTCTCAGTGGCCCAGG - Intergenic
940423877 2:153509213-153509235 CCCTGCACTCTCAGGGACCCTGG - Intergenic
941929308 2:170924586-170924608 CCCTATGCTCTCAGGGGCTCAGG - Intergenic
941998784 2:171626476-171626498 CCCTGTGCTCTTGGGGGCCCAGG + Intergenic
943190915 2:184679516-184679538 CTCTGCACTCCCGGGGGCTCAGG + Intronic
943960139 2:194254033-194254055 CCCTGCGCTCTTGGGGGCCTGGG + Intergenic
944146665 2:196514102-196514124 CCCTGCACTCTCAGGGGCCCAGG + Intronic
944483772 2:200182294-200182316 CCCTGCACTCTTGGGGGCCCAGG + Intergenic
946852257 2:223919050-223919072 TCCTGCACTCTCAGGGCCTCTGG + Intronic
947754368 2:232550919-232550941 CCCTGGGGTCTCCGGGACTCCGG - Intronic
948301461 2:236910122-236910144 CCCTGCCCTCTCCTGGCCTCTGG + Intergenic
948476167 2:238221288-238221310 CCCTGCACTCTTGGGGGCCCGGG - Intergenic
949065689 2:241989202-241989224 CGCTGAGCTCTCAGGGTTTCAGG - Intergenic
1168954224 20:1823569-1823591 CCCTGCCCTCTCTGAGCCTCAGG - Intergenic
1169422106 20:5469139-5469161 CCCTGTGTGCTCAGGGTCTCAGG + Intergenic
1172013267 20:31858615-31858637 GCCTGGGCTCTGCGGGTCTCAGG + Intronic
1172765130 20:37346743-37346765 CCCTGCCCTCGTGGGGCCTCGGG + Intronic
1173849113 20:46206879-46206901 ACCTGCGTTCTCAGGGTCACAGG - Intronic
1174138754 20:48398439-48398461 CCCTGCACTCTTGGGGACCCAGG - Intergenic
1176042405 20:63072443-63072465 CACTGCCCTTGCGGGGTCTCGGG - Intergenic
1178937326 21:36874855-36874877 CCCTGCACTCTCGGGGGTCCAGG + Intronic
1179882815 21:44300488-44300510 CCCTCCGCTCGCGTGGCCTCGGG - Intronic
1179916427 21:44480935-44480957 CCCTGGGCTCTCCTGGCCTCTGG + Intergenic
1181750077 22:24983065-24983087 CCCTTCTCTCTTGGGGTCTGTGG + Intronic
1182478260 22:30588826-30588848 CCCTGCCCTCTGGCGGTCCCTGG - Intronic
1182584691 22:31337792-31337814 CCTTGAGCTCTCAGGTTCTCAGG - Intronic
1183316733 22:37141211-37141233 CCCTGCACTCTCAGGGGCCCTGG + Intronic
1183708206 22:39487803-39487825 CCGTGCGCTCCCGGGCGCTCAGG - Exonic
1184698114 22:46150781-46150803 GCCCGGGGTCTCGGGGTCTCCGG + Intronic
1184699738 22:46162611-46162633 CTCTGGCCTCACGGGGTCTCAGG - Intronic
1185055554 22:48576808-48576830 CGCTGCGTTCTCGGTGCCTCTGG + Intronic
949667575 3:6358045-6358067 CCATGCAGTCTCCGGGTCTCAGG - Intergenic
950101103 3:10357565-10357587 CACTGTTCTCTGGGGGTCTCTGG - Intronic
950994372 3:17479957-17479979 CCCTGTGCTCTTGGGGTCCCAGG + Intronic
954933622 3:54306660-54306682 CGCTGCCCTCTCAGGGCCTCAGG + Intronic
955303720 3:57809225-57809247 CCCTGCACTCTTGGGGGCCCAGG + Intronic
957417771 3:79929011-79929033 CCCTGTGCTCTCAGGGGCTCAGG + Intergenic
957613957 3:82505355-82505377 CCCTGTGCCCTCGGGGGCCCAGG + Intergenic
957646578 3:82938977-82938999 CCCAGCGCTCTCAGGGGCCCGGG + Intergenic
957665427 3:83218933-83218955 CCCTGTGCTCTCAGGGTCCTGGG - Intergenic
957730238 3:84125354-84125376 CTCTGCACTCTCGGGGGCCCAGG + Intergenic
957922984 3:86771791-86771813 CCCTGCACTCTTGGGGTCTCAGG + Intergenic
958675679 3:97265608-97265630 CTCTGCACCCTCGGGGTCTTGGG - Intronic
959476668 3:106820996-106821018 CCCTGTGCTCTCGGGGGCCCAGG + Intergenic
961045992 3:123708465-123708487 CCCTGCCCTCTCTGGGTTACTGG - Intronic
961674125 3:128554870-128554892 CTCAGCGGTCTCGGGGTCTTGGG - Intergenic
963906204 3:150775098-150775120 CCCTGCGCTCTCGGGGGCCCAGG - Intergenic
965005579 3:163018908-163018930 CCCTGCACTCTTGGGGGCCCAGG + Intergenic
965051482 3:163655184-163655206 CCCTGCACTCTCGGGGGTCCAGG - Intergenic
965061423 3:163789026-163789048 CCCTGTTCTCTCGGGGGCTCAGG - Intergenic
965534606 3:169812100-169812122 CGCCGTGCTCTCAGGGTCTCCGG - Intronic
968642221 4:1720529-1720551 CCAGGCGCTTTCGGGGCCTCGGG + Intronic
968818028 4:2831786-2831808 CCCTAGGCTCCCGGGTTCTCGGG - Intronic
969425268 4:7120618-7120640 CCCTGCGATCTCGAAATCTCTGG + Intergenic
969721808 4:8896202-8896224 CCCTGGGCTCTCAGGGGTTCCGG + Intergenic
970446345 4:16126185-16126207 CCCTGAGCTCTTGGCATCTCTGG - Intergenic
971834737 4:31748471-31748493 CCCTGAGCTCTCAGGGGCCCAGG - Intergenic
974235721 4:59179414-59179436 CCCTGCACTCTTGGGGACCCAGG + Intergenic
974432474 4:61816857-61816879 CCCTGAGCTCTCAGGGACCCAGG + Intronic
975910150 4:79258159-79258181 CCCTGTGCTCTTGGGGATTCTGG + Intronic
976734562 4:88296745-88296767 CCCTGCACTCTTGGGGGCCCTGG - Intergenic
980480832 4:133385293-133385315 CCCTGCACTCTCAGGGACCCAGG + Intergenic
982901131 4:161003760-161003782 TCCTGAGCTCTCGGGGGCTCAGG - Intergenic
983323707 4:166227155-166227177 CCCTGAGCTCTTGGGGACCCAGG + Intergenic
984296552 4:177861653-177861675 CCCTGTGCTCTCGGGGGCCCAGG + Intronic
985646406 5:1086754-1086776 CCCTGGGCTCTCCTGGGCTCTGG - Intronic
985664402 5:1174483-1174505 CCCTGCTCTCACGGGATCTCTGG - Intergenic
985682470 5:1263801-1263823 CCTTGAGCTCTCGGGCTCTGGGG + Intronic
987099734 5:14581658-14581680 CCGCGCGCTGTCGGGGTCGCGGG - Intergenic
987537626 5:19208643-19208665 CCCTGCCCTCTTGGGGGCCCGGG + Intergenic
988518026 5:31921563-31921585 CCCTGCGGTCCCGGGTACTCAGG + Intronic
989537525 5:42581852-42581874 CCCCGTGCTCTCGGGGGCCCAGG + Intronic
992627354 5:78648165-78648187 CCCTGCTCTCTGGGCGTCGCTGG - Intronic
996304686 5:122033707-122033729 CCCAGCGCTCTGGGAGTCTGAGG - Intronic
997212166 5:132083245-132083267 CCCTGCCCTCTCTGGGCCTTGGG - Intergenic
998013597 5:138714936-138714958 CCCTGCCCTCTCTAGGACTCTGG - Intronic
998157616 5:139795627-139795649 CCCGGCACGCTCGGGGTCCCGGG + Intergenic
999300433 5:150486822-150486844 CCCTCCTCCCTCAGGGTCTCGGG + Intronic
1001605890 5:172959432-172959454 CCCTGCGCACTCAGGGTCTGAGG + Intronic
1002104533 5:176873573-176873595 CCCTGTGCTCTGGGGATCCCAGG + Intronic
1002442442 5:179271408-179271430 CCCTGAGCTCTCGGGGACACAGG + Intronic
1003628786 6:7767982-7768004 CCCTGGGCTCAGTGGGTCTCAGG + Intronic
1004476055 6:15973267-15973289 CCATTGGCTCTCTGGGTCTCAGG + Intergenic
1004720941 6:18266630-18266652 CCCTGCACTCTTGGGGGCCCAGG - Intergenic
1006406364 6:33848030-33848052 ACCTGCCCTCTCTGGGCCTCAGG + Intergenic
1006467187 6:34202793-34202815 GCCTGCACCCTCGGGGCCTCAGG - Intergenic
1009241793 6:61193850-61193872 CTCTGCACTCTCGGGGGCCCAGG - Intergenic
1011517067 6:88166327-88166349 CCCTCCGCTCGCGCTGTCTCTGG + Exonic
1011930244 6:92701802-92701824 CCCTGCACTCTTGGGGCCCCAGG - Intergenic
1012133053 6:95519972-95519994 CCCCGCACTCTCGGGGCCCCAGG - Intergenic
1014227248 6:118862183-118862205 CCCTGCACTCTTGGGGGCCCAGG - Intronic
1014391578 6:120872016-120872038 TCCTGCACTCTCAGGGGCTCAGG + Intergenic
1014505422 6:122248423-122248445 CCCTGTGCTCTTGGGGCCCCAGG - Intergenic
1014724967 6:124962626-124962648 CCCTGAGGCCTCGGGGGCTCAGG - Exonic
1016190644 6:141260948-141260970 TCCTGCACTCTTGGGGTCCCTGG + Intergenic
1017906788 6:158761948-158761970 ATCTGCTCTCTCGGGGTCTGAGG + Intronic
1019477174 7:1249604-1249626 CCCTTCCCTCTCGGGGTATGAGG + Intergenic
1020113434 7:5461110-5461132 TCCTGCACTCTCGGGGTGGCAGG + Intronic
1020564511 7:9778596-9778618 CTCTGGGGTCTTGGGGTCTCAGG - Intergenic
1021021221 7:15600346-15600368 TCCTGTGCTCTTGGGGGCTCAGG - Intergenic
1021097159 7:16547525-16547547 CCCTGCACTCTCGGGGACCCAGG + Intronic
1022742580 7:33137321-33137343 CCCTGCACTGTCGGGGGCCCGGG - Intronic
1023700131 7:42883946-42883968 CCCTGTGCTCTGGGGGGCCCAGG - Intergenic
1023750441 7:43366885-43366907 GCCTGCTCTCCCGGGATCTCAGG - Intronic
1023862681 7:44225568-44225590 CCCTGCTCTCTCGGGCACCCAGG + Intronic
1027735023 7:81920905-81920927 CCCTGTGCTCTCAGGGGCCCAGG - Intergenic
1029327555 7:99823153-99823175 CCCTGCACTCTTGGGGGCCCAGG + Intergenic
1029439179 7:100577834-100577856 CCTTGCGTTCTCTGGGTCCCCGG + Exonic
1029681755 7:102116290-102116312 AGCTGGGCTCTCGAGGTCTCAGG - Intronic
1030721854 7:112881037-112881059 CCCTGCGCTCTTGGGGGCCTGGG + Intronic
1031265208 7:119572508-119572530 CCCTGCACTCTTGGGGGCCCAGG + Intergenic
1031922067 7:127609377-127609399 CCCTGCACTCTCAGGGGCACAGG - Intergenic
1034976099 7:155450015-155450037 CCCCGGGCTCTCCGGGTCCCGGG - Intergenic
1036220670 8:6919562-6919584 CCCTGCGCTCATGGTGGCTCAGG + Intergenic
1039444695 8:37621748-37621770 CCCTGCATTCACGTGGTCTCAGG + Intergenic
1039936513 8:42051423-42051445 CCCCGCGCTCGCGGGCGCTCGGG - Intronic
1040587326 8:48756246-48756268 CCCGGCGCTCCCGCGCTCTCCGG - Intergenic
1041738566 8:61135914-61135936 CTGTGCCCTCTCGGGCTCTCCGG + Intronic
1043180721 8:77083567-77083589 CCCTGTGTTCTCAGGGTTTCAGG - Intergenic
1044409446 8:91867772-91867794 CTCTGCACTCTCGGGGGCCCAGG + Intergenic
1045300830 8:100908554-100908576 CCCTGTGCTCTCGGGGGCCCCGG - Intergenic
1045674076 8:104589014-104589036 CCCTGCGCTCTCCGCGGCTGCGG + Intronic
1046323691 8:112612840-112612862 CCCTGTGATTTCGGTGTCTCTGG - Intronic
1048548053 8:135405167-135405189 CCCTGTGCTCTCAGGGGCCCAGG - Intergenic
1049189116 8:141276832-141276854 CCCAGCGCTGTCTGGGCCTCAGG - Intronic
1049534216 8:143170618-143170640 CGCTGTGCTCTCTGGCTCTCTGG + Intergenic
1049823939 8:144654965-144654987 CCCTGCACTCTTGGGGGCCCAGG + Intergenic
1049826944 8:144674980-144675002 CCCTGCTCTCTCGGGGACTCAGG - Intergenic
1050182239 9:2934046-2934068 CTCTGCGCTCTTGGGGGCCCAGG + Intergenic
1050337253 9:4601622-4601644 CCCAGCGATCTCGAGATCTCAGG - Intronic
1050432234 9:5573707-5573729 CCCTGCTCTCTAGGAGTCTAAGG - Intergenic
1050589794 9:7149388-7149410 CCCTGTGCTCTCAGGGTCCCAGG - Intergenic
1050941885 9:11471241-11471263 CCCTGCACTCTCAGGGGCCCAGG + Intergenic
1051057875 9:13009094-13009116 TCCTGCTCTCTTGGGGTTTCAGG - Intergenic
1056986047 9:91364399-91364421 CCCTGCACTCTTGGGGGCCCAGG + Intergenic
1058077569 9:100666939-100666961 TCCTGCACTCTTGGGGGCTCAGG + Intergenic
1058153319 9:101486100-101486122 CACTGCGCTCGCGGTGTCTTGGG - Intronic
1059305414 9:113349814-113349836 CCAGGCGCGCCCGGGGTCTCCGG - Intronic
1060268178 9:122124371-122124393 CCCTTGGCTCTCAGGCTCTCAGG + Intergenic
1060870658 9:127037363-127037385 CCCTCCTCTCTTTGGGTCTCAGG + Intronic
1061483571 9:130909028-130909050 ACCTGCGCTCTCAGCCTCTCAGG + Intronic
1062184656 9:135211522-135211544 CCCTGCACTCTTGGGGGCCCAGG + Intergenic
1062587509 9:137255835-137255857 CCCTGTGCTCTCAGGACCTCGGG + Intronic
1062645822 9:137547615-137547637 CCCTGCACTCTTGGGGACTGTGG - Exonic
1188434788 X:30148164-30148186 CCCTGCGCTCTCGGGGACCCAGG + Intergenic
1189856459 X:45229438-45229460 CTCTGCACTCTCGGGGACCCGGG - Intergenic
1197526797 X:127574830-127574852 CCCTGTGCTCTCGGGGGCCTGGG + Intergenic
1198026881 X:132715545-132715567 CCCTGCCCTCTCAAAGTCTCAGG - Intronic
1200079136 X:153566902-153566924 CCCTGCGTGATCGTGGTCTCTGG - Intronic
1200249730 X:154546607-154546629 CCCTTCGCTCTCGGGGTCTCAGG + Intronic