ID: 1103371175

View in Genome Browser
Species Human (GRCh38)
Location 12:120420737-120420759
Sequence CTCAGCTACTCGGAAGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103371175_1103371180 4 Left 1103371175 12:120420737-120420759 CCTCCACCTTCCGAGTAGCTGAG No data
Right 1103371180 12:120420764-120420786 CAGGTGTGCACCACCATGCCTGG 0: 1870
1: 7031
2: 30417
3: 78542
4: 159160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103371175 Original CRISPR CTCAGCTACTCGGAAGGTGG AGG (reversed) Intergenic
No off target data available for this crispr