ID: 1103367612

View in Genome Browser
Species Human (GRCh38)
Location 12:120394638-120394660
Sequence GGATTGTGCAGACCCAGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103367609_1103367612 6 Left 1103367609 12:120394609-120394631 CCAGCTAAAGAAAGAGCTGGCTT No data
Right 1103367612 12:120394638-120394660 GGATTGTGCAGACCCAGCTTTGG No data
1103367606_1103367612 16 Left 1103367606 12:120394599-120394621 CCCTAATTAACCAGCTAAAGAAA No data
Right 1103367612 12:120394638-120394660 GGATTGTGCAGACCCAGCTTTGG No data
1103367604_1103367612 20 Left 1103367604 12:120394595-120394617 CCCTCCCTAATTAACCAGCTAAA No data
Right 1103367612 12:120394638-120394660 GGATTGTGCAGACCCAGCTTTGG No data
1103367607_1103367612 15 Left 1103367607 12:120394600-120394622 CCTAATTAACCAGCTAAAGAAAG No data
Right 1103367612 12:120394638-120394660 GGATTGTGCAGACCCAGCTTTGG No data
1103367605_1103367612 19 Left 1103367605 12:120394596-120394618 CCTCCCTAATTAACCAGCTAAAG No data
Right 1103367612 12:120394638-120394660 GGATTGTGCAGACCCAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103367612 Original CRISPR GGATTGTGCAGACCCAGCTT TGG Intergenic
No off target data available for this crispr