ID: 1103367073

View in Genome Browser
Species Human (GRCh38)
Location 12:120391034-120391056
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103367073_1103367083 30 Left 1103367073 12:120391034-120391056 CCTGCCCCCCTCTTCCCATGGCA No data
Right 1103367083 12:120391087-120391109 AGAAGTCTTCCTAGACCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103367073 Original CRISPR TGCCATGGGAAGAGGGGGGC AGG (reversed) Intergenic
No off target data available for this crispr